CN114752508B - Aspergillus polypolypolyvidone MNP-2 and application thereof in synthesis of dibenzooxazepine compounds - Google Patents

Abstract

The invention discloses poly aspergillus MNP-2 and a method for synthesizing dibenzooxazepineApplication of the poly aspergillus MNP-2 in the class of compounds can produce dibenzo [ b, e ] in high yield]Oxa-typeThe strain is easy to culture, is convenient for amplifying fermentation, and has potential of industrialized and large-scale production. Isolation of a high yield of dibenzo [ b, e ] from Aspergillus polyvidone MNP-2 fermentation products]Oxa-typeThe yield of the compound (I) is 4.3mg/g, and the separation process is simple. Dibenzo [ b, e ] of the invention]Oxa-type

Description

Aspergillus polypolypolyvidone MNP-2 and application thereof in synthesis of dibenzooxazepine compounds

Field of the art

The invention relates to a dibenzooxazepinePreparation of compounds, in particular to poly aspergillus MNP-2 and synthesis of dibenzooxazepine->Application of the compounds.

(II) background art

Dibenzo [ b, e]Oxa-typeThe class of compounds have a more specific heterocyclic structure. To date, more than 85% of the bioactive compounds have consisted of heterocyclic structures. Aspergillus fungi are a class of filamentous fungi that are widely distributed in different natural habitats. The Aspergillus fungus metabolite has the characteristics of complexity, diversity, novelty and the like, and the compound types mainly comprise polysaccharide, alkaloid, polyketide, diketopyrazine, anthraquinone and the like. These metabolites have biological activities such as antibacterial, anticancer, antioxidant, antiviral, etc. Natural products are an important source of pharmaceuticals, accounting for 49.3% of the thousands of drugs approved by the FDA for sale, either directly or indirectly from natural products.

As the compound has a special heterocyclic structure, no synthesis method of the compound is reported at present, and the compound is also separated from Aspergillus polyrhizus for the first time.

(III) summary of the invention

The invention aims to provide a novel strain, namely Aspergillus polypolyvidone MNP-2 and a method for synthesizing dibenzooxazepine by using the sameApplication of the strain in synthesizing dibenzooxazepine>The compound can obtain higher yield and the preparation method is simpler and more convenient.

The technical scheme adopted by the invention is as follows:

the invention provides a new strain Aspergillus sp MNP-2, which is preserved in China center for type culture Collection, with a preservation number of CCTCC NO: M2022061, a preservation date of 2022, 1 month and 12 days, and a preservation unit address of Wuhan, university of Wuhan, post code 430072.

The invention also provides a method for synthesizing dibenzooxazepine shown in the formula (I) by the poly aspergillus MNP-2 in biological fermentationThe application of the compound in the preparation of the compound,

preferably, the application is as follows: (1) strain fermentation: inoculating Aspergillus sp MNP-2 to rice culture medium, stirring, and fermenting at room temperature (25-30deg.C) for 25-35 days (preferably 30 days) under dark condition to obtain fermentation mixture; the rice culture medium consists of rice and distilled water, wherein the distilled water dosage is 1-2mL/g based on the mass of the rice;

(2) Extraction of compounds: adding the fermentation mixture prepared in the step (1) into an organic solvent a, performing ultrasonic extraction at room temperature (25-30 ℃) and 30-50kHz for 15-20min (preferably 40kHz and 20 min), filtering, and concentrating the filtrate under reduced pressure until no liquid flows out to obtain crude extract; after all crude extract is dissolved by an organic solvent b, a silica gel column (the particle size of the silica gel is 200-300 meshes, the height of the column is 120cm, the diameter of the column is 10cm, and the height of the packed column is 50 cm) is adopted for separation and purification, and organic solvents c, methanol and eluent with the volume ratio of 1:0, 100:1, 50:1, 20:1, 10:1, 4:1 and 0:1 are respectively used as eluent, the eluting speed is 50-60mL/min, the eluting amount is 5-15 column volumes (preferably 10 column volumes), and effluent with the volume ratio of 20:1 is collected; concentrating the collected effluent until no liquid flows out, dissolving the concentrate with methanol a, and then separating and purifying by a silica gel column (the silica gel particle diameter is 200-300 meshes, the column height is 70cm, the diameter is 6cm, and the column height is 30 cm), wherein the volume ratio of the organic solvent d is 50:1, 40:1 and 20:1: methanol is used as eluent, the eluting speed is 30-40mL/min, and the volume is equal to the volumeMethylene chloride in a ratio of 10:1: TLC detection is carried out by taking methanol as developing agent, and effluent with Rf value of 0.6 is collected; adding the effluent into methanol b, standing at room temperature for recrystallization, filtering, collecting crystals, and drying at 40-50deg.C for 3-5 hr (preferably 45 deg.C for 3 hr) to obtain dibenzo [ b, e ] shown in formula (I)]Oxa-typeA class of compounds; the organic solvent a is methanol, ethanol, acetone or ethyl acetate, preferably ethyl acetate; the organic solvent b is the same as the organic solvent a, and the organic solvent b is preferably methanol; the organic solvent c is dichloromethane or chloroform, and the organic solvent d and the organic solvent c are both preferably dichloromethane; wherein the organic solvent a, the organic solvent b, the organic solvent c and the organic solvent d are all organic solvents, and the letter itself has no meaning in order to be convenient for distinguishing the organic solvents of different steps; the volume amount of the organic solvent a is 1-5mL/g (preferably 1.8 mL/g) based on the mass of the rice culture medium before fermentation; the volume amount of the methanol a is 2-10mL/g, preferably 5mL/g, based on the mass of the concentrate; the volume amount of the organic solvent b is 0.01-1mL/g (preferably 0.03 mL/g) based on the mass of the fermentation mixture; the volume ratio of the effluent liquid to the methanol b is 1:10-15 parts; the methanol a and the methanol b are both methanol, and the letter itself has no meaning.

Preferably, the Aspergillus oryzae MNP-2 is activated before fermentation, the seeds are subjected to expansion culture, and then the seed liquid is inoculated to a rice culture medium in an inoculum size with the volume concentration of 0.05 mL/g; the activation and seed expansion culture are carried out according to the following steps: (1) activation culture: inoculating Aspergillus oryzae MNP-2 into PDA slant culture medium, culturing at 28deg.C for 3-4 days, and activating strain; the final concentration composition of PDA slant culture medium is: glucose 20g/L, potato 200g/L, agar 15-18g/L, distilled water as solvent, and natural pH; (2) seed culture: selecting an inoculating loop thallus from the activated colony in the step (1), inoculating the inoculating loop thallus to a PDB seed culture medium, and carrying out shake cultivation for 3 days at 200rpm and 28 ℃ to obtain seed liquid; the final concentration composition of the PDB seed culture medium is as follows: 200g/L of potato, 20g/L of glucose, distilled water as a solvent and natural pH.

The dibenzooxazepine of the formula (I)The compounds are also used for preparing medicines for inhibiting the activity of tumor cells and antitumor medicines, wherein the tumor cells comprise a human lung cancer cell strain A549, a human liver cancer cell strain Bel-7402 and a human colon cancer cell strain HCT-116.

Compared with the prior art, the invention has the beneficial effects that:

(1) The invention provides a method for producing dibenzo [ b, e]Oxa-typeThe poly aspergillus MNP-2 of the compound (I) has a preservation number of CCTCC No. M2022061, is easy to culture, is convenient for amplified fermentation, and has potential of industrialized and large-scale production.

(2) The invention separates the dibenzo [ b, e ] with high yield from the Aspergillus polyvidone MNP-2 fermentation product for the first time]Oxa-typeThe yield of the compound (I) is 4.3mg/g, and the separation process is simple.

(3) Dibenzo [ b, e ] of the invention]Oxa-typeThe compound (I) has anti-tumor activity, and can be structurally modified in the later stage to prepare derivatives thereof so as to greatly improve the activity of the derivatives, thereby preparing the anti-tumor drugs.

(IV) description of the drawings

FIG. 1 is a phylogenetic tree of strain MNP-2.

FIG. 2 shows the ESI-MS spectrum of compound (I).

FIG. 3 shows the compound (I) ¹ H NMR spectrum (DMSO-d) ₆ ,600MHz)。

FIG. 4 shows the compound (I) ¹³ C NMR spectrum (DMSO-d) ₆ ,150MHz)。

(fifth) detailed description of the invention

The invention will be further described with reference to the following specific examples, but the scope of the invention is not limited thereto: the room temperature in the embodiment of the invention is 25-30 ℃.

Example 1 screening and identification of Strain MNP-2

1. Screening of Strain MNP-2

And (3) primary screening: 200g of ore from North Pole (73.8 longitude, 168.9 latitude) is placed in a 15mL centrifuge tube, 5mL of sterile water is added, the ultrasonic treatment is carried out for 5min at room temperature and 40KHz, after standing and layering, the supernatant is taken and put into a PDA flat plate, the culture is carried out for 3-4 days in a culture box at 28 ℃, and after thalli grow out, single bacterial colonies are selected. The final concentration composition of PDA plate medium was: glucose 20g/L, potato 200g/L, agar 18g/L, distilled water as solvent, and natural pH.

And (3) re-screening: inoculating the single colony of the primary screening into a PDA plate, culturing for 3-4 days in a 28 ℃ incubator, repeating the screening until the size, shape, color and the like of the colony are basically consistent, and finally obtaining the strain MNP-2.

2. Identification of strains

(1) Morphology observation:

the strain MNP-2 is inoculated to PDA slant culture medium, cultured in a 28 deg.c incubator for 3-4 days, and the initial colony is white filiform and mature and turned to dark green gradually.

The fungus was judged by preliminary morphological observation.

(2) Species identification:

the strain MNP-2 was subjected to ITS (SEQ ID NO. 1) identification, and the strain is subjected to species authentication (Optimus Practiginosa Co., ltd.), phylogenetic tree is shown in figure 1.

The sequence is as follows: TCCGTAAAGGGGAACCTGCGGAAGGATCATTACTGAGTGCGGGCTGCCTCCGGGCGCCCAACCTCCCACCCGTGAATACCTAACACTGTTGCTTCGGCGGGGAACCCCCTCGGGGGCGAGCCGCCGGGGACTACTGAACTTCATGCCTGAGAGTGATGCAGTCTGAGTCTGAATATAAAATCAGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAACTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCCCGGCTTGTGTGTTGGGTCGTCGTCCCCCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGTGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCGACTAGGGCCGGCCGGGCGCCAGCCGACGTCTCCAACCATTTTTCTTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAAAAGCGGGAGGAAGATCATTACTGGACTG.

The strain MNP-2 is identified as Aspergillus sp MNP-2 by combining morphology and species characteristics, and is preserved in China Center for Type Culture Collection (CCTCC) No. M2022061, and the preservation date is 2022, 1 month and 12 days, and the preservation unit address is Wuhan, university of Wuhan, post code 430072 in China.

Example 2: bacterial strain MNP-2 fermentation culture

(1) And (3) activating and culturing: inoculating MNP-2 strain into PDA slant culture medium, culturing at 28deg.C in incubator for 3-4 days to obtain activated strain; the final concentration composition of PDA slant culture medium is: glucose 20g/L, potato 200g/L, agar 18g/L, distilled water as solvent, and natural pH.

(2) Seed culture: selecting an inoculating loop thallus from the activated colony in the step (1), inoculating the inoculating loop thallus to a PDB seed culture medium, and carrying out shake cultivation for 3 days at 200rpm and 28 ℃ to obtain seed liquid; the final concentration composition of the PDB seed culture medium is as follows: glucose 20g/L, potato 200g/L, distilled water as solvent, and natural pH.

(3) Fermentation culture: inoculating 0.83L of the seed liquid obtained in the step (2) to the surface of 16.6kg of rice culture medium in an inoculum size of 0.05mL/g by volume concentration, uniformly stirring, and standing and fermenting for 30 days at room temperature in a dark place to obtain a fermentation mixture. The rice culture medium consists of rice and distilled water, wherein the distilled water dosage is 1.5g/mL based on the mass of the rice.

Example 3: dibenzo [ b, e]Oxa-typeExtraction, separation and identification of class compound (I)

1. Extraction and isolation of Compound (I)

Adding all the fermented mixture prepared in the example 2 into 30L of ethyl acetate (the dosage of the ethyl acetate is 1.8ml/g based on the amount of the rice culture medium before fermentation), performing ultrasonic extraction at room temperature and 40kHz for 20min, filtering, and concentrating the filtrate under reduced pressure until no liquid flows out to obtain crude extract; dissolving the crude extract with 500mL of methanol, and subjecting to silica gel column (silica gel particle size 200-300 mesh, column height 120 cm)10cm in diameter and 50cm in packed column height), respectively using methylene dichloride and methanol with volume ratios of 1:0, 100:1, 50:1, 20:1, 10:1, 4:1 and 0:1 as eluent, eluting at 60mL/min, eluting with 10 column volumes, and collecting effluent with volume ratios of 20:1; concentrating the collected effluent until no liquid flows out, dissolving the concentrate with 17.5mL of methanol (the volume amount of the methanol is 5mL/g based on the mass of the concentrate), and then separating and purifying by a silica gel column (the silica gel particle size is 200-300 meshes, the column height is 70cm, the diameter is 6cm, and the column loading height is 30 cm) according to the volume ratio of 50:1, 40:1 and 20:1 of dichloromethane: methanol is used as eluent, the eluting speed is 30ml/min, TLC detection (the developing solvent is methylene dichloride: methanol with the volume ratio of 10:1) is carried out, effluent liquid with the Rf value of 0.6 is collected, 10 times of methanol with the volume is added, standing and recrystallization are carried out at room temperature, filtration is carried out, crystals are taken, drying is carried out at 45 ℃ for 3h, 279.4g of product is obtained, and the dibenzo [ b, e ] is obtained]Oxa-typeA class of compounds (I).

2. Structural identification of Compound (I)

(1) Yellow powder, slightly soluble in methanol.

(2) ESI-MS spectrum detection is carried out by a mass spectrometer (LCQ sheet, thermo), and the result is shown in FIG. 2; detection by nuclear magnetic resonance spectrometer (ADVANCE III, bruker) ¹ H NMR spectrum, results are shown in fig. 3; detection by nuclear magnetic resonance spectrometer (ADVANCE III, bruker) ¹³ The results of the C NMR spectrum are shown in FIG. 4.

Mass spectrum data are: ESI-MS m/z 316.95[ M+H ]] ⁺ Determining the molecular formula of the compound (I) as C by combining nuclear magnetic resonance spectrum ₁₆ H ₁₂ O ₇ The method comprises the steps of carrying out a first treatment on the surface of the The nuclear magnetic data are shown in Table 1.

Table 1: of the compounds (I) ¹ H-NMR and ¹³ C-NMR nuclear magnetic data and attribution

In summary, according to the comparison of the documents (Novel lactones from Aspergillus versicolor [ J ]. Tetrahedron Letters,2001,42 (5): 809-811.), the compound (I) is determined to have the formula:

EXAMPLE 4 dibenzo [ b, e]Oxa-typeDetection of antitumor Activity of class Compound (I)

The experiment adopts a Sulfonyl Rhodamine B (SRB) colorimetric method to perform an in vitro tumor cell growth inhibition experiment on the separated monomer compound.

1. Tumor cells

The human lung cancer cell strain A549, the human liver cancer cell strain Bel-7402 and the human colon cancer cell strain HCT-116 are all from the cell center of basic research institute of China medical college.

Respectively selecting tumor cells in logarithmic growth phase, performing pancreatin digestion, and adjusting cell concentration to 2×10 with 10% fetal calf serum RPMI1640 medium ⁴ Cell suspensions of individual tumor cells were obtained per mL.

2. Medicament and reagent

0.4% srb solution: 0.8g of SRB was weighed out and dissolved in 200mL of 1% strength aqueous acetic acid solution and stored at room temperature.

50% tca solution: 50g of trichloroacetic acid (TCA) was weighed, water was added to a constant volume of 100mL, and the mixture was stored at 4 ℃.

10mM Tris-base solution: 0.6057g of Tris (hydroxymethyl) aminomethane (Tris-base) was weighed, added with water to 500mL, and kept at pH 10.5 at 4 ℃.

Sample solution: dibenzo [ b, e ] prepared in example 2]Oxa-typeThe compound (I) was prepared as a sample solution of 100. Mu.g/mL using dimethyl sulfoxide (DMSO).

5-fluorouracil solution: 5-fluorouracil was formulated with Dimethylsulfoxide (DMSO) as a 100. Mu.g/mL sample solution.

3. Tumor cell Activity assay

The cell suspensions of the respective tumor cells in Table 2 were inoculated at 190. Mu.L per well in 96-well plates at 37℃in 5% CO ₂ Culturing for 24h. Culture wells were divided into drug wells, control wells, blank wells.

Adding 10 mu L of sample solution into the medicine hole to make the final concentration of the medicine in the culture hole be 5 mu g/mL; the control wells were added with 10. Mu.L of 5-fluorouracil solution to give a final drug concentration of 5. Mu.g/mL in the control wells; blank wells were added with 10 μl of 10% fetal bovine serum RPMI1640 medium containing an equal volume of vehicle (DMSO). The plates were incubated at 37℃with 5% CO ₂ After 3 days of culture, the medium was discarded, 100. Mu.L of a pre-chilled 50% TCA solution at 4℃was gently added to each well, and the mixture was allowed to stand for 5 minutes and then transferred to 4℃for 1 hour to fix the cells. Pouring out the fixing solution, washing with distilled water for 5 times to remove TCA, and air-drying for 1h. 80 μl of 0.4% SRB solution was added to each well and stained at room temperature for 30min. The dye solution is discarded, and the solution is washed 5 times by 1% acetic acid water solution with volume concentration to fully remove unbound SRB and is air-dried for 1h. mu.L of 10mM Trisbase solution was added to each well for dissolution, and the mixture was shaken on a micro shaker (Mini shaker, kylin-Bell Lab instruments) for 5 minutes, and the OD value at 510nm was measured by using an M5 microplate reader for each well, and the tumor cell growth inhibition rate was calculated according to the formula, and the results are shown in Table 2.

Tumor cell growth inhibition (%) = (OD) _Control -OD _Medicament )/(OD _Control -OD _{Blank space} )×100％。

The results show that the compound I has IC on Bel-7402 human hepatoma cell line ₅₀ The value was 297.81. Mu.M.

Table 2: results of in vitro tumor cell growth inhibition experiments of Compound I

The foregoing is merely illustrative of specific embodiments of the present invention, and the scope of the invention is not limited thereto, but any changes or substitutions that do not undergo the inventive effort should be construed as falling within the scope of the present invention. Therefore, the protection scope of the present invention should be subject to the protection scope defined by the claims.

Sequence listing

<110> Zhejiang university of industry

<120> Aspergillus polypolypolyMNP-2 and use in the Synthesis of dibenzooxazepine-like Compounds

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 588

<212> DNA

<213> Aspergillus polis (sp.)

<400> 1

tccgtaaagg ggaacctgcg gaaggatcat tactgagtgc gggctgcctc cgggcgccca 60

acctcccacc cgtgaatacc taacactgtt gcttcggcgg ggaaccccct cgggggcgag 120

ccgccgggga ctactgaact tcatgcctga gagtgatgca gtctgagtct gaatataaaa 180

tcagtcaaaa ctttcaacaa tggatctctt ggttccggca tcgatgaaga acgcagcgaa 240

ctgcgataag taatgtgaat tgcagaattc agtgaatcat cgagtctttg aacgcacatt 300

gcgccccctg gcattccggg gggcatgcct gtccgagcgt cattgctgcc catcaagccc 360

ggcttgtgtg ttgggtcgtc gtcccccccg ggggacgggc ccgaaaggca gcggcggcac 420

cgtgtccggt cctcgagcgt atggggcttt gtcacccgct cgactagggc cggccgggcg 480

ccagccgacg tctccaacca tttttcttca ggttgacctc ggatcaggta gggatacccg 540

ctgaacttaa gcatatcaaa aagcgggagg aagatcatta ctggactg 588

Claims (6)

1. Aspergillus sp MNP-2 is preserved in China center for type culture Collection, with a preservation number of CCTCC NO: M2022061, a preservation date of 2022, 1 month and 12 days, and a preservation unit address of Wuhan, university of Wuhan, and post code 430072.

2. A process for the synthesis of dibenzooxazepine of formula (I) by biological fermentation of Aspergillus MNP-2 according to claim 1The application of the compound in the preparation of the compound,

3. the application of claim 2, wherein the application is: (1) strain fermentation: inoculating Aspergillus MNP-2 to rice culture medium, stirring, standing at room temperature in dark place, fermenting for 25-35 days to obtain fermentation mixture; the rice culture medium consists of rice and distilled water;

(2) Extraction of compounds: adding the fermentation mixture prepared in the step (1) into an organic solvent a, performing ultrasonic extraction at room temperature and 30-50kHz for 15-20min, filtering, and concentrating the filtrate under reduced pressure until no liquid flows out to obtain crude extract; after all crude extract is dissolved by an organic solvent b, separating and purifying by a silica gel column, respectively taking organic solvents c with volume ratios of 1:0, 100:1, 50:1, 20:1, 10:1, 4:1 and 0:1 as eluent, wherein the eluting speeds are 50-60mL/min, the eluting amounts are 5-15 column volumes, and collecting effluent liquid with volume ratio of 20:1; concentrating the collected effluent until no liquid flows out, dissolving the concentrate with methanol a, and then separating and purifying by a silica gel column, wherein the volume ratio of the organic solvent d is 50:1, 40:1 and 20:1: methanol is used as eluent, the elution speed is 30-40mL/min, and the volume ratio of dichloromethane is 10:1: TLC detection is carried out by taking methanol as developing agent, and effluent with Rf value of 0.6 is collected; adding the effluent into methanol b, standing at room temperature for recrystallization, filtering, collecting crystals, and drying at 40-50deg.C for 3-5 hr to obtain dibenzo [ b, e ] shown in formula (I)]Oxa-typeA class of compounds; the organic solvent a is methanol, ethanol, acetone or ethyl acetate; the organic solvent b is the same as the organic solvent a; the organic solvent c is dichloromethane or chloroform, and the organic solvent d is the same as the organic solvent c.

4. Use according to claim 3, characterized in that distilled water from step (1) is used in an amount of 1-2mL/g based on the mass of rice.

5. The use according to claim 3, characterized in that the aspergillus MNP-2 of step (1) is activated before fermentation, the seeds are grown in bulk, and the seed solution is inoculated to the rice culture medium in an inoculum size of 0.05mL/g by volume; the activation and seed expansion culture are carried out according to the following steps: (1) activation culture: inoculating Aspergillus MNP-2 into PDA slant culture medium, culturing at 28deg.C for 3-4 days, and activating strain; the final concentration composition of PDA slant culture medium is: glucose 20g/L, potato 200g/L, agar 15-18g/L, distilled water as solvent, and natural pH; (2) seed culture: selecting an inoculating loop thallus from the activated colony in the step (1), inoculating the inoculating loop thallus to a PDB seed culture medium, and carrying out shake cultivation for 3 days at 200rpm and 28 ℃ to obtain seed liquid; the final concentration composition of the PDB seed culture medium is as follows: 200g/L of potato, 20g/L of glucose, distilled water as a solvent and natural pH.

6. The use according to claim 3, characterized in that the organic solvent a in step (2) is used in a volume amount of 1-5mL/g based on the mass of the fermentation mixture; the volume amount of the organic solvent b is 0.01-1mL/g based on the mass of the fermentation mixture.