CN101857841B - Marine fungi aspergillus unguis strain, active extract thereof and preparation method and use of active extract thereof and active components thereof - Google Patents
Marine fungi aspergillus unguis strain, active extract thereof and preparation method and use of active extract thereof and active components thereof Download PDFInfo
- Publication number
- CN101857841B CN101857841B CN2009102205397A CN200910220539A CN101857841B CN 101857841 B CN101857841 B CN 101857841B CN 2009102205397 A CN2009102205397 A CN 2009102205397A CN 200910220539 A CN200910220539 A CN 200910220539A CN 101857841 B CN101857841 B CN 101857841B
- Authority
- CN
- China
- Prior art keywords
- extract
- active
- aspergillus
- artificial seawater
- methanol
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Abstract
The invention belongs to a stain of biological field and relates to marine fungi aspergillus unguis, active extract thereof and a preparation method and the use of the active extract thereof and active components thereof. A stain of marine fungi strain DLEP2008001 separated from Dalian sea area is appraised as aspergillus unguis. After the bacterial stain is fermented in a shake flask, the ethyl acetate extract of the fermentation liquor of the bacterial strain is combined with the alcohol extract of mycelia to form the total coarse extract having methyl penicillin-resistant staphylococcus aureus, pseudomonas aeruginosa and Candida albicans resistance activities; and the extract is subjected to silica gel column chromatography, silica gel thin-layer chromatography and reversed-phase high-efficiency liquid phase separation to obtain two active ingredients, namely a white powder component 1 and a component 2. The extract has remarkable antibacterial activities for the methyl penicillin-resistant staphylococcus aureus, the pseudomonas aeruginosa and the Candida albicans and has potential use as an antibacterial agent.
Description
Technical field
The present invention relates to the activity extract of strain thalassiomycetes pawl aspergillus a DLEP2008001, particularly this strain culture and the method for making and this extract and the purposes of component aspect antibacterium, fungi-medicine of active ingredient.
Background technology
The resistance of the present mikrobe that in clinical treatment, finds the cause of disease is more and more stronger; Especially the infection that causes of the penicillium mould of anti-methoxyl group streptococcus aureus (MRSA), Pseudomonas aeruginosa (being commonly called as Pseudomonas aeruginosa) and white candiyeast (being commonly called as Candida albicans) is more and more serious; Therefore a lot of traditional microbiotic are lost curative effect basically, are necessary to seek novel microbiotic and antibiotics generated bacterium is dealt with this challenge.Near for more than half a century discover the source of land mikrobe as new antibiotic, its potentiality are exhausted day by day.And the new drug development of made from ocean microorganism is a worldwide research hot issue of 21st century, with its novel bacterial source, produce the new texture active substance, overcome traditional antibiotic resistance and realize characteristics such as resource is sustainable and be the common concern of people institute.Thalassiomycetes have be easy to cultivate, characteristics that meta-bolites is abundant; From various thalassiomycetess, be separated at present antibacterium microbiotic, antifungal antibiotic, antiviral antibiotic, antitumor antibiotics and some anti-inflammatories and analgesic active substance, the enzyme inhibitors etc. of many novel structures, therefore can be used as the valuable source of medicine such as new antibiotic.
Summary of the invention
The object of the present invention is to provide a kind of activity extract and active ingredient thereof of thalassiomycetes pawl Aspergillus strain nutrient solution.
Another object of the present invention has provided the preparation and the separation method of this activity extract and active ingredient.
Further aim of the present invention has provided this activity extract and the application of active ingredient in preparation antibacterium, fungi-medicine.
The contriver requires to protect thalassiomycetes pawl aspergillus DLEP2008001 itself simultaneously.
A strain thalassiomycetes pawl aspergillus DLEP2008001 who the present invention relates to separates from her algae body surface of the fan-shaped plan of a kind of sea life in DaLian, China marine site to obtain.The growth salt concn scope that this bacterial strain is suitable is 2.0%～5.0%; Resistance streptococcus aureus, Pseudomonas aeruginosa and white candiyeast all there is resistance.According to " fungi identification handbook " (Wei Jingchao; 1979); Through being accredited as pawl aspergillus Aspergillus unguisDLEP2008001 bacterial strain; China Committee for Culture Collection of Microorganisms's common micro-organisms center (it abbreviates CGMCC as), depositary institution address have been deposited in on October 29th, 2009: No. 3 Institute of Microorganism, Academia Sinica in Yard 1, BeiChen xi Road, Chaoyang District, Beijing City.Deposit number is: CGMCC No.3372.
Thalassiomycetes pawl aspergillus DLEP2008001 has property: be inoculated on seawater potato sucrose substratum (seawater PSA) flat board; 30 ℃ of cultivations, bacterium colony begin to be white, circle; To expansion all around; The back produces the greyish-green spore from bacterium colony mediad edge, the colony edge color is slightly shallow, and it is loose cotton-shaped that whole bacterium colony is.Mycelial growth is slower, cultivates 2 days colony diameters and only reaches 0.7cm.Have typical radial spherical conidial head, 6 to 10 conidiums that the spore head is concatenated by the top capsule that expands, peripheral nascent stigma, secondary stigma and each the secondary stigma top of top capsule are formed, and spore is circular, green; The conidiophore base portion has podocyte.26～30 ℃ of optimum growth temp scopes, optimum growh pH is 6.0～7.0, carbon sources such as glucose capable of using, sucrose, lactose.This bacterial strain shaker fermentation in seawater potato sucrose liquid nutrient medium can produce antibacterial substance.
The ITS1-5.8S-ITS2rDNA sequence (533bp) of thalassiomycetes pawl aspergillus DLEP2008001 is submitted to the GenBank geneseq database of American National biotechnology information center (NCBI), and the number of landing is GU117635.Its complete sequence is following:
GCGGGCTGCCTCCGGGCGCCCAACCTCCCACCCTTGAATACTAAACACTGTTGCTTCGGCGGGGAGCCCCTTCCGGGGGGCAAGCCGCCGGGGACCACTGAACTTCATGCCTGAGAGTGATGCAGTCTGAGTCTGAATTATAAATCAGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAACTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTTCAAGCCCGGCTTGTGTGTTGGGTCGTCGTCCCCCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGTGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCGATTAGGGCCGGCCGGGC
GCCAGCCGGCGTCATCAATCTATTTTACCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAAGA
This thalassiomycetes bacterial strain pawl aspergillus DLEP2008001 can utilize the conventional bottle method of shaking to cultivate, and can contain the carbon source, nitrogenous source and other nutrition source that are useful on microorganism culturing in the substratum, and illumination is not had strict restriction, is as the criterion to be suitable for this strain growth.When being purpose with preparation anti-microbial activity product; Factors such as the component of substratum, ionic strength, potential of hydrogen, culture temperature, dress liquid coefficient, shaking speed, culture cycle can influence the yield of activity extract, and fermentation culture should select to make the highest condition of the yield of activity extract of culture for well.Culture by above gained sets out; Just can extract active ingredient wherein through some appropriate means; These methods are the methods that are usually used in extracting metabolite; Activity extract for example capable of using and other impurity extract in the difference of aspects such as solubleness, ionic bond power, absorption avidity and molecular weight, and these methods can be used separately, also can proper fit or use repeatedly.Wherein, cultivate thalassiomycetes bacterial strain pawl aspergillus DLEP2008001 with following substratum, cultural method and process for extracting and produce microbiotic the best:
The seed solid medium:
Sucrose 20.0g;
Yam liquor 500ml;
Artificial seawater or 4% half artificial seawater 500ml;
Agar 15.0g;
Nature pH value.
Liquid nutrient medium is:
Sucrose 20.0g;
Yam liquor 500ml;
Artificial seawater or 4% half artificial seawater 500ml;
Nature pH value.
Yam liquor: get the fresh potato peeling and be cut into 1cm
3Size is block, and every 200g potato ball adding distil water 500ml boils 20min, and double-deck absorbent gauze filters, and is settled to 500ml with zero(ppm) water.
Artificial seawater: NaCl 25.0g, Na
2SO
44.0g, KCl 0.70g, NaHCO
30.20g, KBr 0.10g, H
3BO
30.03g, NaF 0.003g, MgCl
25.04g, CaCl
21.11g, SrCl
20.014g, being dissolved in 1000ml zero(ppm) water, filtration obtains.
The thick natural sea salt of 4% half artificial seawater: 40g is dissolved in 1000ml zero(ppm) water, and filtration obtains.
A. seed culture: bacterial classification is transferred on the aseptic solid medium flat board from the inclined-plane, places constant incubator to cultivate down for 26～30 ℃ the petridish flat board.Incubation time is 4～7 days;
B. enlarged culturing: liquid nutrient medium is filled in the ventilative fungi-proofing Glass Containers, and dress liquid coefficient is 0.15～0.25, seals back 121 ℃, 0.105Mpa in the high-pressure sterilizer 20min that sterilizes; The above-mentioned seed flat board agar block 40～80cm that carries disease germs is inoculated by every 1000ml liquid nutrient medium in cooling back
2The ratio inoculation is sealed, and places the constant-temperature shaking culture case with 160～200rpm rotating speed, in 26～30 ℃ of cultivations down, natural lighting.Incubation time is 5～9 days;
C. extract: the nutrient solution that will accomplish the enlarged culturing process filters with double-deck absorbent gauze and obtains clarified broth and mycelium respectively; Fermented liquid is with equal-volume ethyl acetate extraction 4 times; The mycelium that every 1000ml fermented liquid obtains is with 200ml anhydrous methanol soaking and extracting four times; Each 12h uses Rotary Evaporators in 50 ℃ of concentrating under reduced pressure respectively the ethyl acetate extract and the mycelium methanol extract of fermented liquid, and last united extraction thing continues with Rotary Evaporators in 50 ℃ of evaporated under reduced pressure; Obtain a dried solid, be the gross activity crude extract;
D. purify: above-mentioned gross activity crude extract is dissolved in small amount of methanol; Join 100～200 order silica gel that equate with its dry weight; Mix and the even extremely drying of grinding; Be splined on 20～50 times on 200～300 order silica gel column chromatographies of sample dry weight; With following eluent gradient elution progressively: sherwood oil: methylene dichloride=1: 2～1: 3 (v/v), absolute dichloromethane, methylene dichloride: methyl alcohol=100: 1～2: 1 (v/v), adopt thin-layer chromatography and thin-layer chromatography biological activity autography method to follow the trail of active ingredient.Again with the active ingredient point sample in preparation type silica gel thin-layer plate, use methylene dichloride: methyl alcohol=60: 1～20: 1 launches, and active band is scraped respectively, uses methanol-eluted fractions.Be further purified through HPLC respectively behind the wash-out phase evaporate to dryness, use C
18Reversed-phase column, use volumetric concentration be 60～100% methanol-water as moving phase, carry out 35 minutes gradient elutions; Flow velocity 0.6ml/min; Detect the 254nm uv-absorbing, follow the trail of through active chromatogram, prepare respectively RT at the active peak of 9～15min and 4～9min component; The elutriant that will contain active ingredient is used the Rotary Evaporators evaporated under reduced pressure, gets two parts of white powder components 1 and component 2.Tlc analysis shows that the chromatography developping agent is a methylene dichloride: methyl alcohol=40: 1 o'clock, component 1 is at GF
254The Rf value is 0.64 on the thin-layer silicon offset plate, and the Rf value of component 2 is 0.38, this two component under the 254nm UV-irradiation at GF
254Present mulberry on the silica-gel plate.
From thalassiomycetes bacterial strain pawl aspergillus DLEP2008001, extract activity extract and the active ingredient that obtains among the present invention; Screen through antimicrobial model; Adopt micro-broth dilution method (National Committee forClinical Laboratory Standards.2003.Methods for dilution antimicrobialsusceptibility tests for bacteria that grow aerobically, 5th ed.Approved standardM7-A6.; National Committee for Clinical Laboratory Standards.1997.Reference methed for broth dilution antifungal susceptibility testing of yeasts:approvedstandard M27-A; 7th ed.NCCLS; Wayne; Pa.) mensuration is to the MIC value of streptococcus aureus (MRSA), Pseudomonas aeruginosa and the white candiyeast of the penicillium mould of anti-the methoxyl group; Confirm that the fermented liquid ethyl acetate extract of its nutrient solution and the total thick extraction that the merging of mycelium methanol extract obtains have anti-MRSA streptococcus aureus, Pseudomonas aeruginosa and weak anti-saccharomyces albicans activity, its MIC value is respectively 8 μ g/mL, 4 μ g/mL reach＞128 μ g/mL (inhibiting rate is 35.0% under the 128 μ g/mL dosage); The MIC value of the active ingredient 1 anti-MRSA for preparing is 16 μ g/mL, and the MIC value of resisting pseudomonas aeruginosa is 8 μ g/mL, and the MIC value of anti-white candiyeast is 16 μ g/mL; The MIC value of the active ingredient 2 anti-MRSA that prepare is 8 μ g/mL, and the MIC value of resisting pseudomonas aeruginosa is 16 μ g/mL, and the MIC value of anti-white candiyeast is＞128 μ g/mL (inhibiting rate is 71.5% under the 128 μ g/mL dosage).
Utilize activity extract of the present invention and active principle wherein, can be used to prepare the antimicrobial medicine.
Below with embodiment the present invention is described further.
Embodiment
Embodiment 1.
The seed solid medium:
Sucrose 20.0g;
Yam liquor 500ml;
Agar 15.0g;
4% half artificial seawater 500ml;
Nature pH value.
Liquid nutrient medium:
Sucrose 20.0g;
Yam liquor 500ml;
4% half artificial seawater 500ml;
Nature pH value.
Yam liquor: get the fresh potato peeling and be cut into 1cm
3Size is block, and every 200g potato ball adding distil water 500ml boils 20min, and double-deck absorbent gauze filters, and is settled to 500ml with zero(ppm) water.
The thick natural sea salt of 4% half artificial seawater: 40g is dissolved in 1000ml zero(ppm) water, and filtration obtains.
A. seed culture: bacterial classification is transferred on the aseptic solid medium flat board from the inclined-plane, places constant incubator to cultivate down for 28 ℃ the petridish flat board.Incubation time is 5 days;
B. enlarged culturing: liquid nutrient medium is filled in the ventilative fungi-proofing Glass Containers, and dress liquid coefficient is 0.15, seals back 121 ℃, 0.105Mpa in the high-pressure sterilizer 20min that sterilizes; The above-mentioned seed flat board agar block 40cm that carries disease germs is inoculated by every 1000ml liquid nutrient medium in cooling back
2The ratio inoculation is sealed, and places the constant-temperature shaking culture case with the 180rpm rotating speed, in 28 ℃ of cultivations down, natural lighting.Incubation time is 6 days;
C. extract: the nutrient solution that will accomplish the enlarged culturing process filters with double-deck absorbent gauze and obtains clarified broth and mycelium respectively; Fermented liquid is with equal-volume ethyl acetate extraction 4 times; The mycelium that every 1000ml fermented liquid obtains is with 200ml anhydrous methanol soaking and extracting four times; Each 12h uses Rotary Evaporators in 50 ℃ of concentrating under reduced pressure respectively the ethyl acetate extract and the mycelium methanol extract of fermented liquid, and last united extraction thing continues with Rotary Evaporators in 50 ℃ of evaporated under reduced pressure; Obtain a dried solid, be the gross activity crude extract;
D. purify: above-mentioned gross activity crude extract is dissolved in small amount of methanol; Join 100～200 order silica gel that equate with its dry weight; Mix and the even extremely drying of grinding; Be splined on 20 times on 200～300 order silica gel column chromatographies of sample dry weight, with following eluent gradient elution progressively: sherwood oil: methylene dichloride=1: 2～1: 3 (v/v), absolute dichloromethane, methylene dichloride: methyl alcohol=100: 1～2: 1 (v/v), adopt thin-layer chromatography and thin-layer chromatography biological activity autography method to follow the trail of active ingredient.Again with the active ingredient point sample in preparation type silica gel thin-layer plate, use methylene dichloride: methyl alcohol=20: 1 launches, and active band is scraped respectively, uses methanol-eluted fractions.Be further purified through HPLC respectively behind the wash-out phase evaporate to dryness, use C
18Reversed-phase column, use volumetric concentration be 60～100% methanol-water as moving phase, carry out 35 minutes gradient elutions; Flow velocity 0.6ml/min; Detect the 254nm uv-absorbing, follow the trail of through active chromatogram, prepare respectively RT at the active peak of 9～15min and 4～9min component; The elutriant that will contain active ingredient is used the Rotary Evaporators evaporated under reduced pressure, gets two parts of white powder components 1 and component 2.Tlc analysis shows that the chromatography developping agent is a methylene dichloride: methyl alcohol=40: 1 o'clock, component 1 is at GF
254The Rf value is 0.64 on the thin-layer silicon offset plate, and the Rf value of component 2 is 0.38, this two component under the 254nm UV-irradiation at GF
254Present mulberry on the silica-gel plate.
Embodiment 2.
The seed solid medium:
Sucrose 20.0g;
Yam liquor 500ml;
Artificial seawater 500ml;
Agar 15.0g;
Nature pH value.
Liquid nutrient medium:
Sucrose 20.0g;
Yam liquor 500ml;
Artificial seawater 500ml;
Nature pH value.
Yam liquor: get the fresh potato peeling and be cut into 1cm
3Size is block, and every 200g potato ball adding distil water 500ml boils 20min, and double-deck absorbent gauze filters, and is settled to 500ml with zero(ppm) water.
Artificial seawater: NaCl 25.0g, Na
2SO
44.0g, KCl 0.70g, NaHCO
30.20g, KBr 0.10g, H
3BO
30.03g, NaF 0.003g, MgCl
25.04g, CaCl
21.11g, SrCl
20.014g, being dissolved in 1000ml zero(ppm) water, filtration obtains.
A. seed culture: bacterial classification is transferred on the aseptic solid medium flat board from the inclined-plane, places constant incubator to cultivate down for 28 ℃ the petridish flat board.Incubation time is 5 days;
B. enlarged culturing: liquid nutrient medium is filled in the ventilative fungi-proofing Glass Containers, and dress liquid coefficient is 0.20, seals back 121 ℃, 0.105Mpa in the high-pressure sterilizer 20min that sterilizes; The above-mentioned seed flat board agar block 80cm that carries disease germs is inoculated by every 1000ml liquid nutrient medium in cooling back
2The ratio inoculation is sealed, and places the constant-temperature shaking culture case with the 180rpm rotating speed, in 28 ℃ of cultivations down, natural lighting.Incubation time is 7 days;
C. extract: the nutrient solution that will accomplish the enlarged culturing process filters with double-deck absorbent gauze and obtains clarified broth and mycelium respectively; Fermented liquid is with equal-volume ethyl acetate extraction 4 times; The mycelium that every 1000ml fermented liquid obtains is with 200ml anhydrous methanol soaking and extracting four times; Each 12h uses Rotary Evaporators in 50 ℃ of concentrating under reduced pressure respectively the ethyl acetate extract and the mycelium methanol extract of fermented liquid, and last united extraction thing continues with Rotary Evaporators in 50 ℃ of evaporated under reduced pressure; Obtain a dried solid, be the gross activity crude extract;
D. purify: above-mentioned gross activity crude extract is dissolved in small amount of methanol; Join 100～200 order silica gel that equate with its dry weight; Mix and the even extremely drying of grinding; Be splined on 40 times on 200～300 order silica gel column chromatographies of sample dry weight, with following eluent gradient elution progressively: sherwood oil: methylene dichloride=1: 2～1: 3 (v/v), absolute dichloromethane, methylene dichloride: methyl alcohol=100: 1～2: 1 (v/v), adopt thin-layer chromatography and thin-layer chromatography biological activity autography method to follow the trail of active ingredient.Again with the active ingredient point sample in preparation type silica gel thin-layer plate, use methylene dichloride: methyl alcohol=40: 1 launches, and active band is scraped respectively, uses methanol-eluted fractions.Be further purified through HPLC respectively behind the wash-out phase evaporate to dryness, use C
18Reversed-phase column, use volumetric concentration be 60～100% methanol-water as moving phase, carry out 35 minutes gradient elutions; Flow velocity 0.6ml/min; Detect the 254nm uv-absorbing, follow the trail of through active chromatogram, prepare respectively RT at the active peak of 9～15min and 4～9min component; The elutriant that will contain active ingredient is used the Rotary Evaporators evaporated under reduced pressure, gets two parts of white powder components 1 and component 2.Tlc analysis shows that the chromatography developping agent is a methylene dichloride: methyl alcohol=40: 1 o'clock, component 1 is at GF
254The Rf value is 0.64 on the thin-layer silicon offset plate, and the Rf value of component 2 is 0.38, this two component under the 254nm UV-irradiation at GF
254Present mulberry on the silica-gel plate.
Embodiment 3. activity extracts and active ingredient determination of activity result
Adopt micro-broth dilution method (National Committee for Clinical Laboratory Standards.2003.Methods for dilution antimicrobial susceptibility tests for bacteria that growaerobically, 5th ed.Approved standard M7-A6.; National Committee for ClinicalLaboratory Standards.1997.Reference methed for broth dilution antifungalsusceptibility testing of yeasts:approved standard M27-A; 7th ed.NCCLS; Wayne; Pa.) mensuration is to the MIC value of streptococcus aureus (MRSA), Pseudomonas aeruginosa and the white candiyeast of the penicillium mould of anti-the methoxyl group; Confirm that the fermented liquid ethyl acetate extract of its nutrient solution and the total thick extraction that the merging of mycelium methanol extract obtains have anti-MRSA streptococcus aureus, Pseudomonas aeruginosa and weak anti-saccharomyces albicans activity, its MIC value is respectively 8 μ g/mL, 4 μ g/mL reach＞128 μ g/mL (inhibiting rate is 35.0% under the 128 μ g/mL dosage); The MIC value of the active ingredient 1 anti-MRSA for preparing is 16 μ g/mL, and the MIC value of resisting pseudomonas aeruginosa is 8 μ g/mL, and the MIC value of anti-white candiyeast is 16 μ g/mL; The MIC value of the active ingredient 2 anti-MRSA that prepare is 8 μ g/mL, and the MIC value of resisting pseudomonas aeruginosa is 16 μ g/mL, and the MIC value of anti-white candiyeast is＞128 μ g/mL (inhibiting rate is 71.5% under the 128 μ g/mL dosage).
Sequence table
SEQUENCE?LISTING
< 110>Dalian University Of Communications
The method for making and the purposes of < 120>one strain thalassiomycetes pawl aspergillus, its activity extract and activity extract and active ingredient
<160>1
<170>PatentIn?version?3.3
<210>1
<211>533
<212>DNA
< 213>the ITS1-5.8S-ITS2 rDNA sequence of thalassiomycetes pawl aspergillus DLEP2008001
<400>1
gcgggctgcc?tccgggcgcc?caacctccca?cccttgaata?ctaaacactg?ttgcttcggc 60
ggggagcccc?ttccgggggg?caagccgccg?gggaccactg?aacttcatgc?ctgagagtga 120
tgcagtctga?gtctgaatta?taaatcagtc?aaaactttca?acaatggatc?tcttggttcc 180
ggcatcgatg?aagaacgcag?cgaactgcga?taagtaatgt?gaattgcaga?attcagtgaa 240
tcatcgagtc?tttgaacgca?cattgcgccc?cctggcattc?cggggggcat?gcctgtccga 300
gcgtcattgc?tgcccttcaa?gcccggcttg?tgtgttgggt?cgtcgtcccc?cccgggggac 360
gggcccgaaa?ggcagcggcg?gcaccgtgtc?cggtcctcga?gcgtatgggg?ctttgtcacc 420
cgctcgatta?gggccggccg?ggcgccagcc?ggcgtcatca?atctatttta?ccaggttgac 480
ctcggatcag?gtagggatac?ccgctgaact?taagcatatc?aataagcgga?aga 533
Claims (5)
1. strain thalassiomycetes pawl aspergillus (Aspergillus unguis) DLEP2008001 CGMCC No.3372,
Its ITS1-5.8S-ITS2rDNA sequence.
2. the gross activity crude extract of the nutrient solution of strain thalassiomycetes pawl as claimed in claim 1 aspergillus (Aspergillrs unguis) DLEP2008001CGMCC No.3372,
Described gross activity crude extract leaching process does
The seed solid medium:
Sucrose 20.0g;
Yam liquor 500ml;
Agar 15.0g;
4% half artificial seawater 500ml;
Nature pH value;
Liquid nutrient medium:
Sucrose 20.0g;
Yam liquor 500ml;
4% half artificial seawater 500ml;
Nature pH value;
Yam liquor: get the fresh potato peeling and be cut into 1cm
3Size is block, and every 200g potato ball adding distil water 500ml boils 20min, and double-deck absorbent gauze filters, and is settled to 500ml with zero(ppm) water; The thick natural sea salt of 4% half artificial seawater: 40g is dissolved in 1000ml zero(ppm) water, and filtration obtains;
A. seed culture: bacterial classification is transferred on the aseptic solid medium flat board from the inclined-plane, places constant incubator to cultivate down for 28 ℃ the petridish flat board; Incubation time is 5 days;
B. enlarged culturing: liquid nutrient medium is filled in the ventilative fungi-proofing Glass Containers, and dress liquid coefficient is 0.15, seals back 121 ℃, 0.105Mpa in the high-pressure sterilizer 20min that sterilizes; The above-mentioned seed flat board agar block 40cm that carries disease germs is inoculated by every 1000ml liquid nutrient medium in cooling back
2The ratio inoculation is sealed, and places the constant-temperature shaking culture case with the 180rpm rotating speed, in 28 ℃ of cultivations down, natural lighting, and incubation time is 6 days;
C. extract: the nutrient solution that will accomplish the enlarged culturing process filters with double-deck absorbent gauze and obtains clarified broth and mycelium respectively; Fermented liquid is with equal-volume ethyl acetate extraction 4 times; The mycelium that every 1000ml fermented liquid obtains is with 200ml anhydrous methanol soaking and extracting four times; Each 12h uses Rotary Evaporators in 50 ℃ of concentrating under reduced pressure respectively the ethyl acetate extract and the mycelium methanol extract of fermented liquid, and last united extraction thing continues with Rotary Evaporators in 50 ℃ of evaporated under reduced pressure; Obtain a dried solid, be the gross activity crude extract.
3. gross activity crude extract according to claim 2; It is characterized in that containing the ethyl acetate extract and the mycelium methanol extract of fermented liquid, the penicillium mould of anti-methoxyl group streptococcus aureus (MRSA), Pseudomonas aeruginosa and white candiyeast are had resistance.
4. the strain preparation method of the gross activity crude extract of the nutrient solution of thalassiomycetes pawl aspergillus (Aspergillus unguis) DLEP2008001CGMCC No.3372 according to claim 1; And the preparation method of the active ingredient of the gross activity crude extract of the nutrient solution of thalassiomycetes pawl aspergillus (Aspergillus unguis) DLEP2008001CGMCC No.3372 according to claim 1, it is characterized in that may further comprise the steps:
A. seed culture: bacterial classification is transferred on the aseptic solid medium flat board from the inclined-plane, places constant incubator to cultivate down for 26～30 ℃ the petridish flat board, incubation time is 4～7 days;
B. enlarged culturing: liquid nutrient medium is filled in the ventilative fungi-proofing Glass Containers, and dress liquid coefficient is 0.15～0.25, seals back 121 ℃, 0.105Mpa in the high-pressure sterilizer 20min that sterilizes; The above-mentioned seed flat board agar block 40～80cm that carries disease germs is inoculated by every 1000ml liquid nutrient medium in cooling back
2The ratio inoculation is sealed, and places the constant-temperature shaking culture case with 160～200rpm rotating speed, in 26～30 ℃ of cultivations down, natural lighting, and incubation time is 5～9 days;
In said seed culture and the enlarged culturing, solid medium is:
Sucrose 20.0g;
Yam liquor 500ml;
Artificial seawater or 4% half artificial seawater 500ml;
Agar 15.0g;
Nature pH value
Liquid nutrient medium is:
Sucrose 20.0g;
Yam liquor 500ml;
Artificial seawater or 4% half artificial seawater 500ml;
Nature pH value
Yam liquor: get the fresh potato peeling and be cut into 1cm
3Size is block, and every 200g potato ball adding distil water 500ml boils 20min, and double-deck absorbent gauze filters, and is settled to 500ml with zero(ppm) water;
Artificial seawater: NaCl 25.0g, Na
2SO
44.0g, KCl 0.70g, NaHCO
30.20g, KBr 0.10g, H
3BO
30.03g, NaF 0.003g, MgCl
25.04g, CaCl
21.11g, SrCl
20.014g, being dissolved in 1000ml zero(ppm) water, filtration obtains;
The thick natural sea salt of 4% half artificial seawater: 40g is dissolved in 1000ml zero(ppm) water, and filtration obtains;
C. extract: the nutrient solution that will accomplish the enlarged culturing process filters with double-deck absorbent gauze and obtains clarified broth and mycelium respectively; Fermented liquid is with equal-volume ethyl acetate extraction 4 times; The mycelium that every 1000ml fermented liquid obtains is with 200ml anhydrous methanol soaking and extracting four times; Each 12h uses Rotary Evaporators in 50 ℃ of concentrating under reduced pressure respectively the ethyl acetate extract and the mycelium methanol extract of fermented liquid, and last united extraction thing continues with Rotary Evaporators in 50 ℃ of evaporated under reduced pressure; Obtain a dried solid, be the gross activity crude extract;
D. purify: above-mentioned gross activity crude extract is dissolved in small amount of methanol; Join 100～200 order silica gel that equate with its dry weight; Mix and the even extremely drying of grinding; Be splined on 20～50 times on 200～300 order silica gel column chromatographies of sample dry weight, with following eluent gradient elution progressively: volume ratio sherwood oil: methylene dichloride=1: 2～1: 3, absolute dichloromethane, volume ratio methylene dichloride: methyl alcohol=100: 1～2: 1, adopt thin-layer chromatography and thin-layer chromatography biological activity autography method to follow the trail of active ingredient; Again with the active ingredient point sample in preparation type silica gel thin-layer plate; Use methylene dichloride: methyl alcohol=60: 1～launch at 20: 1, active band is scraped respectively, use methanol-eluted fractions; Be further purified through HPLC respectively behind the wash-out phase evaporate to dryness, use C
18Reversed-phase column, use volumetric concentration be 60～100% methanol-water as moving phase, carry out 35 minutes gradient elutions; Flow velocity 0.6ml/min; Detect the 254nm uv-absorbing, follow the trail of through active chromatogram, prepare respectively RT at the active peak of 9～15min and 4～9min component; The elutriant that will contain active ingredient is used the Rotary Evaporators evaporated under reduced pressure, gets two parts of white powder components 1 and component 2.
5. the gross activity crude extract of strain thalassiomycetes pawl aspergillus (Aspergillus unguis) DLEP2008001 CGMCC No.3372 nutrient solution of preparing method's preparation according to claim 4 and active ingredient 1 thereof and the application of component 2 in streptococcus aureus, Pseudomonas aeruginosa and the white candiyeast medicine of the anti-penicillium mould of anti-methoxyl group of preparation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009102205397A CN101857841B (en) | 2009-12-01 | 2009-12-01 | Marine fungi aspergillus unguis strain, active extract thereof and preparation method and use of active extract thereof and active components thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009102205397A CN101857841B (en) | 2009-12-01 | 2009-12-01 | Marine fungi aspergillus unguis strain, active extract thereof and preparation method and use of active extract thereof and active components thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101857841A CN101857841A (en) | 2010-10-13 |
| CN101857841B true CN101857841B (en) | 2012-06-06 |
Family
ID=42944003
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009102205397A Expired - Fee Related CN101857841B (en) | 2009-12-01 | 2009-12-01 | Marine fungi aspergillus unguis strain, active extract thereof and preparation method and use of active extract thereof and active components thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101857841B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102634551B (en) * | 2012-03-06 | 2013-09-18 | 大连交通大学 | Algal epiphytic fungus chlorinated depside cyclic ether compound, and preparation and application thereof |
| CN103655436B (en) * | 2013-05-24 | 2016-03-09 | 钱臻 | A kind of biological fermentation facial cleanser and preparation method thereof |
| CN107287246B (en) * | 2017-08-07 | 2020-03-27 | 中国农业科学院烟草研究所 | Marine fungus extract, preparation method and application |
| CN108640841B (en) * | 2018-06-20 | 2021-04-02 | 广东海洋大学 | Depside cyclic ether compound and preparation method and application thereof |
| CN109112171A (en) * | 2018-09-28 | 2019-01-01 | 广州市雅薏诗化妆品有限公司 | A kind of preparation method of the antibacterial substance based on marine microorganism |
| CN110604731B (en) * | 2019-08-29 | 2023-03-17 | 广东海洋大学深圳研究院 | Application of compound Aspergillus G in preparation of neuroprotective drugs |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1891237A (en) * | 2006-03-27 | 2007-01-10 | 大连交通大学 | Active extract of a strictly anaerobic marine bacterium, and its preparing method and use |
| CN101113422A (en) * | 2007-06-28 | 2008-01-30 | 浙江大学 | Bacillus licheniformis fibrinolytic enzyme and production method thereof |
-
2009
- 2009-12-01 CN CN2009102205397A patent/CN101857841B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1891237A (en) * | 2006-03-27 | 2007-01-10 | 大连交通大学 | Active extract of a strictly anaerobic marine bacterium, and its preparing method and use |
| CN101113422A (en) * | 2007-06-28 | 2008-01-30 | 浙江大学 | Bacillus licheniformis fibrinolytic enzyme and production method thereof |
Non-Patent Citations (1)
| Title |
|---|
| 杨柳等.一株海洋真菌Sw-25产胞外多糖发酵条件研究.《大连轻工业学院学报》.2007,第26卷(第03期), * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101857841A (en) | 2010-10-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11459593B2 (en) | Dendrobium officinale endophytic fungus strain and extracellular polysaccharide produced thereby, and extraction method and application of extracellular polysaccharide | |
| CN101857841B (en) | Marine fungi aspergillus unguis strain, active extract thereof and preparation method and use of active extract thereof and active components thereof | |
| CN103952362B (en) | One strain is to the oranges and tangerines endogeny rayungus of various plants pathogenic bacteria tool bacteriostatic activity | |
| CN107298671A (en) | Come from the secalonic acid H of penicillium oxalicum and prepare the application of anti-human colon cancer drug | |
| CN103255061B (en) | Penicillium griseofulvum, antibacterial active compound generated thereby and application | |
| CN103074233B (en) | Marine fungus penicillium chrysogenum and application thereof to preparation of anti-tumor medicines | |
| CN108300677B (en) | One plant of streptomyces albus and its preparing the application in microbialpreservatives | |
| CN109182147A (en) | A kind of mould and its method for producing fumidil | |
| CN103484500B (en) | Bacterial CD-126 fermentation solution and application thereof | |
| CN105985919B (en) | Bacillus and application thereof | |
| CN102391968B (en) | Streptomyces and its application in echinomycin production | |
| CN105296357B (en) | A method of aweto liquid fermentation mycelium production is improved by feed supplement | |
| CN103740614B (en) | One plant height produces the actinoplanes mutagenic strain of rapamycin | |
| CN103408550B (en) | Derive from 2,5-diketopiperazines dipeptides and the Synthesis and applications thereof producing the molten bacillus of enzyme | |
| CN105420119B (en) | Ginseng endogenetic fungus and its application | |
| CN103146594B (en) | Sorangiumcellulosum strain and application thereof to synthesis of epothilone | |
| CN110357788A (en) | A kind of polyketides and its preparation method and application | |
| CN104962507A (en) | Myxobacteria strain and antitumor activity metabolite thereof | |
| CN103145740A (en) | Sulfoxide alkaloid compound as well as preparation method and application for same | |
| CN106148214B (en) | A kind of streptomyces ansochromogenes and the method for preparing Nikemycin | |
| CN102584615A (en) | Alkaloid compound as well as preparation method and application thereof | |
| CN102911877B (en) | Marine fungi cladosporium sphaerospermum and application thereof | |
| CN102477067A (en) | 3-amino-2-hydroxy-4-phenyl-valyl-isoleucine and preparation method and application thereof | |
| CN103222479B (en) | Use of Streptomyces sioyaensis metabolite in prevention and control of Colletotrichum lindemuthianum | |
| CN105861356B (en) | A kind of Raoul bacterium pan22x and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120606 Termination date: 20141201 |
|
| EXPY | Termination of patent right or utility model |