CN114752508A - Aspergillus sydowii MNP-2 and use in synthesis of dibenzoxepin - Google Patents
Aspergillus sydowii MNP-2 and use in synthesis of dibenzoxepin Download PDFInfo
- Publication number
- CN114752508A CN114752508A CN202210469812.5A CN202210469812A CN114752508A CN 114752508 A CN114752508 A CN 114752508A CN 202210469812 A CN202210469812 A CN 202210469812A CN 114752508 A CN114752508 A CN 114752508A
- Authority
- CN
- China
- Prior art keywords
- organic solvent
- mnp
- aspergillus
- methanol
- culture medium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
- A61K31/365—Lactones
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D313/00—Heterocyclic compounds containing rings of more than six members having one oxygen atom as the only ring hetero atom
- C07D313/02—Seven-membered rings
- C07D313/06—Seven-membered rings condensed with carbocyclic rings or ring systems
- C07D313/10—Seven-membered rings condensed with carbocyclic rings or ring systems condensed with two six-membered rings
- C07D313/12—[b,e]-condensed
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
- C12P17/02—Oxygen as only ring hetero atoms
- C12P17/08—Oxygen as only ring hetero atoms containing a hetero ring of at least seven ring members, e.g. zearalenone, macrolide aglycons
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Pharmacology & Pharmacy (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- General Chemical & Material Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biotechnology (AREA)
- Epidemiology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a Aspergillus sydowii MNP-2 and a method for synthesizing dibenzoxaxepinThe application of the Aspergillus sydowii MNP-2 in the invention can produce dibenzo [ b, e ] with high yield]Oxygen oxideClass (I)The compound is easy to culture, is convenient for amplified fermentation, and has the potential of industrial and large-scale production. Isolation of a high yield of dibenzo [ b, e ] from Aspergillus polytrichus MNP-2 fermentation product]Oxygen oxideThe yield of the compound (I) is 4.3mg/g, and the separation process is simple. The dibenzo [ b, e ] of the present invention]Oxygen oxide
Description
(I) technical field
(II) background of the invention
Dibenzo [ b, e ] s]Oxygen oxideThe compounds have a special heterocyclic structure. To date, more than 85% of biologically active compounds are composed of heterocyclic structures. Aspergillus fungi are a group of filamentous fungi that are widely distributed in different habitats of nature. The metabolites of the aspergillus fungi have the characteristics of complexity, diversity, novelty and the like, and the compound types mainly comprise polysaccharides, alkaloids, polyketides, diketopyrazines, anthraquinones and the like. The metabolites have biological activities of antibacterial, anticancer, antioxidant, antiviral, etc. Natural products are an important source of drugs, and over the last several decades, over the thousands of drugs approved by the FDA to be marketed, 49.3% of natural products are directly or indirectly derived.
Because the compound has a special heterocyclic structure, no synthetic method report of the compound exists at present, and the compound is separated from aspergillus polyvidus for the first time.
Disclosure of the invention
The invention aims to provide a novel strain-Aspergillus sydowii MNP-2 and application thereof in synthesizing dibenzoxaxepinApplication of compounds in synthesizing dibenzo oxygen and oxaThe compound can obtain higher yield, and the preparation method is simpler and more convenient.
The technical scheme adopted by the invention is as follows:
the invention provides a new strain-Aspergillus nidulans (Aspergillus sp.) MNP-2 which is preserved in China center for type culture collection with the preservation number of CCTCC NO: M2022061, the preservation date of 2022 years, 1 month and 12 days, and the preservation unit address of Wuhan, Wuhan university, postcode 430072.
The invention also provides a method for synthesizing dibenzoxaxepin shown in formula (I) by the Aspergillus sydowii MNP-2 through biological fermentationThe application of the compounds in the series of compounds,
preferably, the application is as follows: (1) fermenting the strain: inoculating Aspergillus nidulans (Aspergillus sp.) MNP-2 to rice culture medium, stirring, and fermenting at room temperature (25-30 deg.C) in dark place for 25-35 days (preferably 30 days) to obtain fermented mixture; the rice culture medium consists of rice and distilled water, wherein the amount of the distilled water is 1-2mL/g based on the mass of the rice;
(2) compound extraction: adding the fermentation mixture prepared in the step (1) into an organic solvent a, and performing ultrasonic treatment at room temperature (25-30 ℃) and 30-50kHzExtracting for 15-20min (preferably 40kHz, 20min), filtering, and concentrating the filtrate under reduced pressure until no liquid flows out to obtain crude extract; dissolving all crude extract with organic solvent b, separating and purifying with silica gel column (silica gel particle size 200-300 mesh, column height 120cm, diameter 10cm, column height 50cm), eluting with organic solvent c: methanol at volume ratio of 1:0, 100:1, 50:1, 20:1, 10:1, 4:1, 0:1, respectively, eluting at 50-60mL/min at elution rate and elution amount of 5-15 column volumes (preferably 10 column volumes), and collecting eluate at volume ratio of 20: 1; concentrating the collected effluent until no liquid flows out, dissolving the concentrate with methanol a, and separating and purifying by silica gel column (silica gel particle size 200-300 meshes, column height 70cm, diameter 6cm, column height 30cm), wherein the volume ratio of organic solvent d: methanol is used as an eluent, the elution speed is 30-40mL/min, and the volume ratio of dichloromethane to methanol is 10: 1: performing TLC detection with methanol as developing agent, and collecting eluate with Rf value of 0.6; adding the effluent into methanol b, standing at room temperature for recrystallization, filtering, collecting crystals, drying at 40-50 deg.C for 3-5h (preferably 45 deg.C for 3h) to obtain dibenzo [ b, e ] of formula (I)]Oxygen oxideA compound of the class; the organic solvent a is methanol, ethanol, acetone or ethyl acetate, preferably ethyl acetate; the organic solvent b is the same as the organic solvent a, and the organic solvent b is preferably methanol; the organic solvent c is dichloromethane or chloroform, and the organic solvent d and the organic solvent c are preferably dichloromethane; wherein the organic solvent a, the organic solvent b, the organic solvent c and the organic solvent d are all organic solvents, and are named for the convenience of distinguishing the organic solvents in different steps, and the letters have no meanings; the volume dosage of the organic solvent a is 1-5mL/g (preferably 1.8mL/g) based on the mass of the rice culture medium before fermentation; the volume dosage of the methanol a is 2-10mL/g, preferably 5mL/g based on the mass of the concentrate; the volume dosage of the organic solvent b is 0.01-1mL/g (preferably 0.03mL/g) based on the mass of the fermentation mixture; the volume ratio of the effluent liquid to the methanol b is 1: 10-15 parts of; the methanol a and the methanol b are both methanol, and the letters have no meaning per se.
Preferably, the aspergillus versicolor MNP-2 is activated before fermentation, seeds are subjected to amplification culture, and then the seed solution is inoculated to a rice culture medium in an inoculation amount with the volume concentration of 0.05 mL/g; the activation and seed expansion culture are carried out according to the following steps: (1) activation culture: inoculating Aspergillus nidulans MNP-2 into PDA slant culture medium, culturing in 28 deg.C incubator for 3-4 days, and activating the strain; the final concentration composition of the PDA slant culture medium is as follows: 20g/L of glucose, 200g/L of potato, 15-18g/L of agar and distilled water as a solvent, wherein the pH is natural; (2) seed culture: selecting one strain of the activated bacterial colony from the step (1), inoculating the strain into a PDB seed culture medium, and performing shake culture at 200rpm and 28 ℃ for 3 days to obtain a seed solution; the final concentration composition of the PDB seed culture medium is as follows: 200g/L of potatoes, 20g/L of glucose and distilled water as a solvent, wherein the pH is natural.
The dibenzoxazine of the invention is represented by the formula (I)The compounds can also be used for preparing drugs for inhibiting the activity of tumor cells and antitumor drugs, wherein the tumor cells comprise a human lung cancer cell strain A549, a human hepatoma cell strain Bel-7402 and a human colon cancer cell strain HCT-116.
Compared with the prior art, the invention has the following beneficial effects:
(1) the invention provides a strain for producing dibenzo [ b, e ]]Oxygen oxideThe Aspergillus sydowii MNP-2 of the compound (I) has the preservation number of CCTCC NO. M2022061, and the strain is easy to culture, convenient for amplified fermentation and has the potential of industrial and large-scale production.
(2) The invention separates dibenzo [ b, e ] with high yield from MNP-2 fermentation product of aspergillus polydoricus for the first time]Oxygen oxideThe yield of the compound (I) is 4.3mg/g, and the separation process is simple.
(IV) description of the drawings
FIG. 1 is a phylogenetic tree of the strain MNP-2.
FIG. 2 is an ESI-MS spectrum of compound (I).
FIG. 3 is a drawing showing the preparation of Compound (I)1H NMR Spectrum (DMSO-d)6,600MHz)。
FIG. 4 shows the preparation of compound (I)13C NMR Spectrum (DMSO-d)6,150MHz)。
(V) detailed description of the preferred embodiments
The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto: the room temperature in the embodiment of the invention is 25-30 ℃.
Example 1 screening and identification of Strain MNP-2
1. Screening of Strain MNP-2
Primary screening: 200g of ore collected from the arctic (longitude 73.8, latitude-168.9) is placed in a 15mL centrifuge tube, 5mL of sterile water is added, ultrasonic treatment is carried out for 5min at room temperature and 40KHz, standing and layering are carried out, supernatant is taken and inoculated into a PDA (personal digital assistant) plate, the culture is carried out for 3-4 days in an incubator at 28 ℃, and a single colony is selected after thalli grow out. The final concentration composition of the PDA plate culture medium is as follows: 20g/L of glucose, 200g/L of potato, 18g/L of agar and distilled water as a solvent, and the pH is natural.
Re-screening: inoculating the primarily screened single colony to a PDA plate, culturing for 3-4 days in an incubator at 28 ℃, and repeatedly screening until the size, shape, color and the like of the colony are basically consistent to finally obtain the strain MNP-2.
2. Identification of strains
(1) And (3) morphology observation:
inoculating the strain MNP-2 to a PDA slant culture medium, culturing for 3-4 days in an incubator at 28 ℃, wherein the colony is white filiform in the initial stage and gradually turns into dark green after maturation.
Through preliminary morphological observation, the fungus is judged to be the fungus.
(2) Species identification:
ITS (SEQ ID NO.1) identification is carried out on the strain MNP-2, species identification (Ongjingke biology, Ltd.) is carried out on the strain, and a phylogenetic tree is shown in figure 1.
The sequence is as follows: TCCGTAAAGGGGAACCTGCGGAAGGATCATTACTGAGTGCGGGCTGCCTCCGGGCGCCCAACCTCCCACCCGTGAATACCTAACACTGTTGCTTCGGCGGGGAACCCCCTCGGGGGCGAGCCGCCGGGGACTACTGAACTTCATGCCTGAGAGTGATGCAGTCTGAGTCTGAATATAAAATCAGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAACTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCCCGGCTTGTGTGTTGGGTCGTCGTCCCCCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGTGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCGACTAGGGCCGGCCGGGCGCCAGCCGACGTCTCCAACCATTTTTCTTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAAAAGCGGGAGGAAGATCATTACTGGACTG is added.
The strain MNP-2 is identified as the Aspergillus nidulans (Aspergillus sp.) MNP-2 by combining morphological and species characteristics, and is preserved in China center for type culture Collection with the preservation number of CCTCC NO: M2022061, the preservation date of 2022 years, 1 month and 12 days, and the preservation unit address is Wuhan, Wuhan university, post code 430072 in China.
Example 2: MNP-2 fermentation culture of bacterial strain
(1) Activation culture: inoculating MNP-2 strain into PDA slant culture medium, and culturing in 28 deg.C incubator for 3-4 days to obtain activated strain; the final concentration composition of the PDA slant culture medium is as follows: 20g/L of glucose, 200g/L of potato, 18g/L of agar and distilled water as a solvent, and the pH is natural.
(2) Seed culture: selecting one strain of the activated bacterial colony from the step (1) to inoculate to a PDB seed culture medium, and performing shake culture for 3 days at the conditions of 200rpm and 28 ℃ to obtain a seed solution; the final concentration composition of the PDB seed culture medium is as follows: 20g/L of glucose, 200g/L of potato and distilled water as a solvent, and the pH is natural.
(3) Fermentation culture: and (3) inoculating 0.83L of the seed solution obtained in the step (2) to the surface of 16.6kg of rice culture medium in an inoculation amount with the volume concentration of 0.05mL/g, uniformly stirring, and standing and fermenting for 30 days at room temperature in a dark place to obtain a fermentation mixture. The rice culture medium consists of rice and distilled water, wherein the consumption of the distilled water is 1.5g/mL based on the mass of the rice.
1. Extraction and isolation of Compound (I)
Adding the whole fermentation mixture prepared in example 2 into 30L ethyl acetate (the amount of ethyl acetate is 1.8ml/g based on the mass of the rice culture medium before fermentation), ultrasonically extracting at room temperature and 40kHz for 20min, filtering, and concentrating the filtrate under reduced pressure until no liquid flows out to obtain crude extract; dissolving all crude extract with 500mL of methanol, separating and purifying by using a silica gel column (silica gel particle size is 200-300 meshes, column height is 120cm, diameter is 10cm, column height is 50cm), respectively taking dichloromethane and methanol with volume ratios of 1:0, 100:1, 50:1, 20:1, 10:1, 4:1 and 0:1 as eluent, wherein the elution speed is 60mL/min, the elution amount is 10 column volumes, and collecting the effluent with volume ratio of 20: 1; the collected effluent was concentrated to no liquid, and after the concentrate was dissolved in 17.5mL of methanol (the volume of methanol was 5mL/g based on the mass of the concentrate), the solution was subjected to separation and purification by a silica gel column (silica gel particle size 200 and 300 mesh, column height 70cm, diameter 6cm, packed column height 30cm) with dichloromethane in a volume ratio of 50:1, 40:1, 20:1, respectively: eluting with 30ml/min of methanol, detecting by TLC (developing agent is dichloromethane: methanol at volume ratio of 10: 1), collecting eluate with Rf value of 0.6, adding 10 times volume of methanol, standing at room temperature for recrystallization, filtering, collecting crystal, drying at 45 deg.C for 3 hr to obtain 279.4g of product which is dibenzo [ b, e ]]Oxygen oxideA compound (I).
2. Structural characterization of Compound (I)
(1) Yellow powder, slightly soluble in methanol.
(2) ESI-MS spectrogram detection is carried out by adopting a mass spectrometer (LCQ sweet, Thermo), and the result is shown in figure 2; using nuclear magnetismResonance spectrometer (ADVANCE III, Bruker) detection1The H NMR spectrum, the result is shown in FIG. 3; detection by NMR spectrometer (ADVANCE III, Bruker)13The C NMR spectrum was as shown in FIG. 4.
The mass spectrum data is: ESI-MS M/z 316.95[ M + H ]]+Determining the molecular formula of the compound (I) as C by combining nuclear magnetic resonance spectrum16H12O7(ii) a The nuclear magnetic data are shown in table 1.
Table 1: process for preparing compound (I)1H-NMR and 13C-NMR Nuclear magnetic data and attribution
As described above, the structural formula of the compound (I) is determined by comparison of Novel olefins from Aspergillus versicolor [ J ]. Tetrahedron Letters,2001,42(5): 809-811.):
In the experiment, a Sulforhodamine B (SRB) colorimetric method is adopted to carry out an in vitro tumor cell growth inhibition experiment on the separated monomer compound.
1. Tumor cells
The human lung cancer cell strain A549, the human liver cancer cell strain Bel-7402 and the human colon cancer cell strain HCT-116 are all from the cell center of the basic research institute of Chinese medical college.
Selecting tumor cells in logarithmic growth phase, digesting with pancreatin, and adding10% fetal bovine serum RPMI1640 medium to adjust the cell concentration to 2X 104Individual cells/mL, cell suspensions of individual tumor cells were obtained.
2. Medicaments and agents
0.4% SRB solution: 0.8g of SRB was weighed, dissolved in 200mL of a 1% acetic acid aqueous solution by volume, and stored at room temperature.
50% TCA solution: 50g of trichloroacetic acid (TCA) is weighed, added with water to a constant volume of 100mL and stored at 4 ℃.
10mM Tris-base solution: 0.6057g of Tris (hydroxymethyl) aminomethane (Tris-base) was weighed, added with water to a constant volume of 500mL, and stored at 4 ℃ at pH 10.5.
Sample solution: dibenzo [ b, e ] prepared in example 2]Oxygen oxideCompound (I) was prepared as a 100. mu.g/mL sample solution in dimethyl sulfoxide (DMSO).
5-fluorouracil solution: 5-Fluorouracil was prepared as a sample solution at 100. mu.g/mL with dimethyl sulfoxide (DMSO).
3. Tumor cell Activity assay
Cell suspensions of the individual tumor cells in Table 2 were seeded at 190. mu.L per well in 96-well plates at 37 ℃ with 5% CO2And culturing for 24 h. Culture wells were divided into drug wells, control wells, blank wells.
Adding 10 mu L of sample solution into the drug hole to ensure that the final concentration of the drug in the culture hole is 5 mu g/mL; adding 10 mu L of 5-fluorouracil solution into the control wells to ensure that the final concentration of the drugs in the control wells is 5 mu g/mL; the blank wells were filled with 10 μ L of 10% fetal bovine serum RPMI1640 medium with an equal volume of vehicle (DMSO). Plates were incubated at 37 ℃ with 5% CO2Culturing for 3 days, discarding the culture medium, lightly adding 100 μ L of 4 deg.C pre-cooled 50% TCA solution into each well, standing for 5min, and standing at 4 deg.C for 1h to fix the cells. The fixative was decanted, washed 5 times with distilled water to remove TCA, and air dried for 1 h. Add 80. mu.L of 0.4% SRB solution to each well and stain at room temperature for 30 min. The dye solution is discarded, and the dye solution is washed by acetic acid aqueous solution with the volume concentration of 1% for 5 times to fully remove the unbound SRB, and is dried by air for 1 hour. Add 150. mu.L 10mM Trisbase solution per well for solubilization, microShaking on a shaker (Mini shaker, Kylin-Bell Lab instruments) for 5min, sampling each well, measuring OD value at 510nm by using an M5 microplate reader, and calculating the tumor cell growth inhibition rate according to the formula, wherein the results are shown in Table 2.
Tumor cell growth inhibition ratio (%) (OD)Control-ODMedicine)/(ODControl-ODBlank space)×100%。
The result shows that the compound I has IC effect on Bel-7402 human hepatoma cell line50The value was 297.81. mu.M.
Table 2: results of Compound I tumor cell growth inhibition in vitro
The above description is only an embodiment of the present invention, but the scope of the present invention is not limited thereto, and any changes or substitutions that are not thought of through the inventive work should be included in the scope of the present invention. Therefore, the protection scope of the present invention shall be subject to the protection scope defined by the claims.
Sequence listing
<110> Zhejiang industrial university
<120> Aspergillus polydorus MNP-2 and use in synthesizing dibenzoxel
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 588
<212> DNA
<213> Aspergillus sydowii (Aspergillus sp.)
<400> 1
tccgtaaagg ggaacctgcg gaaggatcat tactgagtgc gggctgcctc cgggcgccca 60
acctcccacc cgtgaatacc taacactgtt gcttcggcgg ggaaccccct cgggggcgag 120
ccgccgggga ctactgaact tcatgcctga gagtgatgca gtctgagtct gaatataaaa 180
tcagtcaaaa ctttcaacaa tggatctctt ggttccggca tcgatgaaga acgcagcgaa 240
ctgcgataag taatgtgaat tgcagaattc agtgaatcat cgagtctttg aacgcacatt 300
gcgccccctg gcattccggg gggcatgcct gtccgagcgt cattgctgcc catcaagccc 360
ggcttgtgtg ttgggtcgtc gtcccccccg ggggacgggc ccgaaaggca gcggcggcac 420
cgtgtccggt cctcgagcgt atggggcttt gtcacccgct cgactagggc cggccgggcg 480
ccagccgacg tctccaacca tttttcttca ggttgacctc ggatcaggta gggatacccg 540
ctgaacttaa gcatatcaaa aagcgggagg aagatcatta ctggactg 588
Claims (8)
1. Aspergillus nidulans (Aspergillus sp.) MNP-2 is preserved in China center for type culture Collection with the preservation number of CCTCC NO: M2022061, the preservation date of 2022 years, 1 month and 12 days, and the preservation unit address is Wuhan, Wuhan university, Zip code 430072.
3. the use according to claim 2, wherein said use is: (1) fermenting the strain: inoculating Aspergillus nidulans MNP-2 to rice culture medium, stirring, and fermenting at room temperature in dark place for 25-35 days to obtain fermented mixture; the rice culture medium consists of rice and distilled water;
(2) compound extraction: adding the fermentation mixture prepared in the step (1) into an organic solvent a, ultrasonically extracting at room temperature and 30-50kHz for 15-20min, filtering, and concentrating the filtrate under reduced pressure until no liquid existsThe body flows out to obtain a crude extract; dissolving all crude extract with organic solvent b, separating and purifying with silica gel column, respectively eluting with organic solvent c and methanol at volume ratios of 1:0, 100:1, 50:1, 20:1, 10:1, 4:1 and 0:1, at an elution speed of 50-60mL/min and an elution amount of 5-15 column volumes, and collecting eluate at a volume ratio of 20: 1; concentrating the collected effluent until no liquid flows out, dissolving the concentrate with methanol a, and then carrying out silica gel column separation and purification, wherein the volume ratio of an organic solvent d: methanol is used as eluent, the elution speed is 30-40mL/min, and the volume ratio of dichloromethane to methanol is 10: 1: performing TLC detection with methanol as developing agent, and collecting eluate with Rf value of 0.6; adding the effluent into methanol b, standing at room temperature for recrystallization, filtering, collecting crystals, drying at 40-50 deg.C for 3-5h to obtain dibenzo [ b, e ] shown in formula (I)]Oxygen oxideA compound of the class; the organic solvent a is methanol, ethanol, acetone or ethyl acetate; the organic solvent b is the same as the organic solvent a; the organic solvent c is dichloromethane or chloroform, and the organic solvent d and the organic solvent c.
4. The use according to claim 3, wherein the amount of distilled water used in step (1) is 1 to 2mL/g based on the mass of rice.
5. The use according to claim 3, wherein the Aspergillus sydowii MNP-2 is activated before fermentation in step (1), seeds are expanded and cultured, and then the seed solution is inoculated to the rice culture medium with the volume concentration of 0.05 mL/g; the activation and seed expansion culture are carried out according to the following steps: (1) activation culture: inoculating Aspergillus nidulans MNP-2 into PDA slant culture medium, culturing in 28 deg.C incubator for 3-4 days, and activating the strain; the final concentration composition of the PDA slant culture medium is as follows: 20g/L of glucose, 200g/L of potato, 15-18g/L of agar and distilled water as a solvent, wherein the pH is natural; (2) seed culture: selecting one strain of the activated bacterial colony from the step (1) to inoculate to a PDB seed culture medium, and performing shake culture for 3 days at the conditions of 200rpm and 28 ℃ to obtain a seed solution; the final concentration composition of the PDB seed culture medium is as follows: 200g/L of potato, 20g/L of glucose and distilled water as a solvent, and the pH is natural.
6. The use according to claim 3, wherein the organic solvent a is used in the step (2) in a volume amount of 1 to 5mL/g based on the mass of the fermentation mixture; the volume dosage of the organic solvent b is 0.01-1mL/g based on the mass of the fermentation mixture.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202210469812.5A CN114752508B (en) | 2022-04-28 | 2022-04-28 | Aspergillus polypolypolyvidone MNP-2 and application thereof in synthesis of dibenzooxazepine compounds |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202210469812.5A CN114752508B (en) | 2022-04-28 | 2022-04-28 | Aspergillus polypolypolyvidone MNP-2 and application thereof in synthesis of dibenzooxazepine compounds |
Publications (2)
Publication Number | Publication Date |
---|---|
CN114752508A true CN114752508A (en) | 2022-07-15 |
CN114752508B CN114752508B (en) | 2023-09-05 |
Family
ID=82333860
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202210469812.5A Active CN114752508B (en) | 2022-04-28 | 2022-04-28 | Aspergillus polypolypolyvidone MNP-2 and application thereof in synthesis of dibenzooxazepine compounds |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN114752508B (en) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103074234A (en) * | 2012-12-25 | 2013-05-01 | 浙江工业大学 | Marine fungus aspergillus sydowii and application thereof to preparation of anti-tumor medicines |
CN112111410A (en) * | 2018-03-14 | 2020-12-22 | 扬州大学 | Preparation method of dibenzoxepin compound |
-
2022
- 2022-04-28 CN CN202210469812.5A patent/CN114752508B/en active Active
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103074234A (en) * | 2012-12-25 | 2013-05-01 | 浙江工业大学 | Marine fungus aspergillus sydowii and application thereof to preparation of anti-tumor medicines |
CN112111410A (en) * | 2018-03-14 | 2020-12-22 | 扬州大学 | Preparation method of dibenzoxepin compound |
Non-Patent Citations (2)
Title |
---|
MARCIA RODRIGUES CARVALHO ET AL: "Novel lactones from Aspergillus versicolor", TETRAHEDRON LETTERS, vol. 42, no. 5, pages 809 - 811, XP004314691, DOI: 10.1016/S0040-4039(00)02154-7 * |
XIAN-QIN SONG ET AL: "Xanthone derivatives from Aspergillus sydowii, an endophytic fungus from the liverwort Scapania ciliata S. Lac and their immunosuppressive activities", PHYTOCHEMISTRY LETTERS, vol. 6, no. 3, pages 318 - 321 * |
Also Published As
Publication number | Publication date |
---|---|
CN114752508B (en) | 2023-09-05 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN115197172B (en) | Sesterterpene compound, synthetic gene cluster and synthetic method thereof | |
CN112592350B (en) | Polyketide lithocarpin E-G and preparation method and application thereof | |
CN110066283A (en) | A kind of Indolyl diketopiperazine compounds Alkaloid and its preparation method and application | |
CN103058974B (en) | Natural compound and preparation method and application thereof | |
CN114752508B (en) | Aspergillus polypolypolyvidone MNP-2 and application thereof in synthesis of dibenzooxazepine compounds | |
CN105061446B (en) | Penicillium citrinum-derived penicitrinine A as well as application thereof to preparation of drugs for resisting nasopharyngeal carcinoma | |
CN101812079A (en) | Piprazine compound containing polysulfide bond and preparation method and application thereof | |
CN114213428B (en) | Indole alkaloid compound and preparation method and application thereof | |
CN112300243B (en) | Cyclopeptide compound and preparation method and application thereof | |
CN110563740B (en) | Alpha-pyrone compound, preparation method, strain and application | |
CN103014090A (en) | Method for extracting bis-benzene oxepin-11(6H) keto-1, 10-dihydroxy, 3-methyl-7, 8-dimethoxy from Moller bacteria | |
CN109180635B (en) | Compound E1011, preparation method and application thereof, fermentation product of potato endophytic fungi and ethyl acetate extract liquid of fermentation product | |
CN114230538B (en) | Cyclic anthraquinone compound and preparation method and application thereof | |
CN112175027A (en) | Olive phylline derivative and preparation method and application thereof | |
CN113402453B (en) | Pyridone piericin, preparation method thereof and application thereof in preparation of anti-cancer drugs | |
CN108660169A (en) | A method of fermentation prepares spine spore bacteriums antibiotic | |
CN116199695B (en) | Citrinin derivative, and preparation method and application thereof | |
CN105111168A (en) | Natural antineoplastic compound and preparation method and use thereof | |
CN115505033A (en) | Cyclic depsipeptide compound and preparation method and application thereof | |
CN115894519B (en) | Tripeptide alkaloid compound and preparation method and application thereof | |
CN103265522B (en) | Lactone derivative derived from trichoderma citrinoviride and application thereof | |
CN113480557B (en) | Polyketone compounds, preparation method thereof and application thereof in preparation of antitumor drugs | |
CN112300188B (en) | Compounds myrothecin H and I, and preparation method and application thereof | |
CN105061445B (en) | Penicillium citrinum-derived penicitrinine A as well as application thereof to preparation of drugs for resisting human gastric cancer | |
CN102276613B (en) | Sesquiterpene alkaloid compound as well as preparation method and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |