CN103074234A - Marine fungus aspergillus sydowii and application thereof to preparation of anti-tumor medicines - Google Patents
Marine fungus aspergillus sydowii and application thereof to preparation of anti-tumor medicines Download PDFInfo
- Publication number
- CN103074234A CN103074234A CN2012105743321A CN201210574332A CN103074234A CN 103074234 A CN103074234 A CN 103074234A CN 2012105743321 A CN2012105743321 A CN 2012105743321A CN 201210574332 A CN201210574332 A CN 201210574332A CN 103074234 A CN103074234 A CN 103074234A
- Authority
- CN
- China
- Prior art keywords
- extract
- application
- aspergillus
- aspergillus sydowi
- sydowi
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a marine fungus-aspergillus sydowii MNP12010103 with anti-tumor activity and application thereof. The marine fungus was collected into China Center for Type CultureCollection (CCTCC) on October 8th, 2012, wherein the collection number is CCTCC No: M2012391. The invention has the following benefits: (1) the marine fungus-aspergillus sydowii MNP12010103 is simple in nutritional requirement and easy to cultivate; (2) the metabolite of the marine fungus has anti-tumor activity; and (3) the secondary metabolite of the marine fungus has high anti-tumor activity, and the fermented liquid total extractum cultivated by the secondary metabolite has high anti-tumor activity on HepG2, PC12 and U937 cells.
Description
(1) technical field
The present invention relates to the thalassiomycetes that a strain has anti-tumor activity---aspergillus sydowi (Aspergillus sydowii) MNP12010103, and the application in the preparation antitumor drug.
(2) background technology
Cancer always is the difficult problem that the mankind are difficult to capture, and the strong material of searching physiologically active becomes the mankind and captures one of groundwork of disease.Marine microorganism meta-bolites research is emerging research topic in the world in recent years.
In the very long evolutionary process of Marine ecosystems, marine microorganism has formed the unique mechanism that adapts to harsh living environment, and the diversity of the genotype of evolving out, pathways metabolism and physiological ecological function is being contained a large amount of novel secondary metabolites.The lead compound of some marine sources successfully is developed to medicine, comprise the anti-infectives cephamycin (cephalo sporins) that derives from thalassiomycetes, derive from the antitumor drug cytosine arabinoside (cytarabine of sponge, AraC), Antivirus Agent Adenine Arabinoside (vidarabine, AraA), derive from the anodyne conotoxin (ziconotide, Prialt) etc. of cone shell.At present, the whole world also has more than 40 kind marine drug approvals to enter clinical study.
In the past few decades, from marine microorganism, separated in the worldwide and obtained novel cpd kind more than 20000.Studies show that in a large number the meta-bolites structure type of thalassiomycetes mainly contains: cyclic peptide, sterols, Anthraquinones, pyranone, ketal class, contain carbonyl hydroxy kind (Carbonyl compounds, ester and free carboxy chemical combination, hydroxy-containing compounds), nitrogenous class (sulfur-bearing alkaloid compound, piperazines and quinoline azole compounds, pyroles, other azepine condensed ring classes and pyridine compounds and their, acid amides, amine and other nitrogenous compounds).The biologically active substance that thalassiomycetes produces mainly contains: antibacterial substance, anti-tumor active substance.More antitumor, the acetylcholine esterase inhibition of at present research, antibacterium and the thalassiomycetes secondary metabolite such as anti-oxidant have become the abundant source of the natural compounds with biomedical meaning, all have wide prospect in medicine.So find that from the secondary metabolite of thalassiomycetes highly active material for finding very important of lead compound, has an important significance to capturing also of disease.
(3) summary of the invention
The object of the invention provides the thalassiomycetes that a strain has anti-tumor activity---aspergillus sydowi (Aspergillus sydowii) MNP12010103, and the application in the preparation antitumor drug.
The technical solution used in the present invention is:
One strain has the thalassiomycetes of anti-tumor activity---aspergillus sydowi (Aspergillus sydowii) MNP12010103, be preserved in Chinese Typical Representative culture collection center, address: China, Wuhan, Wuhan University, postcode 430072, deposit number: CCTCC No:M 2012391, preservation date on October 8th, 2012.
The colony characteristics of described aspergillus sydowi MNP12010103 is as follows: coating or streak inoculation are cultivated 5d, colony diameter 31mm for 28 ℃ in the upper growth of seawater PDA rapidly on seawater PDA, smooth, central protrusion, quality is velvet-like to cotton-shaped, and the conidium structure is a large amount of, the surface dusty blue is to faint blue, edge white, old rear color depth is without transudate, the bacterium colony reverse side is khaki, and soluble pigment lacks; The thalli growth feature of described aspergillus sydowi is as follows: in the liquid medium within, be the particulate state suspension growth behind 28 ℃ of cultivation 48 h; Described aspergillus sydowi MNP12010103 conidial head sphere is to Radiation, and the microconidium head is like mould shape, cylindricality at random or loose.This kind main feature is the cylindricality conidial head of densification and smooth microconidium, and mycelium is white in color.
Bacterial strain of the present invention is to be obtained by Isolation and screening in the seawater of Zhejiang Province's nutrients collection.
The screening purification process of bacterial strain is: use method of dilution butteron on plate to be applied on the potato plate culture medium in the seawater that gathers, 28 ℃ are cultured to colony counts and no longer increase, and picking list bacterium colony is to slant medium.Cultivate 2d for 28 ℃, select with the difference of strain morphology feature, namely get this bacterial strain, and this bacterial strain is carried out strain identification.
The composition of described plate culture medium and slant medium is identical, consists of: potato 150 ~ 350g/L, and glucose 10 ~ 30g/L, agar 15 ~ 35g/L, solvent are water, pH7.2 ~ 8.0.
With the rDNA-ITS sequence of described aspergillus sydowi Aspergillus sydowii MNP12010103 at the U.S. state-run bioinformation center (National Center for Biotechnology Information USA, NCBI) carry out the homology comparison among the GenBank, be accredited as aspergillus sydowi (Aspergillus sydowii).The sequencing sequence of its rDNA-ITS is as follows:
CTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGAGTGCGGGCTGCCTCCGGGCGCCCAACCTCCCACCCGTGAATACCTAACACTGTTGCTTCGGCGGGGAACCCCCTCGGGGGCGAGCCGCCGGGGACTACTGAACTTCATGCCTGAGAGTGATGCAGTCTGAGTCTGAATATAAAATCAGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAACTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCCCGGCTTGTGTGTTGGGTCGTCGTCCCCCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGTGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCGACTAGGGCCGGCCGGGCGCCAGCCGACGTCTCCAACCATTTTTCTTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA。
The invention still further relates to the application of described aspergillus sydowi MNP12010103 in the preparation antitumor drug.
Concrete, described antitumor drug is the medicine of Hepatoma therapy, neural cancer or lymphatic cancer.
Concrete, described aspergillus sydowi MNP12010103 extract is for the preparation of antitumor drug.
Preferably, described extract is ethyl acetate extract, make by the following method: aspergillus sydowi MNP12010103 is seeded in the liquid fermentation medium, under 25 ~ 35 ℃, 150 ~ 250 r/min oscillating conditions, cultivate 14 ~ 30d, obtain fermented liquid, fermented liquid is used ethyl acetate extraction after removing somatic cells, concentrates and volatilizes to get medicinal extract, is the ethyl acetate extract of described aspergillus sydowi MNP12010103; Described fermention medium consists of: glucose 8 ~ 20 g/L, and peptone 1.5 ~ 3 g/L, yeast extract paste 0.8 ~ 2g/L, solvent are water: the mixture of artificial seawater volume ratio 1:1 ~ 4, pH 7 ~ 8.
Per 100 mL of described artificial seawater consist of: NaCl 2.448 g, Na
2SO
40.3917 g, KCl 0.0664 g, KBr 0.0096 g, SrCl
20.0024 g, MgCl6H
2O 0.4981 g, CaCl
2H
2O 0.1102 g, NaHCO
30.0192 g, H
3BO
30.0026 g, NaF 0.0004 g, distilled water 100 mL.
Described bacterial strain is before fermentation culture, and common the needs activates through slant culture first, then accesses liquid fermentation medium through seed culture, acquisition seed bacterial strain again and produces the enzyme cultivation.
Described slant medium consists of: potato 150 ~ 350g/L, and glucose 10 ~ 30g/L, agar 15 ~ 35g/L, solvent are water, pH7.2 ~ 8.0.
Described plane seed culture medium consists of: glucose 8 ~ 15g/L, and peptone 1.5 ~ 4g/L, yeast extract paste 0.5 ~ 1.5g/L, agar 15 ~ 20g/L, solvent are water: the mixture of artificial seawater volume ratio 1:1 ~ 4, pH7.2 ~ 8.0.
Described liquid fermentation medium consists of: glucose 8 ~ 15g/L, and peptone 1.5 ~ 3g/L, yeast extract paste 0.8 ~ 2g/L, solvent are water: the mixture of artificial seawater volume ratio 1:1 ~ 4, pH7 ~ 8.0.
Concrete, described extract obtains by the following method:
(1) with thalassiomycetes aspergillus sydowi MNP12010103 inoculation in slant medium, cultivate 24 ~ 48 h, the bacterial classification after obtaining activating in 25 ~ 35 ℃; Described slant medium consists of: potato 150 ~ 350g/L, and glucose 10 ~ 30g/L, agar 15 ~ 35g/L, solvent are water, pH7.2 ~ 8.0;
(2) thalassiomycetes aspergillus sydowi MNP12010103 thalline after step (1) activation culture is seeded in the seed culture medium of plane, under 25 ~ 35 ℃ of conditions, cultivates 16 ~ 48h, obtain kind of a daughter bacteria; Described plane seed culture medium consists of: glucose 8 ~ 15 g/L, and peptone 1.5 ~ 4 g/L, yeast extract paste 0.5 ~ 1.5 g/L, agar 15 ~ 20g/L, solvent are water: the mixture of artificial seawater volume ratio 1:1 ~ 4, pH7.2 ~ 8.0;
(3) with the inoculum size of step (2) seed bacterial strain with 1% ~ 10% volume ratio, culture transferring was cultivated 14 ~ 30 days under 25 ~ 35 ℃, 150 ~ 250 r/min oscillating conditions in liquid fermentation medium, obtained fermented liquid; Described liquid fermentation medium consists of: glucose 8 ~ 20 g/L, and peptone 1.5 ~ 3 g/L, yeast extract paste 0.8 ~ 2g/L, solvent are water: the mixture of artificial seawater volume ratio 1:1 ~ 4, pH 7 ~ 8;
(4) with fermented liquid cytoclasis under 4 ℃ of conditions of step (3), centrifugal or filtration, separate and remove thalline, the gained fermented liquid is collected upper layer of extraction liquid after with ethyl acetate extraction, the concentrated total medicinal extract of the oil-like extracts that makes, the i.e. ethyl acetate extract of volatilizing.
Beneficial effect of the present invention is mainly reflected in: simple, the easily cultivation of (1) thalassiomycetes aspergillus sydowi of the present invention MNP12010103 nutritional requirement; (2) meta-bolites of this bacterial strain has anti-tumor activity; (3) anti-tumor activity of the secondary metabolite of this bacterial strain is high, and its total medicinal extract of fermented liquid of cultivating gained has stronger anti-tumor activity to HepG2 cell, PC12 cell and U937 cell.
(4) description of drawings
Fig. 1 is the colonial morphology of aspergillus sydowi MNP12010103 on the plate culture medium;
Fig. 2 is the thalli morphology of aspergillus sydowi MNP12010103 under the opticmicroscope.
(5) embodiment
The present invention is described further below in conjunction with specific embodiment, but protection scope of the present invention is not limited in this:
Embodiment 1: the screening of bacterial strain, purifying and evaluation
(1) will use method of dilution butteron on plate to be applied on the potato plate culture medium from the seawater of East Sea nutrients collection, 28 ℃ be cultured to colony counts and no longer increase, and picking list bacterium colony is to new potato plate culture medium.Cultivate 2d for 28 ℃, select with the difference of strain morphology feature, namely get this bacterial strain.Described potato plate culture medium is prepared by following composition: potato 200g, glucose 20g, agar 20g, distilled water 1000mL.
(2) the PCR product sequence of the rDNA-ITS of the bacterial strain MNP12010103 that screening is obtained is carried out the nucleotide sequence comparison, combining form is learned and is observed, with its called after aspergillus sydowi MNP12010103(Aspergillus sydowii MNP12010103), submit Chinese Typical Representative culture collection center to, preserving number: CCTCC No:M 2012391, preservation date on October 8th, 2012.
Embodiment 2: the activation of bacterial strain and large scale culturing
(1) inoculation that screening among the embodiment 1 is obtained is in slant medium, and in 28 ℃ of cultivation 24-48h, the bacterial strain after obtaining activating, described slant medium are pressed following composition preparation: potato 200g, glucose 20g, agar 20g, distilled water 1000mL.
(2) with the inoculation after step (1) activation culture to plating medium, under 28 ℃, 150 ~ 250 r/min oscillating conditions, cultivate 48h, obtain seed liquor, institute's liquid seed culture medium is prepared by following composition: glucose 10g, peptone 2g, yeast extract paste 1g, agar 15g, distilled water 400mL, artificial seawater 600mL, pH 7.5.
(3) with the inoculum size of step (2) seed bacterial strain with 10% volume ratio, culture transferring is cultivated 21d under 28 ℃, 150 ~ 250 r/min oscillating conditions in the mass liquid fermention medium, obtain fermented liquid.Described liquid fermentation medium is prepared by following composition: glucose 10g, and peptone 2g, yeast extract paste 1g, distilled water 400mL, artificial seawater 600mL, pH 7.5.
Embodiment 3: the antitumor activity of thalassiomycetes aspergillus sydowi MNP12010103
(1) will cultivate the fermented liquid of gained among the embodiment 2 prior to carrying out bacterial cell disruption 20min in the ultrasonic cell disruption instrument, then centrifugal (9000r/min under 4 ℃ of conditions, 15min) or filter, remove thalline, extract with ethyl acetate, extraction phase is revolved steaming, and gained medicinal extract is the total medicinal extract of secondary metabolite of this bacterial strain.
(2) the total medicinal extract of fermented liquid with step (1) gained carries out antitumor cytolytic activity.Concrete steps are as follows: choose three strain tumour cells, be respectively Adrenal Pheochromocytoma cell (PC12 cell), liver cancer cell (HepG2 cell) and human tissue cell's lymphoma cell (U937 cell), the cell strain of phase of taking the logarithm is made cell suspension, be inoculated in 96 orifice plates, cultivate 48h, after testing sample (total medicinal extract) adds 0.1% DMSO10 μ L dissolving, 1640 cell culture mediums dilution with serum-free, add 100 μ L to test group, so that the concentration of the final total medicinal extract of fermented liquid is respectively 50 μ g/mL, 100 μ g/mL, 200 μ g/mL, 400 μ g/mL, 800 μ g/mL, negative control group adds the serum free medium that equivalent does not contain sample, the blank group then is acellular and serum free medium sample, Etoposide (VP-16) is as positive reference substance, each concentration is established 5 multiple holes, tumour cell is cultivated 48h at CO2 incubator (37 ℃), every hole adds the MTT20 μ L of 5mg/mL, after continuing to cultivate 4h, carefully remove supernatant, every hole adds DMSO150 μ L, vibration 10min, fully vibrate so that MTT purple product dissolves fully with microplate reader, survey the A value of 490nm, according to formula: inhibiting rate=(A negative control group-A blank group)-(A sample sets-A blank group)/(A negative control group-A blank group) can be tried to achieve inhibiting rate.
(3) data according to step (1)-(3) gained see Table 1 ~ 3.
Table 1: bacterial strain fermentation liquor medicinal extract is to the restraining effect of HepG2 cell
Table 2: bacterial strain fermentation liquor medicinal extract is to the restraining effect of U937 cell
Table 3: bacterial strain fermentation liquor medicinal extract is to the restraining effect of PC12 cell
Can be got by data in the table: the anti-tumor activity of the secondary metabolite of thalassiomycetes aspergillus sydowi MNP12010103 is high, its total medicinal extract of fermented liquid of cultivating gained has stronger anti-tumor activity to liver cancer cell (HepG2 cell) and human tissue cell's lymphoma cell (U937 cell), and Adrenal Pheochromocytoma cell (PC12 cell) is also had certain anti-tumor activity.
Claims (6)
1. a strain has the thalassiomycetes of anti-tumor activity---aspergillus sydowi (Aspergillus sydowii) MNP12010103, be preserved in Chinese Typical Representative culture collection center, address: China, Wuhan, Wuhan University, postcode 430072, deposit number: CCTCC No:M 2012391, preservation date on October 8th, 2012.
2. aspergillus sydowi MNP12010103 as claimed in claim 1 is characterized in that the sequencing sequence of its rDNA-ITS is as follows:
CTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGAGTGCGGGCTGCCTCCGGGCGCCCAACCTCCCACCCGTGAATACCTAACACTGTTGCTTCGGCGGGGAACCCCCTCGGGGGCGAGCCGCCGGGGACTACTGAACTTCATGCCTGAGAGTGATGCAGTCTGAGTCTGAATATAAAATCAGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAACTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCCCGGCTTGTGTGTTGGGTCGTCGTCCCCCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGTGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCGACTAGGGCCGGCCGGGCGCCAGCCGACGTCTCCAACCATTTTTCTTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA。
3. the application of aspergillus sydowi MNP12010103 claimed in claim 1 in the preparation antitumor drug.
4. application as claimed in claim 3 is characterized in that described antitumor drug is the medicine of Hepatoma therapy, neural cancer or lymphatic cancer.
5. such as claim 3 or 4 described application, it is characterized in that aspergillus sydowi MNP12010103 extract is for the preparation of antitumor drug.
6. application as claimed in claim 5, it is characterized in that described extract is ethyl acetate extract, make by the following method: aspergillus sydowi MNP12010103 is seeded in the liquid fermentation medium, under 25 ~ 35 ℃, 150 ~ 250 r/min oscillating conditions, cultivate 14 ~ 30d, obtain fermented liquid, fermented liquid is used ethyl acetate extraction after removing somatic cells, concentrates and volatilizes to get medicinal extract, is the ethyl acetate extract of described aspergillus sydowi MNP12010103; Described fermention medium consists of: glucose 8 ~ 20 g/L, and peptone 1.5 ~ 3 g/L, yeast extract paste 0.8 ~ 2g/L, solvent are water: the mixture of artificial seawater volume ratio 1:1 ~ 4, pH 7 ~ 8.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210574332.1A CN103074234B (en) | 2012-12-25 | 2012-12-25 | Marine fungus aspergillus sydowii and application thereof to preparation of anti-tumor medicines |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210574332.1A CN103074234B (en) | 2012-12-25 | 2012-12-25 | Marine fungus aspergillus sydowii and application thereof to preparation of anti-tumor medicines |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103074234A true CN103074234A (en) | 2013-05-01 |
| CN103074234B CN103074234B (en) | 2015-03-04 |
Family
ID=48150933
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210574332.1A Active CN103074234B (en) | 2012-12-25 | 2012-12-25 | Marine fungus aspergillus sydowii and application thereof to preparation of anti-tumor medicines |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103074234B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107893090A (en) * | 2017-10-20 | 2018-04-10 | 国家海洋局第三海洋研究所 | Application of the Aspergillus terreus H768 fermented cpds in Claritin is prepared |
| CN109112171A (en) * | 2018-09-28 | 2019-01-01 | 广州市雅薏诗化妆品有限公司 | A kind of preparation method of the antibacterial substance based on marine microorganism |
| CN110438012A (en) * | 2019-08-05 | 2019-11-12 | 四川大学 | It is a kind of produce anthocyanidin aspergillus sydowi H-1 and its application |
| CN114752508A (en) * | 2022-04-28 | 2022-07-15 | 浙江工业大学 | Aspergillus sydowii MNP-2 and use in synthesis of dibenzoxepin |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0438813A1 (en) * | 1990-01-26 | 1991-07-31 | Hoechst Aktiengesellschaft | A novel antibiotic, Deoxymulundocandin, a process for its production and its use as medicament |
| CN101787023A (en) * | 2010-02-10 | 2010-07-28 | 浙江工业大学 | Dimer salt of quinoline alkaloid, preparation method and application thereof |
-
2012
- 2012-12-25 CN CN201210574332.1A patent/CN103074234B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0438813A1 (en) * | 1990-01-26 | 1991-07-31 | Hoechst Aktiengesellschaft | A novel antibiotic, Deoxymulundocandin, a process for its production and its use as medicament |
| CN101787023A (en) * | 2010-02-10 | 2010-07-28 | 浙江工业大学 | Dimer salt of quinoline alkaloid, preparation method and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| HE FEI ET AL: "Indole alkaloids from marine-derived fungus Aspergillus sydowii SCSIO 00305", 《THE JOURNAL OF ANTIBIOTICS》, 21 December 2011 (2011-12-21), pages 109 - 111 * |
| 任虹等: "真菌萨氏曲霉D 2-6抗肿瘤活性代谢产物", 《中国药学杂志》, vol. 46, no. 8, 30 April 2011 (2011-04-30), pages 569 - 575 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107893090A (en) * | 2017-10-20 | 2018-04-10 | 国家海洋局第三海洋研究所 | Application of the Aspergillus terreus H768 fermented cpds in Claritin is prepared |
| CN107893090B (en) * | 2017-10-20 | 2020-05-15 | 国家海洋局第三海洋研究所 | Application of fermentation compound of aspergillus terreus H768 in preparation of antiallergic drugs |
| CN109112171A (en) * | 2018-09-28 | 2019-01-01 | 广州市雅薏诗化妆品有限公司 | A kind of preparation method of the antibacterial substance based on marine microorganism |
| CN110438012A (en) * | 2019-08-05 | 2019-11-12 | 四川大学 | It is a kind of produce anthocyanidin aspergillus sydowi H-1 and its application |
| CN110438012B (en) * | 2019-08-05 | 2021-10-26 | 四川大学 | Aspergillus sakazakii H-1 for producing anthocyanin and application thereof |
| CN114752508A (en) * | 2022-04-28 | 2022-07-15 | 浙江工业大学 | Aspergillus sydowii MNP-2 and use in synthesis of dibenzoxepin |
| CN114752508B (en) * | 2022-04-28 | 2023-09-05 | 浙江工业大学 | Aspergillus polypolypolyvidone MNP-2 and application thereof in synthesis of dibenzooxazepine compounds |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103074234B (en) | 2015-03-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103074233B (en) | Marine fungus penicillium chrysogenum and application thereof to preparation of anti-tumor medicines | |
| CN103114064B (en) | Marine actinomycete with antibacterial activity to multiple plant pathogens | |
| CN103074234B (en) | Marine fungus aspergillus sydowii and application thereof to preparation of anti-tumor medicines | |
| CN103122318B (en) | Marine fungus penicillium citrinum and application thereof in preparing anti-tumor drugs | |
| CN103074275B (en) | Lysinibacillus fusiformis for producing ethyl urethane hydrolase and application of lysinibacillus fusiformis | |
| CN101993847B (en) | Bacterial cellulose strain | |
| CN102792855A (en) | Cordyceps sinensis host infection strain material and method | |
| CN102342218A (en) | Method for producing cordyceps sinensis hyphae by virtue of solid-state fermentation | |
| CN101857841B (en) | Marine fungi aspergillus unguis strain, active extract thereof and preparation method and use of active extract thereof and active components thereof | |
| CN103667072B (en) | A kind of Huperzia serrata endogenetic epiphyte and the application at preparation 8 α, 15 α-epoxidation selagine thereof | |
| CN102911877B (en) | Marine fungi cladosporium sphaerospermum and application thereof | |
| CN104762229B (en) | A kind of bacillus subtilis strain and its application | |
| CN100567318C (en) | Nucleoside active matter in the artificial culture Cordyceps militaris (L.) Link. and its production and use | |
| CN102911876A (en) | Marine fungus mucor circinelloides and application thereof in preparation of antineoplastic drugs | |
| CN103283482B (en) | Cordyceps militaris, cultivation method and separation method | |
| CN1316519A (en) | Process for preparing ganoderic polyose and ganoderic acid by fermentation during which raw materials are supplemented | |
| CN110024623A (en) | L-PROLINE is improving the application in aweto blastopore quantity and hypha biomass | |
| CN102925372B (en) | Marine fungus rhodotorula minuta and application thereof in preparing anti-tumor medicines | |
| CN102994433B (en) | Acid producing klebsiella oxytoca for synthesizing acidity ethyl carbamate hydrolase and application thereof | |
| CN103103134A (en) | Huperzia serrata endophytic fungi and its use in production of huperzine a | |
| CN103045514B (en) | Proteus mirabilis for synthetizing acidic ethyl urethane hydrolytic enzyme and application thereof | |
| TW201139662A (en) | A formula of culturing medium for Cordyceps spp. | |
| CN101407767A (en) | Method for producing Chinese caterpillar fungus by fermentation | |
| CN108085273A (en) | One plant of streptomyces antifungus and its metabolin, metabolin preparation method and application | |
| CN102584615A (en) | Alkaloid compound as well as preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |