CN103013895A

CN103013895A - Genetic engineering live vaccine of recombinant Salmonella choleraesuis and Porcine epidemic diarrhea virus, preparation and application

Info

Publication number: CN103013895A
Application number: CN2011102869658A
Authority: CN
Inventors: 何启盖; 徐丽丽; 库旭钢; 李燕; 李娜娜; 张坤; 陈焕春; 郭爱珍; 徐高原
Original assignee: WUHAN KEQIAN ANIMAL BIOLOGICAL PRODUCTS CO Ltd; Huazhong Agricultural University
Current assignee: WUHAN KEQIAN BIOLOGICAL CO., LTD.; Huazhong Agricultural University
Priority date: 2011-09-23
Filing date: 2011-09-23
Publication date: 2013-04-03
Anticipated expiration: 2031-09-23
Also published as: CN103013895B

Abstract

The invention belongs to the technical field of animal bacterial genetic engineering, and concretely relates to a construction of recombinant Salmonella choleraesuis strains C501-Coe and C501-SD with no resistance marker and expressing main antigenic sites of porcine epidemic diarrhea virus, a preparation of a vaccine and an application. The invention obtains the recombinant Salmonella choleraesuis strains C501-Coe and C501-SD with no resistance marker and expressing the main antigenic sites of the porcine epidemic diarrhea virus, and the strains have the following accession number respectively: CCTCC NO: M2011296 and CCTCC NO: M2011297. The two recombinant strains are deleted with an asd gene necessary for growth of the S. choleraesuis, and contain plasmids which can express the asd gene, as well as a COE gene fragment and a SD gene fragment of the Porcine epidemic diarrhea virus in the strains. <{EN3}>The invention further discloses a method and an application by using the recombinant strain to prepare the vaccine of the Salmonella choleraesuis and the Porcine epidemic diarrhea virus. <{EN4}>The vaccine provided by the invention can stimulate swine to generate a protective immunization reaction for resisting the Salmonella choleraesuis and the Porcine epidemic diarrhea virus, and can effectively prevent infection of the Salmonella choleraesuis and the Porcine epidemic diarrhea virus. The invention further discloses a method and an application by using the recombinant strain to prepare the vaccine of the Salmonella choleraesuis and the Porcine epidemic diarrhea virus. The vaccine provided by the invention can stimulate swine to generate a protective immunization reaction for resisting the Salmonella choleraesuis and the Porcine epidemic diarrhea virus, and can effectively prevent infection of the Salmonella choleraesuis and the Porcine epidemic diarrhea virus.

Description

Porcine epidemic diarrhea virus recombinant salmonella choleraesuis genetically engineered living vaccine and preparation and application

Technical field

The invention belongs to the animal bacteria gene engineering technology field, be specifically related to the construction and application of the Salmonella choleraesuls living vaccine bacterial strain of two kinds of restructuring of expressing respectively Porcine epidemic diarrhea virus protective antigen gene-COE gene and SD gene that do not contain resistance marker.

Background technology

Salmonellas (Salmonellu) is the entozoic Gram-negative intestinal bacillis of a kind of born of the same parents, has aggressive, and modal salmonella has Salmonella typhimurium, Salmonella choleraesuls and Salmonella enteritidis etc.Salmonellas all has stronger virulence to humans and animals, can cause the gastrointestinal tract disease of human body and animal, and the viability of Salmonellas in external environment is stronger, utilize engineered method cause weak after, still have stronger invasiveness.

The vaccine of initial prevention Salmonellas is full bacterium deactivation vaccine, but the humoral immunization that this vaccine can only excitating organism, and easily causes side effect, and in addition, also existing needs immunity repeatedly and without the shortcoming of cross protection, thereby can not widespread use.After this, the researcher simulates the mode of Salmonellas enteron aisle natural infection, give the Salmonellas (such as the oral weak malicious seedling of Salmonella enteritidis Ty21a) of the oral attenuation of animal, found that, can induce body to produce better humoral immunization and cellular immunization, therefore be subject to a lot of researchers' generally attention (Gernianier R et al., 1975).

Because it is unintelligible that enteritis salmonella typhi Ty21a causes weak genetic background, the various countries researcher, attempt using engineered method, research genetic background is the weak virus gene deletion of vaccine strain of typhoid fever clearly, be used for oral immunity research, for example, aro gene-deleted strain (Dougan G et al., 1988), cya/crp gene-deleted strain (Alper M D et al., 1978), Dam and phoP/phoQ gene-deleted strain (Galan J E et al., 1989), asd gene-deleted strain (Xu Yindi etc., 2006) etc.

Weak malicious Salmonellas is except itself can be used as vaccine, also can be used as carrier and express the exogenous antigen gene, in recent years, exogenous antigen take weak malicious Salmonellas as vector expression tumour, virus, bacterium and parasite etc., development multivalent genetic engineered vaccine becomes the study hotspot in this field, thereby for the development of new recombinant vaccine has been opened up new approach (Zhao Z et al., 2008).

In recent years, the recombinant vaccine that weak malicious Salmonellas is carrier becomes the focus of research, and its superiority is mainly manifested in (Xu draws younger brother's Ph D dissertation, 2006):

(1) validity of antigen presentation, when especially oral or collunarium is immune, effect better (Dietrich et al., 1998);

(2) can produce specific cytotoxic t lymphocytes and kill and wound reaction (CTL effect);

(3) can excite the reaction of mucous membrane and systemic immunity.After vaccine oral administration take weak malicious Salmonellas as carrier or the mode immunity of collunarium, can directly exogenous antigen be delivered the mucosa-associated lymphoid tissue (MALT) to body, thereby the mucous membrane of excitating organism and systemic immunity reaction (Spreng et al., 2006);

(4) has immunoadjuvant function.The LPS of Salmonellas is a kind of inherent adjuvant, in addition, there are some researches show, there is a non-methylated CpG dna sequence dna Salmonellas inside, have stronger immunostimulatory activity, can promote that internal body Th type is main immunne response, thereby, be considered to have immunostimulant and the immunological adjuvant (Paglia et al., 1998) of application potential;

(5) immunity has persistence.The entrained plasmid of attenuation salmonella carrier is difficult for losing, and can be present in steadily in the long term in the body Lymphoid tissue, thereby does not need the also immune response of excitating organism chronically of repeated multiple times ground booster immunization;

(6) combined immunization effect.The antigen that attenuation salmonella itself is entrained and the exogenous antigen of plasmid expression have played the effect of combined immunization, simultaneously, exogenous antigen gene more than 2 or 2 can also be inserted in the expression plasmid, can produce for different exogenous antigens corresponding immune response behind the immunity host, thereby reach the curative effect of primary immune response control various diseases;

(7) expressed antigen protein need not purified.Vaccine take attenuation salmonella as carrier only needs incubated overnight get final product direct immunization, induces step with purifying protein thereby saved inductor, and preparation process is simple, save time, and is easy to store transportation, therefore, can significantly reduce the vaccine production cost;

(8) vaccination ways is easy, and easy handling is suitable for herd immunity, and security is good.

Salmonella choleraesuls C500 low virulent strain is in containing the substratum of thaliium acetate, continuous passage causes weak bacterial strain for 500 times, it has good immunogenicity, practice has proved that also the C500 strain has good immunogenicity, and can activate whole body, part and mucomembranous immune system, have the advantages that side effect is low, security is good.Wherein, that the most frequently used is Salmonellas Asd-balanced lethal system (Galan J E, et al.1990).State Key Laboratory of Agricultural Microbiology Xu Yindi doctor has made up the asd gene-deleted strain Δ asd C500 of C500 strain, immunogenicity through experiment confirm Δ asd C500 gene-deleted strain, compare with the C500 bacterial strain, virulence is lower, better (the Xu Yindi etc. of security, 2006), and be applied to the preparation of live recombined vaccines, made up the recombinant salmonella living vaccine of transmissible gastroenteritis of swine such as applicant place agricultural microorganism National Key Laboratory, through clinical verification, this vaccine has preferably immunoprophylaxis effect, and has applied for Chinese invention patent (number of patent application is 2009100639279).

Porcine epizootic diarrhea (PED) is caused by Porcine epidemic diarrhea virus (PEDV), a kind of acute infectious disease of height contact, pig infects after the PEDV, often cause the acute enteritis of piglet and mortality watery diarrhea until dehydration is dead, its Clinical symptoms is mainly manifested in piglet vomiting, severe diarrhea and dehydration; Atrophy and come off (Pensaert and Yeo, 2006) of the intestinal villus of jejunum that inspection pathological change main manifestations is pig and ileal segment are cutd open by PEDV infected pigs.PED is very large to the harm of pig, and the pig at various ages all can fall ill, but the most serious to the harm of sucking piglets, and 20 ages in days reach (Timoney J F et al., 1988) more than 95% with interior piglet mortality ratio, bring heavy economic losses to pig industry.

At present, PED worldwide is widely current.At European Countries, PED popularity degree than before obviously reduces, but the infection rate of PEDV is very high in the pig farm, Asia, especially in Korea S, Japan and Chinese etc., on pathogenesis and clinical symptom, PEDV is very similar to TGEV, and since its infection rate apparently higher than TGEV and porcine rotavirus (PoRV), cause huge loss (Cavanagh D et al., 1997) to pig industry.

PEDV belongs to coronaviridae, coronavirus genus.PED finds and reports to be Britain (Oldham, 1972) in 1971 first.Henceforth, this disease was reported (Puranaveja et al., 2009) on a large scale in Europe and Asia, from 1976, China has reported the generation of PED in succession, and PED has become one of important pig virus diarrhoea disease popular in the world wide now.1978, cause pathogenic agent-PEDV that this is sick, obtain first identifying (Chasey et al. in Britain and Belgium, 1978), and be listed in possible the member of coronavirus genus in (ICTV) the 5th time report of ICTV in 1991, until the full member who just is listed in coronavirus genus is reported in the 6th time of nineteen ninety-five.

PEDV particle shape feature and other member's of coronaviridae very similar (Chasey et al., 1978), Spike Glycoprotein (S albumen), membrane glycoprotein (M albumen) and envelope glycoprotein (E albumen) are distributed in the surface of virus particle; Nucleocapsid protein (N albumen) is positioned at virus particle inside, the nucleocapsid structure of PEDV is interacted by N albumen and geneome RNA and forms, this is so that PEDV and Transmissible gastroenteritis virus are difficult to difference (Pensaert et al., 1986) at morphology.So far, research finds that only there is a serotype (Witte et al., 1981) in PEDV.

PEDV S albumen plays a significant role in the mediated infection host produces the process of neutralizing antibody, in recent years, and the research successively PEDV S gene carried out of researchist both at home and abroad.Chang in 2002 etc. are according to the neutralizing epitope sequence of TGEV S gene, infer an epitope district (499～638aa) that PEDV S gene, and called after COE, confirm through test, this gene has preferably immunogenicity, and also as target gene, be applied to (Nguyen et al., 2009 among the preparation of Transgenic Plant Vaccines and recombinant vaccine; Ge Junwei etc., 2010).PEDV is as main virus take humoral immunization, thereby, the B cell antigen epi-position has great importance in anti-PEDV infects, the people such as Sun (2008) identify S1D5 (744-759aa) and the S1D6 (756-771aa) that comprises in S1D (636-789aa) district of learning the S1 subunit by experiment, may be two B cell epitopes (Sun D B et al. of PEDV, 2008), the S1D district has also comprised preferably high-affinity epitope sequences S1P3 (697-742aa) of an immunogenicity in addition.

The method of prevention PED generation commonly used is both at home and abroad, and with the ight soil of PEDV infected pigs or the intestinal contents of morbidity piglet, the artificial challenge pregnant sow stimulates to produce maternal antibody, after piglet is sucked the breast, obtains to protect, and reduces mortality ratio and shortens the popular time of PED.

Identical with most of virus diseases, to the prevention and control of PED, mainly be to put prevention first with vaccine immunity.At present, the business-like vaccine of PED mainly is two kinds of deactivation vaccine and weak malicious seedlings, and two kinds of vaccines are after use, although can prevent to a certain extent the generation of PED, effect is undesirable.Infer that its former because PEDV is mainly through the intestinal tract infections pig, part Mucosal Immunity system has brought into play important effect (Pospischil A et al. in the immunologic process that anti-PEDV infects, 2002), thereby the specificity sIgA that stimulates intestinal mucosa to produce, become the anti-problem of making the generation of this disease and development PED vaccine key.Yet existing commercialization deactivation vaccine and weak malicious seedling can only be induced humoral immunoresponse(HI) after immunity, can not activate the mucosa-immune system, even higher serum antibody titer is arranged, still can not stop in the cause of disease per mucous membrane invasion body, thereby immune effect are not good.At present, though the correlative study of existing PED Transgenic Plant Vaccines and genetically engineered living vaccine just is in the experimental study stage, also unrealized commercialization, therefore, develop safer, efficient, cheap new generation vaccine and be world's pig industry in the urgent need to.

In view of attenuation salmonella has the efficient of transporting height as vaccine carrier, immunization method is simple, and immune effect is better, can excite simultaneously the advantages such as general immunity and local mucosal immunity, and good application prospect is arranged.There are a lot of defectives in the conventional construction method of recombinant salmonella vaccine, such as the previously used expression plasmid that carries resistant gene, because of its existing Biosafety problem, and is not accepted by people.This is studied employed Salmonella choleraesuls C500asd plasmid-carrier balanced lethal system and has the advantage of non-resistant mark, in addition, have also that immunogenicity is good, expression amount is high, exogenous gene expression is stable and do not need the advantages such as purifying, thereby, it is developed as the live recombined vaccines of expressing Porcine epidemic diarrhea virus major antigen gene has broad application prospects.

Summary of the invention

The object of the invention is to overcome the defective that prior art exists, its first purpose is the recombinant salmonella choleraesuis strain that obtains to express Porcine epidemic diarrhea virus protective antigen protein gene-COE gene and SD protein gene.

Second purpose of the present invention is to utilize above-mentioned recombinant bacterium to obtain a kind of Salmonella choleraesuls and Porcine epidemic diarrhea virus bivalent genetic engineering vaccine.

The 3rd purpose of the present invention is the application of above-mentioned recombinant bacterium in preparation Salmonella choleraesuls and Porcine epidemic diarrhea virus bivalent genetic engineering vaccine.

The present invention is achieved through the following technical solutions:

The applicant is by engineered method, obtained to express the Salmonella choleraesuls (Salmonella choleraesuis) of the restructuring of Porcine epidemic diarrhea virus protective antigen gene-COE gene and SD gene-C501-COE and C501-SD, this two bacterial strain is delivered Chinese Typical Representative microbial preservation center (CCTCC) preservation that is positioned at Wuhan City, Hubei Province Wuhan University on August 22nd, 2011, and its deposit number is respectively CCTCCNO:M2011296; CCTCC NO:M2011297.

The Salmonella choleraesuls C501-COE of two restructuring and the preparation method of C501-SD mainly comprise the following steps:

1) structure of prokaryotic expression plasmid pET-32a-COE and pET-32a-SD: from suffering from Porcine Epidemic Diarrhea (Porcine epidemic diarrhea, PED) in the sick swine excrement pathological material of disease, amplification Porcine epidemic diarrhea virus COE gene and SD gene, and respectively with its subclone to prokaryotic expression carrier pET-32a, make up prokaryotic expression plasmid pET-32a-COE and pET-32a-SD;

2) structure of recombinant plasmid pYA-COE and pYA-SD: will make up correct prokaryotic expression plasmid and carry out double digestion, and connect with the shuttle plasmid pYA3493 of the identical double digestion of process, and transform the intestinal bacteria x6097 of Asd-, screening positive clone;

3) the Salmonella choleraesuls C501-COE of restructuring and the structure of C501-SD: recombinant plasmid pYA-COE and pYA-SD electricity are converted in the Salmonella choleraesuls C500 Δ crp Δ asd gene-deleted strain, obtain deposit number and be respectively CCTCC NO:M2011296; Salmonella choleraesuls C501-COE and the C501-SD of the restructuring of CCTCC NO:M2011297.

The applicant obtains gene fragment COE gene, the SD gene in two kinds of Porcine epidemic diarrhea virus major antigen sites, and their nucleotide sequence is shown in sequence table SEQ ID NO:1 and SEQ ID NO:3 (its preparation method is seen shown in the embodiment).

The applicant utilizes the Salmonella choleraesuls C501-COE bacterium liquid of described restructuring, Salmonella choleraesuls C501-SD bacterium liquid and the gelatin protective material of restructuring successfully to prepare a kind of bivalent genetic engineering vaccine of preventing and treating Salmonella choleraesuls and porcine epizootic diarrhea according to proper volume than (seeing embodiment).

The recombinant salmonella choleraesuis strain in the above-mentioned expression Porcine epidemic diarrhea virus major antigen site that does not contain resistance marker lacked cell walls essential in the salmonella strain genome form genes involved asd gene (plasmid that need to contain the asd gene be present in the thalline or external source add on the substratum of DAP could normal growth, breeding), this two strains recombinant bacterial strain contains respectively exogenous plasmid pYA-COE and pYA-SD (all containing the asd gene) simultaneously, and this two strains recombinant bacterial strain has all kept the immunological characteristic of parent strain C500 as the Salmonella choleraesuls attenuated vaccine strain.Plasmid pYA-COE and pYA-SD all can express the asd gene in this bacterial strain, and both can express respectively COE antigen site and SD antigen site gene in the Porcine epidemic diarrhea virus S albumen.Wherein, the asd gene expression product provides salmonella strain essential cell walls forms relevant composition.COE antigen site and SD antigen site gene expression product provide the good immunogenicity for Porcine epidemic diarrhea virus.

Recombinant salmonella choleraesuis strain C501-COE and the C501-SD that does not contain the expression Porcine epidemic diarrhea virus major antigen site of resistance marker of the present invention, this two strain gene engineerings bacterial strain all are derived from China and have used the commercialization Salmonella choleraesuls attenuated vaccine strain C500 more than 50 years.Described recombinant salmonella choleraesuis strain C501-COE of the present invention and C501-SD, lack the asd gene in the C500 strain gene group, added simultaneously the COE antigen site that contains in the Porcine epidemic diarrhea virus S albumen and plasmid pYA-COE and the pYA-SD of SD antigen site gene.Owing to need the recombinant bacterial strain that exists of pYA-COE and pYA-SD to survive, therefore greatly improved plasmid pYA-COE and the stability of pYA-SD (namely COE antigen site and SD antigen site gene) in recombinant bacterial strain.COE antigen site and the stably express of SD antigen site gene in recombinant bacterial strain make it to have for the good immune protective efficiency of transmissible gastro-enteritis virus.

Basic construction method of the present invention is: utilizing the Salmonella choleraesuls attenuated vaccine strain C500 Δ crp Δ asd gene-deleted strain (Xu Yindi etc., 2006) of the asd genetically deficient that the agriculture microorganism National Key Laboratory at the applicant place builds to make up to contain can prokaryotic expression Porcine epidemic diarrhea virus COE and plasmid pYA-COE and the pYA-SD of SD gene.With recombinant plasmid respectively electricity change in the C500asd gene-deleted strain; recombinant plasmid and C500asd gene-deleted strain form complementation like this; and satisfy growth needs; and then stable coexistence, formed recombinant bacterial strain C501-COE and the C501-SD that can express the Porcine epidemic diarrhea virus protective antigen that do not contain resistance marker that we invent.Recombinant bacterial strain by a large amount of biological experiment digital proof the present invention preparation can be used for preparing the bivalent genetic engineering vaccine for Salmonella choleraesuls and porcine epizootic diarrhea.

Major advantage of the present invention is:

1, the N in A, D antigen site and the N albumen in the pig infectious gastroenteritis virus S protein of recombinant bacterial strain expression of the present invention ₃₂₁Antigen site is the important immunogenic gene fragment of transmissible gastro-enteritis virus; the Porcine epidemic diarrhea virus protective antigen gene that recombinant bacterial strain of the present invention is expressed-COE gene and SD gene are the important immunogenic gene fragments of Porcine epidemic diarrhea virus, all have good immune protective.Because transmissible gastro-enteritis virus and pig, epidemic diarrhea virus harm are day by day serious, and extensive stock transmissible gastroenteritis of swine and porcine epizootic diarrhea vaccine (mainly being adjuvant inactivated vaccine and weak malicious seedling) immune effect are generally relatively poor in the market.Therefore, the vaccine made from this engineering strain has wide market application foreground.

2, recombinant bacterial strain of the present invention is derived from China and has used the commercialization Salmonella choleraesuls attenuated vaccine strain C500 more than 50 years, has kept the immune efficacy of C500 for Salmonella choleraesuls fully.And, this recombinant bacterial strain virulence than C500 slightly a little less than, have better biological safety.

3, recombinant bacterial strain of the present invention can provide the protection for Salmonella choleraesuls, Transmissible gastroenteritis virus and three kinds of cause of diseases of porcine epizootic diarrhea simultaneously.

4, the vaccine developed of the present invention is compared with weak malicious seedling with existing deactivation vaccine, have preparation process simple, save time, and be easy to store the characteristics of transportation, significantly reduced the cost of manufacture of vaccine.

5, recombinant bacterial strain of the present invention does not contain resistance marker, meets the requirement of vaccine biological safety fully.

More detailed technical scheme sees that embodiment is described.

Description of drawings

Sequence table SEQ ID NO:1 is the nucleotide fragments of the Porcine epidemic diarrhea virus protective antigen gene COE that clones of the present invention.

Sequence table SEQ ID NO:3 is the nucleotide fragments of the Porcine epidemic diarrhea virus protective antigen gene SD that clones of the present invention.

Fig. 1: the present invention preparation can prokaryotic expression porcine epizootic diarrhea protective antigen gene fragment make up schema.

Fig. 2: the present invention preparation can prokaryotic expression the COE gene and the sequence alignment figure of SD gene.Wherein, Fig. 2 A: can the COE gene of prokaryotic expression and comparing of other strain corresponding sequence; Fig. 2 B: can the SD gene of prokaryotic expression and comparing of other strain corresponding sequence.

Fig. 3: the present invention prepares the collection of illustrative plates of the used shuttle plasmid pYA3493 of recombinant salmonella.

Fig. 4: the PCR that the present invention prepares recombinant plasmid pYA-COE and pYA-SD identifies picture.Wherein:

Fig. 4 A:pYA-COE PCR identifies picture.Wherein, M:DNA Marker (DL2000); 1-2:pYA-COE; 3: positive control; 4: negative control;

Fig. 4 B:pYA-SD PCR identifies picture.Wherein, M:DNA Marker (DL2000); 1-2:pYA-SD; 3: positive control; 4: negative control.

Fig. 5: the present invention prepares the enzyme of recombinant plasmid pYA-COE and pYA-SD and cuts the qualification result electrophorogram.Wherein, M1:DNA Marker (DL2000); M2:DNA marker (DL15000); 1:pYA3493/EcoR I; 2:pYA-COE/EcoRI+HindIII; 3:pYA-SD/EcoRI+Sal I.

Fig. 6: the recombinant bacterium C501-COE of the present invention's preparation and the structure schema of C501-SD.

Fig. 7: the recombinant bacterium C501-COE of the present invention's preparation and the PCR of C501-SD identify figure.Wherein,

Fig. 7 A: recombinant bacterium C501-COE PCR identifies picture.Wherein, M:DNA Marker (DL2000); 1-2:C501-COE; 3: positive control;

4: negative control;

Fig. 7 B: recombinant bacterium C501-SD PCR identifies picture.Wherein, M:DNA Marker (DL2000); 1-2:C501-SD; 3: positive control;

4: negative control.

Fig. 8: the amplification picture of Salmonellas invA gene among the recombinant bacterial strain C501-COE of the present invention's preparation and the C501-SD.Wherein,

M:DNA Marker (DL2000); 1: positive control; InvA gene amplification among the 2:C501-COE; InvA gene amplification among the 3:501-SD.

Fig. 9: utilize Western blotting method to detect the secreting, expressing of albumen among the recombinant bacterium C501-COE of the present invention's preparation and the C501-SD.Wherein:

Fig. 9 A: contain the secreting, expressing of COE albumen in recombinant bacterium C501-COE.Wherein, M:Prestained Protein Ladder;

Fig. 9 B: contain the secreting, expressing of SD albumen in recombinant bacterium C501-SD.Wherein, M:Prestained Protein Ladder.

Figure 10: utilize indirect immunofluorescence experiment to detect the location of expressing protein in bacterium among the recombinant bacterium C501-COE of the present invention's preparation and the C501-SD.Wherein, Figure 10 A:C501-COE; Figure 10 B:C501-SD; Figure 10 C:C501-pYA.

Figure 11: the recombinant bacterium C501-COE of the present invention's preparation and the growth curve chart of C501-SD.

Figure 12: the recombinant bacterium C501-COE of the present invention's preparation and the genetic stability experimental result of C501-SD.Wherein:

Figure 12 A: the genetic stability qualification result of recombinant bacterium C501-COE.Wherein, M:DNA Marker (DL2000); 1-6: be respectively that recombinant bacterium C501-COE goes down to posterity 50 times, 40 times, 30 times, 20 times, 10 times and the PCR qualification result of 1st generation;

Figure 12 B: the genetic stability qualification result of recombinant bacterium C501-SD.Wherein, M:DNA Marker (DL2000); 1-6: be respectively recombinant bacterium C501-SD 1st generation and the PCR qualification result after 20 times, 30 times, 40 times and 50 times of going down to posterity.

Figure 13: the recombinant bacterium C501-COE of the present invention preparation and C501-SD behind immune BalB/C mouse for exogenous antigen mucous membrane sIgA antibody horizontal.Wherein:

Figure 13 A: the mucous membrane sIgA antibody horizontal of the anti-COE albumen behind the recombinant bacterium C501-COE immune mouse;

Figure 13 B: the mucous membrane sIgA antibody horizontal of the anti-SD albumen behind the recombinant bacterium C501-SD immune mouse.

Figure 14: the recombinant bacterium C501-COE of the present invention preparation and C501-SD behind immune BalB/C mouse for the serum IgG antibody level of exogenous antigen.Wherein:

Figure 14 A: the serum IgG antibody level of the anti-COE albumen behind the recombinant bacterium C501-COE immune mouse;

Figure 14 B: the serum IgG antibody level of the anti-SD albumen behind the recombinant bacterium C501-SD immune mouse.

Figure 15: the recombinant bacterium C501-COE of the present invention's preparation and the antibody horizontal of C501-SD pin Salmonellas behind immune BalB/C mouse.Wherein:

Figure 15 A: the serum IgG antibody level of the anti-salmonella behind recombinant bacterium C501-COE and the C501-SD immune mouse;

Figure 15 B: the mucous membrane sIgA antibody horizontal of the anti-salmonella behind recombinant bacterium C501-COE and the C501-SD immune mouse.

Figure 16: the level of difference on the IFN-γ mRNA that the recombinant bacterium C501-COE of the present invention's preparation and C501-SD induce in Mice Body relatively.Wherein,

Figure 16 A: the results of comparison of the IFN-γ mRNA level that recombinant bacterium C501-COE induces and empty plasmid contrast bacterium;

Figure 16 B: the results of comparison of the IFN-γ mRNA level that recombinant bacterium C501-SD induces and empty plasmid contrast bacterium.

Figure 17: the diversity ratio of the IFN-γ protein expression level that the recombinant bacterium C501-COE of the present invention's preparation and C501-SD induce in Mice Body.Wherein:

Figure 17 A: the results of comparison of the IFN-γ protein expression level that recombinant bacterium C501-COE induces and empty plasmid contrast bacterium;

Figure 17 B: the results of comparison of the IFN-γ protein expression level that recombinant bacterium C501-SD induces and empty plasmid contrast bacterium.

Embodiment

The present invention is further illustrated below in conjunction with Figure of description.

Embodiment 1: the porcine epizootic diarrhea protective antigen COE that preparation can prokaryotic expression and the gene fragment of SD albumen

(1) preparation prokaryotic expression plasmid pET-32a-COE and the required design of primers of pET-32a-SD, its sequence is as described in Table 1.

Table 1 preparation prokaryotic expression plasmid pET-32a-COE and the required primer sequence of pET-32a-SD

The underscore of primer partly is restriction enzyme site in the table 1.

(2) preparation can prokaryotic expression COE and SD fragment

Utilize Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and the pig A rotavirus multiple RT-PCR detection method (Zhang Kun, 2010) of a female report, detect the clinical pathological material of disease of censorship.From the positive ight soil pathological material of disease that Porcine epidemic diarrhea virus infects, geneome RNA (adopt the total RNA extraction reagent box of BioFlux company, the test kit specification sheets that provides according to the said firm operates) is provided, then carry out reverse transcription.Take the resulting cDNA of reverse transcription as template, respectively take the EP1/HP2 shown in the table 1 and SDE1/SDS2 as primer, pcr amplification is with the PEDV COE gene of EcoR I, HindIII restriction enzyme site with the SD gene fragment of ECOR I, Sal I restriction enzyme site, and amplification system is as described below:

The pcr amplification condition of COE gene segment and SD gene fragment: behind 95 ℃ of denaturation 4min, carry out following circulation: 94 ℃ of sex change 40s, 58.1 ℃ of annealing 45s, 72 ℃ are extended 50s, 30 circulations, last 72 ℃ of 10min.

After amplification is finished, get PCR product 8 μ L, add 1 μ L10 * Loading Buffer, carry out electrophoresis with 0.8% sepharose, electrophoresis result is observed in EB dyeing.Reclaim the purifying (according to the specification sheets operation of this test kit) that test kit carries out goal gene with BioFlux company glue behind the electrophoresis.COE gene fragment behind the purifying and prokaryotic expression carrier pET-32a are carried out respectively running the glue recovery behind EcoR I and the HindIII double digestion, utilize the T4DNA ligase enzyme to connect the rear escherichia coli expression Host Strains BL21 (DE3) of conversion; SD gene fragment behind the purifying and prokaryotic expression carrier pET-32a are carried out respectively running the glue recovery behind EcoR I and the Sal I double digestion, utilize the T4DNA ligase enzyme to connect the rear escherichia coli expression Host Strains BL21 (DE3) of conversion.Identify through PCR, double digestion and order-checking, finally obtain can prokaryotic expression porcine epizootic diarrhea COE and SD gene fragment.The preparation flow of gene fragment that can prokaryotic expression as shown in Figure 1.The comparison result of sequencing result and other strain sequence as shown in Figure 2.

Embodiment 2: the Construction and identification of recombinant plasmid pYA-COE and pYA-SD

Will be with EcoR I, the recombinant plasmid pET-32a-COE of HindIII restriction enzyme site and with ECOR I, the pET-32a-SD of Sal I restriction enzyme site carries out double digestion and reclaims, then be connected with the same shuttle plasmid pYA3493 (the plasmid construction collection of illustrative plates is seen Fig. 3) that reclaims through double digestion, connect the intestinal bacteria x6097 (source: Dr.Roy Curtiss professor III of Washington, DC university is so kind as to give) that product transforms asd genetically deficient, screening positive clone, extract plasmid, identify through PCR and double digestion, obtain making up correct recombinant plasmid pYA-COE and pYA-SD (as shown in Figure 4 and Figure 5).Wherein, pcr amplification system and amplification condition such as embodiment 1, (2) are described.

Embodiment 3: express Porcine epidemic diarrhea virus COE and the recombinant salmonella bacterial strain C501-COE of SD fusion rotein and the Construction and identification of C501-SD

(1) identify the design of the primer that the Salmonellas C501-COE of restructuring and C501-SD are required, its dna sequence dna is as shown in table 2:

The dna sequence dna of the primer that the Salmonellas C501-COE of table 2 evaluation restructuring and C501-SD are required

(2) the Salmonellas C501-COE of restructuring and the Construction and identification method of C501-SD

The recombinant plasmid pYA-COE that evaluation is correct and pYA-SD (embodiment 2 is seen in the source) respectively electricity are converted in the C500-competent cell of asd disappearance, electroporation (Bio-Rad GenePulserII) parameter is set to: voltage 2.2Kv, electric capacity 25 μ F, pulse resistance 200 Ω and time 4ms make up schema and see Fig. 6.On the negative flat board of DAP, picking list bacterium colony is cultivated 8-10h in the TSB liquid nutrient medium, draws 1mL bacterium solution preparation template, take the EP1/HP2 shown in the table 1 and SDE1/SDS2 as primer, carries out the amplification (as shown in Figure 7) of purpose fragment respectively; The Auele Specific Primer pi1/pi2 (seeing Table 2) that re-uses Salmonellas specific gene invA gene (GenBank:M90846.1) carries out Salmonellas specificity identification (as shown in Figure 8) to recombinant bacterium; The last evaluation of checking order take the primer pY1 shown in the table 2 as the upstream sequencing primer.It is correct that the result shows that the Salmonella choleraesuls of the restructuring that contains pYA-COE and pYA-SD plasmid make up, the applicant is respectively with its called after Salmonella choleraesuls bacterial strain (Salmonella choleraesuis) C501-COE and C501-SD, and delivers the preservation that Chinese Typical Representative culture collection center (CCTCC) is used for patented procedure.

Embodiment 4: express Porcine epidemic diarrhea virus COE and the recombinant salmonella bacterial strain C501-COE of SD fusion rotein and the biological characteristics of C501-SD

(1) the expression characterization analysis of recombinant bacterium C501-COE and C501-SD

Single bacterium colony of picking recombinant bacterium C501-COE and C501-SD is in the TSB liquid nutrient medium respectively, 37 ℃, 200r/min cultivates 12h, places 12h for 4 ℃, and (prescription: 3%TSB powder (30g) is dissolved in ddH to be inoculated in the TSB liquid nutrient medium by 1: 100 volume ratio ₂Among the O, behind 15 pounds of autoclaving 15min in room temperature preservation.) in, 37 ℃, 200r/min, cultivate 6-8h, the centrifugal 10min of 8000rpm collects respectively thalline and supernatant, supernatant liquor is through 0.22 μ m membrane filtration, get 900 μ l supernatants, and add 100% trichoroacetic acid(TCA) 100 μ l, make the final concentration of above-mentioned recombinant bacterium all reach 10%, behind the ice bath 30min, 12000r/min, centrifugal 30min abandons supernatant; The absolute ethanol washing precipitation that adds the 1mL precooling, 12000r/min, centrifugal 10min, so repeated washing is 2 times.Resulting albumen (is so kind as to give by Harbin Veterinary Medicine Inst., China Academy of Agriculture with pig source porcine epidemic diarrhea resisting virus-positive serum, see that the genetic resources table is described) make primary antibodie, carry out Western blotting and identify (as shown in Figure 9), the result shows that recombinant bacterium of the present invention can the secreting, expressing fusion rotein, and fusion rotein can with the Porcine epidemic diarrhea virus positive serum antibody generation specific reaction of pig.

In addition, through indirect immunofluorescence experiment the location of fusion rotein in bacterium identified that authentication method is with reference to Master's thesis (the Wang Miao .2006 of Wang Miao.), experimental result shows that the expressed fusion rotein of recombinant bacterium is positioned the surface (as shown in figure 10) of bacterium.

(2) the growth characteristics analysis of recombinant bacterium C501-COE and C501-SD

With recombinant bacterium C501-COE, C501-SD in TSB after 37 ℃ of overnight incubation, carry out continuous 10 times of dilutions, choose 3 suitable dilution gradients, each extent of dilution is got 100 μ L and is uniformly coated on the TSA flat board, and each gradient is respectively done 3 repetitions, 37 ℃, overnight incubation, counting is averaged, and is calculated the CFU (colony-forming unit) of stoste.It is 10 that switching makes its final concentration ⁶CFU/mL, 37 ℃, the 200r/min shaking culture, the OD600 value is surveyed in every interval 1h sampling, draws growth curve.Identical method is drawn the growth curve of parent plant pig Salmonellas C500 and empty carrier plasmid control strain C501-pYA, then compares the difference of its growth characteristics.Can find out from the growth curve (as shown in figure 11) of recombinant bacterium, recombinant bacterium C501-COE, recombinant bacterium C501-SD, empty carrier plasmid control strain C501-pYA are in culturing process, growth conditions and parent strain pig Salmonellas C500 basic simlarity, just the speed of growth slightly is slower than parent pig Salmonellas.

(3) phenotypic evaluation of recombinant bacterium C501-COE and C501-SD

Respectively that recombinant bacterium C501-COE, C501-SD, empty plasmid control strain C501-pYA and parent strain C500 streak inoculation is dull and stereotyped in TSA, then picking list bacterium colony, the carbon source biochemical identification pipes such as pectinose, seminose, hydrogen sulfide, lactose, wood sugar, urea, glucose, rhamnosyl, melampyrin, sucrose of transferring respectively, 37 ℃, incubation 24h carries out the phenotype of recombinant bacterium and judges.Biochemical identification result shows, recombinant bacterium C501-COE, C501-SD are identical with parent bacterium C500 biochemical characteristic with C501-pYA, all can not utilize sucrose, pectinose, urea, lactose, melampyrin and sucrose, but can utilize seminose, wood sugar, glucose and rhamnosyl as sole carbon source.

(4) genetic stability of recombinant bacterium C501-COE and C501-SD

With recombinant bacterium C501-COE and C501-SD with the TSA solid medium (prescription: 4%TSA powder (40g) is dissolved among the ddH2O, behind 15 pounds of autoclaving 15min in room temperature preservation.) preparation flat board on streak culture, picking list bacterium colony is to liquid nutrient medium, 37 ℃, 200r/min, shaking culture 12h, then be transferred in the fresh TSB liquid nutrient medium by 1: 100 volume ratio, cultivate 12h, repeating so continuously switching cultivates 50 times, with the 1st, 10,20,30, the culture in 40 and 50 generations is template, carries out pcr amplification with the described primer EP1/HP2 of table 1 and SDE1/SDS2 respectively, pcr amplification system and amplification condition such as embodiment 1, (2) described, detect recombinant plasmid pYA-COE and the genetic stability of pYA-SD in Δ asd C500.Qualification result proves, all can be from each for the specific DNA band (as shown in figure 12) that amplifies 480bp and 462bp the recombinant bacterium culture.

Embodiment 5: the immunogenicity of analyzing recombinant bacterium take the Balb/C mouse as animal model

1. mouse immune experimental design

70 BALB/c mouse are (available from Disease Prevention Control Center, Hubei Prov, see that the genetic resources table is described) be divided at random 7 groups, every group 10, be respectively oral recombinant bacterium C501-COE, intramuscular injection recombinant bacterium C501-COE, oral recombinant bacterium C501-SD, intramuscular injection recombinant bacterium C501-SD, oral recombinant bacterium C501-pYA, intramuscular injection recombinant bacterium C501-pYA and TSB control group, after head exempts from, exempt from rear two weeks (head exempts from rear 4 weeks) docking blood sampling two weeks and two and collect intestinal contents, indirect ELISA method detects antibody horizontal (IgA and IgG antibody), and concrete operation step is as described below:

1.1 immune serum IgG antibody horizontal ELISA detects:

According to document " detailed annotation of vaccine gordian technique " original work second edition (A. Robinson etc., 2006), with the concentration coated elisa plate of prokaryotic expression protein (COE albumen and SD albumen) by 0.5 μ g/ hole, 100 μ l/ holes, 4 ℃, coated spending the night, washings washing 3 times, 3min/ time;

(2) add confining liquid and seal, 150 μ l/ holes, 37 ℃, sealing 2h takes out washing 3 times, 3min/ time;

(3) serum to be checked is carried out doubling dilution since 1: 2 or 1: 10, add enzyme plate, 100 μ l/ holes, 37 ℃, reaction 1h takes out washing 3 times, 3min/ time;

(4) the sheep anti mouse HRP-IgG of 1: 6000 times of dilution of adding, 100 μ l/ holes, 37 ℃, reaction 1h washs 3min/ time 5-6 time;

(5) add tetramethyl benzidine substrate (A+B) 100 μ l, room temperature lucifuge reaction 10-15min adds 50 μ l 0.25%HF termination reactions again, measures OD630 with microplate reader _Nm

(6) select OD630 _Nm〉=0.2 reacting hole as the positive, is got the inverse of the highly diluted multiple of serum to be checked, is converted into the titre of antibody.

1.2 immune mouse intestinal secretion IgA antibody horizontal detects:

Respectively at 21d after the immunity, 28d gets 2-3 mouse at random, and the cervical vertebra dislocation is put to death, and scraping enteron aisle surface mucus is done 10 times of dilutions with pH 7.4PBS in the 1.5ml centrifuge tube, and-20 ℃ save backup behind the mixing.

Enteron aisle sIgA antibody ELISA detection method is described with embodiment 5,1.1.Wherein, composition and the preparation process of the used core reagent of indirect ELISA detection method are as follows:

The carbonate buffer solution of coating buffer: pH9.6 (25mmol/L); Na ₂CO ₃1.59g, NaHCO ₃2.93g, ddH ₂O is settled to 1L;

PBS damping fluid: 140mmol NaCl (8.18g), 2.7mmol KCl (0.20g), 10mmol Na ₂HPO ₄(3.58g), 1.8mmol KH ₂PO ₄(0.245g), be dissolved in 800mL ddH ₂Among the O, transfer to pH7.4 with the NaOH of 5mol/L after, ddH ₂O is settled to 1L;

Washings: the Tween-20 of adding 0.05% in the PBS damping fluid;

Confining liquid: add 0.50g bovine serum albumin (BSA) in the 1L washings;

The phosphate-citrate salts damping fluid 25.7mL of substrate buffer solution: pH5.0, the citric acid solution 24.3mL of 0.1mol/L, the Na2HPO4 25.7mL of 0.2mol/L, ddH2O 50mL;

The TMB mother liquor: 0.2g TMB dry powder is dissolved in the dehydrated alcohol of 100mL;

Substrate solution (TMB): TMB mother liquor and substrate buffer solution in after mixing in 1: 20 ratio, are added 30% H2O2 0.2 μ L in every milliliter of substrate solution;

Stop buffer: 0.25%HF.

Before the immunity, need recombinant bacterium is carried out live bacterial count.4h before oral group of immunity, the BALB/c mouse material of need cutting off the water, the oral 50 μ l 10%NaHCO of 20min before immune ₃In and hydrochloric acid in gastric juice, then use BALB/c mouse gavage pin oral immunity 200 μ l No. 12, make every BALB/c mouse immunizing dose be about 1.5 * 10 ⁸Individual viable bacteria amount (dosage reference: People's Republic of China's veterinary biologics quality standard, 2001 editions); Identical under every BALB/c mouse immunizing dose of intramuscular injection group and the oral immunity group; TSB blank group immunization 200 μ l.

In 2 weeks after the immunity, choose at random 5 for every group and carry out booster immunization.Respectively at 2 weeks carrying out the mouse tail vein negative pressure hemostix behind 2 weeks, the booster immunization before the first immunisation, after the first immunisation, collect serum, with 5 BALB/c mouse serum balanced mix, adopt indirect elisa method to detect the average antibody level of respectively organizing.

2. the detection of the porcine epidemic diarrhea resisting of immune BALB/c mouse virus protective antigen protein antibodies level

The collection immunity is front respectively, head exempts from rear 2 weeks and the two BALB/c mouse serum of exempting from rear 2 weeks utilize indirect ELISA method to detect serum IgG antibody; Respectively at 21d after the immunity, 28d gets 2-3 BALB/c mouse at random, and the cervical vertebra dislocation is put to death, and scraping enteron aisle surface mucus with pH 7.4PBS dilution, utilizes indirect ELISA method to detect mucous membrane sIgA antibody in the 1.5ml centrifuge tube.According to document " detailed annotation of vaccine gordian technique " original work second edition (A. Robinson etc., 2006), with the concentration coated elisa plate of prokaryotic expression protein (COE albumen and SD albumen) by 0.5 μ g/ hole, serum to be checked or intestinal mucosa content were carried out doubling dilution since 1: 2 or 1: 10, join respectively in the respective reaction hole and detect.

Detected result is as follows: 1. sIgA production, recombinant bacterium C501-COE and C501-SD oral immunity group sIgA antibody titers are respectively 1: 1280 and 1: 2048, and the sIgA antibody titers of intramuscular injection group was respectively 1: 640 and 1: 1024 (as shown in figure 13); 2. serum IgG antibody production, IgG antibody titers in recombinant bacterium C501-COE and the C501-SD intramuscular injection group is respectively 1: 4096 and 1: 2560, and the IgG antibody titers that the oral immunity group produces was respectively 1: 2048 and 1: 1280 (as shown in figure 14)

(3) the horizontal ELISA of immune BALB/c mouse antibodies toward salmonella detects

The preparation of Salmonellas ELISA antigen: the single bacterium colony of picking Salmonellas is in 5mL TSB liquid nutrient medium, 37 ℃, activation is spent the night, be to be forwarded to 100mL TSB liquid nutrient medium at 1: 100 with volume ratio, 37 ℃, 200r/min cultivates 8h, 8000r/min, centrifugal 10min, collect thalline, use the PBS of pH 7.4 to wash 2 times, then, with the PBS of pH 7.4 take volume ratio as 1: 10 times concentrated resuspended, (UP 200S processor for ultrasonic wave-German Dr.Hielscher company makes power: 200W to limpid in ultrasonication on ice, amplitude: 60%, operating frequency: 24KHz, the ultrasonic disruption time: 30s/ time, pitch time: 1min/ time), 12000r/min, centrifugal 20min abandons precipitation.With spectrophotometric determination supernatant protein concentration, packing 500 μ l/ pipe saves backup in-20 ℃.According to document " detailed annotation of vaccine gordian technique " original work second edition (A. Robinson etc., 2006), by the coated elisa plate of the concentration in 0.5 μ g/ hole, indirect ELISA method detects IgG antibody in the immune BALB/c mouse serum and the Specific IgA antibody level in the intestinal mucosa with the Salmonellas albumen of preparation.

Detected result shows that recombinant bacterial strain C501-COE and C501-SD immune group BALB/c mouse are all induced Salmonellas serum IgG antibody and the enteron aisle sIgA antibody (as shown in figure 15) that has produced with empty carrier control strain C501-pYA immune group BALB/c mouse similar level

(4) cellular immunization detects

Concrete grammar is pressed document (Xiao Shaobo, 2004) and is carried out:

The preparation mouse spleen lymphocyte, and the adjustment cell concn is 2 * 10 ⁶/ mL joins in the 24 porocyte culture plates, the 1mL/ hole, and it is former to make stimulated in vitro with the target protein of purifying, and to make final concentration of protein be 10 μ g/mL.24 porocyte culture plates are put in 37 ℃, 5%CO ₂Cultivate in the cell culture incubator, behind the 20h, each selects a cell hole, extracts cell total rna, by the difference on the quantitative method mensuration IFN-γ mrna expression level of relative fluorescence.The remaining cell hole, behind 72h, the collecting cell supernatant utilizes two sandwich ELISA methods (to adopt R﹠amp; D company mouse IFN-γ detection kit detects, and concrete operation step is with reference to the specification sheets of this test kit), detect the difference on the IFN-γ protein expression level.

Utilize the method for SYBR Green Real-time PCR, detect the mRNA of IFN-γ in the BALB/c mouse immune spleen cell with respect to the expression amount of the mRNA of β-actin, and carried out relative quantitative assay, the result shows, the relative expression quantity of IFN-γ mRNA is higher than empty carrier plasmid C501-pYA immune group in recombinant bacterium C501-COE and the C501-SD immune group BALB/c mouse splenocyte, and the relative expression quantity of the IFN-γ mRNA of intramuscular injection group will be higher than oral immunity group (as shown in figure 16).

Adopt two sandwich ELISA methods (to adopt R﹠amp; D company mouse IFN-γ detection kit detects, concrete operation step is with reference to the specification sheets of this test kit) detect the IFN-γ level of each immune group splenocyte secretion, the result shows, IFN-γ protein expression level is apparently higher than being higher than empty carrier plasmid C501-pYA immune group in recombinant bacterium C501-COE of the present invention and the C501-SD immune group BALB/c mouse splenocyte, and recombinant bacterium intramuscular injection group IFN-gamma antibodies level will be a little more than the oral immunity group.(as shown in figure 17)

In addition, the IFN-γ that Salmonellas empty plasmid control group C501-pYA induces be the mRNA level or on protein level higher than TSB control group all, this may can to serve as adjuvant relevant with Salmonellas itself, thereby can stimulate body to produce more intense cell immune response.

Embodiment 6: utilize Salmonellas C501-COE and the C501-SD of restructuring to prepare bivalent genetic engineering vaccine

Recombinant bacterium C501-COE and C501-SD is streak culture on the TSA solid medium, and picking list bacterium colony is cultivated in the TSB liquid nutrient medium, is cultured to viable bacteria concentration and reaches 2.5 * 10 ¹⁰CFU/mL.With bacterium liquid low-speed centrifugal collection bacterium, in the bacterium liquid of Salmonellas C501-COE and C501-SD: gelatin protective material (volume: be that 2: 1 ratio adds gelatin protective material (protective material compound method: every 100mL ddH volume) ₂Add sucrose 40g, gelatin 8g among the O; Fully dissolving is rear in 121 ℃ of autoclaving 30min, save backup), in sterilization freeze-drying bottle, press the packing of 2.0mL/ bottle, put freeze-drying in-50 ℃ of freeze driers, freeze-drying 36-40h rear pressing cover dissolves and carries out live bacterial count (CFU) with physiological saline or PBS (pH7.4), and guarantees there is not living contaminants, place-20 ℃ to save backup, as the vaccine strains of development recombiant vaccine.

Embodiment 7: the preliminary clinical protection effect observation of recombiant vaccine bacterial strain

(1) the recombiant vaccine bacterial strain is to the safety testing of newborn piglet

Randomly draw the healthy 1 age in days piglet (kind is landrace) of 2 nests from a large scale of pig farm field, with 3 * 10 ⁹The immunizing dose of CFU, the freeze-drying attenuation salmonella vaccine of oral immunity the present invention preparation, tracing observation 7 days finds that immunity front and back piglet body temperature is unchanged, and piglet can normally suck breast milk, illustrates that thus the freeze-drying attenuation salmonella vaccine that the present invention prepares is safe.

(2) the freeze-drying attenuation salmonella vaccine of the present invention's preparation is to the immunoprotection test of piglet

The large-scale pig farm of selecting two PEDV to infect is with 3 * 10 ⁹The immunizing dose of CFU, the freeze-drying attenuation salmonella vaccine of oral immunity the present invention preparation, 1 week of tracing observation, record piglet (kind is landrace) sickness rate and surviving rate after each pig farm immunity, estimate immune effect (see Table 3 and table 4).

Table 3 pig farm A uses the immune effect of the Porcine epidemic diarrhea virus recombinant salmonella choleraesuis genetically engineered living vaccine of the present invention's preparation

Table 4 pig farm B uses the immune effect of the Porcine epidemic diarrhea virus recombinant salmonella choleraesuis genetically engineered living vaccine of the present invention's preparation

By the clinical trial statistic data of table 3 and table 4 as can be known, not only security is better for the freeze-drying attenuation salmonella vaccine of the present invention's preparation, and has preferably preventive effect.Behind the newborn piglet immunity recombiant vaccine, A field diarrhea rate drops to 18%～30%, B field mortality ratio by 100% and then drops to 8%～20% by 80%, and the result has shown that this recombiant vaccine has preferably immunoprophylaxis effect.

Reference

1.A. Robinson etc. the detailed annotation of vaccine gordian technique. the original work second edition. (Che Yanchun etc. translate for Li Qihan, Liu Longding). Beijing: Chemical Industry Press, 2006,12-14.

2. Ge Jun is big, Wang Miao, Li Yijing etc. the immunne response [J] that the recombinant lactobacillus casei immune mouse of expression Porcine epidemic diarrhea virus neutralizing antigenic site is induced. and Chinese veterinary science, 2010,40 (07): 708-712.

3. Wang Miao. express in the Porcine epidemic diarrhea virus and the master of the structure Northeast Agricultural University Diplomarbeit .[master thesis of antigenic region Recombinant Lactococcus lactis system]. Wuhan: Hua Zhong Agriculture University Library, 2006.

4. Xu draws younger brother, Guo Aizhen, Liu Weihong etc. structure and the evaluation [J] of Salmonella choleraesuis C500 strain Δ crp Δ asd gene-deleted strain balanced lethal carrier system. and biotechnology journal, 2006,22 (3): 366-372.

5. Xu draws younger brother. Salmonella choleraesuis C500 strain crp ^-, asd ^-The construction and application .[doctorate paper of gene-deleted strain balanced lethal system]. Wuhan: Hua Zhong Agriculture University Library, 2006.

6. Xiao lacks ripple. and Pseudorabies virus gC gene " the immune-enhancing effect research .[doctorate paper of Suicidal DNA Vaccine and VP22 protein transduction]. Wuhan: Hua Zhong Agriculture University Library, 2004.

7. open female, what opening. foundation and the clinical application [J] of Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and pig A rotavirus multiple RT-PCR detection method. journal of animal science and veterinary medicine, 2010,41 (8): 1001-1005.

8.Alper?M?D，Ames?B?N.Transport?of?antibiotics?and?metabolite?analogs?by?systems?under?cyclic?AMP?control：positive?selection?of?Salmonella?typhimurium?cya?and?crp?mutants[J].J?Bacteriol，1978，133(1)：149-157.

9.Cavanagh?D，Brian?D?A，Briton?P，et?al.Nidovirales：a?new?order?comprising?Coronaviridae?and?Arteriviridae[J].Arch?Virol，1997，142(3)：629-633.

10.Chasey?D，Cartwright?S?F.Virus-like?particles?associated?with?porcine?epidemic?diarrhea.Res?Vet?Sci，1978，25(2)：255-256.

11.Chen?H.，Schifferli?D.M，et?al.Enhanced?immune?responses?to?vira?lepitopes?by?combining?macrophage-inducible?expression?with?multimeric?display?on?a?Salmonella?vector.Vaccine，2001，19(20-22)：3009-3018.

12.Dietrich?G，Bubert?A，Gentschev?I，et?al.Delivery?of?antigen-encoding?plasmid?DNA?into?the?cytosol?of?macrophages?by?attenuated?suicide?Listeria?monocytogenes[J].Nat?Biotechnol，1998，16(2)：181-185.

13.Dougan?G，Chatfield?S，Pickard?D，Bester?J，O’Callaghan?D?and?Maskell?D.Construction?and?characterization?of?vaccine?strains?of?Salmonella?harboring?mutations?in?two?different?aro?genes[J].J?Infect?Dis，1988，158(6)：1329-1335.

14.Galan?J?E?and?Curtiss?III?R.Virulence?and?vaccine?potential?of?phoP?mutants?of?Salmonella?typhimurium[J].Microb?Pathogen，1989，6：433-443.

15.Galan?J?E，Nakayama?K，Curtiss?R?D.Cloning?and?characterization?of?the?asd?gene?of?Salmonella?typhimurium：use?in?stable?maintenance?of?recombinant?plasmids?in?Salmonella?vaccine?strains[J].Gene，1990，94：29-35.

16.Gernianier?R，Furer?E.Isolation?and?characterization?of?GalE?mutant?Ty?21a?of?Salmonellu?typhi：a?candidate?strain?fora?live，oral?typhoid?vaccine[J].J?Infect?Dis，1975，131：553-558.

17.Nguyen?X?H，Young?S?K，Sang?C?J，et?al.Production?of?a?Heat-labile?Enterotoxin?B?Subunit-porcine?Epidemic?Diarrhea?Virus-neutralizing?Epitope?Fusion?Protein?in?Transgenic?Lettuce(Lactuca?sativa)[J].BIOTECHNOLO?BIOPROC?E，2009，14：731-737.

18.Paglia?P，Medina?E，Arioli?I，et?al.Gene?transfer?in?dendritic?cells，induced?by?oral?DNA?vaccination?with?Salmonella?typhimurium，results?in?protective?immunity?against?a?murine?fibrosarcoma[J].Blood，1998，92(9)：3172-3176.

19.Pensaert?M?B.Porcine?Epidemic?Diarrhea.DiseasesofSwine[J].Iowa?State?University?Press，1986，402-406.

20.Pensaert?M?B，Yeo?S?G.Porcine?epidemic?diarrhea.In：Straw?B?E，Zim-merman?J?J，D’Allaire?S，Taylor?D?J.(eds.)，Diseases?of?Swine.Wiley-Blackwell，Ames，2006，9：367-372.

21.Pospischil?A，Stuedli?A，Kiupel?M，et?al.Update?on?porcine?epidemic?diarrhea[J].J?Swine?Health?Prod，2002，10(2)：81-85.

22.Spreng?S，Dietrich?G，Weidinger?G.Rational?design?of?Salmonella-based?vaccination?strategies[J].Methods，2006，38：133-143.

23.Sun?D?B，Feng?L，Shi?H?Y，Chen?J?F，et?al.

cation?of?two?novel?B?cell?epitopes?on?porcine?epidemic?diarrhea?virus?spike?protein[J].Veterinary?Microbiology，2008，131：73-81.

24.Timoney?J?F，GillesPie?J?H，Seott?F?W，et?al.Microbiology?and?Infectious?Diease?of?Domestie?Animals.Ithaca：Comstock?Publishing?Associates，1988，897-898.

25.Zhao?Z，Xue?Y，Wu?B，et?al.Subcutaneous?vaccination?with?attenuated?Salmonella?enterica?serovar?Choleraesuis?C500?expressing?recombinant?filamentous?hemagglutinin?and?pertactin?antigens?protects?mice?against?fatal?infections?with?both?S.enterica?serovar?Choleraesuis?and?Bordetella?bronchiseptica[J].Infect?Immun，2008，76(5)：2157-2163

Claims

1. Salmonella choleraesuls C501-COE and the C501-SD of a restructuring; it is characterized in that; described Salmonella choleraesuls (Salmonella choleraesuis) C501-COE and C501-SD are deposited in Chinese Typical Representative culture collection center; its preserving number is respectively CCTCC NO:M2011296 and CCTCC NO:M2011297; described Salmonella choleraesuls C501-COE and C501-SD contain respectively expression Porcine epidemic diarrhea virus protective antigen gene COE and SD, and the sequence of their protein is shown in sequence table SEQ ID NO:2 and 4.

2. the Salmonella choleraesuls C501-COE of a restructuring and the preparation method of C501-SD, it comprises the following steps:

1) difference construction recombination plasmid pET-32a-COE and pET-32a-SD, to increase respectively from the sick swine excrement pathological material of disease of suffering from Porcine Epidemic Diarrhea (Porcine epidemic diarrhea) Porcine epidemic diarrhea virus COE gene and SD gene, the nucleotide sequence of described COE gene and SD gene is shown in SEQ ID NO:1 and SEQ ID NO:3 with two primers as follows:

The right dna sequence dna of the primer is distinguished as follows:

COE forward primer: GATGAATTCATGCATGAACAGCCAATTTC (5 ' → 3 '),

COE reverse primer: GGGAAGCTTGATAGTATACTTGGTACACACATCC (5 ' → 3 ');

SD forward primer: GACGAATTCATGACAGACGTTTCTTTTATGACTC (5 ' → 3 '),

SD reverse primer: GGGGTCGACAATACTCATACTAAAGTTGGTGGG (5 ' → 3 ');

Respectively with its subclone to prokaryotic expression carrier pET-32a, construction recombination plasmid pET-32a-COE and pET-32a-SD, wherein recombinant plasmid pET-32a-COE comprises the nucleotide sequence shown in sequence table SEQ ID NO:1; Described recombinant plasmid pET-32a-SD comprises the nucleotide sequence shown in sequence table SEQ ID NO:3;

2) difference construction recombination plasmid pYA-COE and pYA-SD, carry out respectively double digestion with making up correct prokaryotic expression plasmid pET-32a-COE and pET-32a-SD, and with connect through the shuttle plasmid pYA3493 of identical double digestion, transform the intestinal bacteria x6097 of asd genetically deficient, screening positive clone;

3) make up respectively recombinant salmonella choleraesuis C501-COE and C501-SD, recombinant plasmid pYA-COE and pYA-SD electricity are converted in the Salmonella choleraesuls C500 Δ crp Δ asd gene-deleted strain, and obtaining respectively deposit number is Salmonella choleraesuls C501-COE and the C501-SD of CCTCC NO:M2011296 and CCTCC NO:M2011297.

One kind can prokaryotic expression Porcine epidemic diarrhea virus major antigen site gene fragment COE, the nucleotide sequence of this fragment is as follows:

CATGAACAGC?CAATTTCTTT?TGTTACTTTG?CCATCATTCA?ATGATCATTC

TTTTGTTAAT?ATTACTGTCT?CTGCGGCTTT?TGGTGGTCAT?AGTGGTGCCA

ACCTCATTGC?ATCTGACACT?ACTATCAATG?GGTTTAGTTC?TTTCTGTGTT

GACACTAGAC?AATTTACCAT?TACACTGTTT?TATAACGTTA?CAAACAGTTA

TGGTTATGTG?TCTAAGTCAC?AGGATAGTAA?TTGCCCTTTC?ACCTTGCAAT

CTGTTAATGA?TTACCTGTCT?TTTAGCAAAT?TTTGTGTTTC?AACCAGCCTT

TTGGCTGGTG?CTTGTACCAT?AGATCTTTTT?GGTTACCCTG?AGTTCGGTAG

TGGTGTTAAG?TTTACGTCCC?TTTATTTTCA?ATTCACAAAG?GGTGAGTTGA

TTACTGGCAC?GCCTAAACCA?CTTCAAGGTG?TCACGGACGT?TTCTTTTATG

ACTCTGGATG?TGTGTACCA?AGTATACTATC

A kind of gene fragment SD that can prokaryotic expression Porcine epidemic diarrhea virus major antigen site, the nucleotide sequence of this fragment is as follows:

ACAGACGTTT?CTTTTATGAC?TCTGGATGTG?TGTACCAAGT?ATACTATCTAT

GGCTTTAAAG?GTGAGGGTAT?TATTACCCTT?ACAAATTCTA?GCTTTTTGGC

AGGTGTTTAT?TATACATCTG?ATTCTGGACA?GTTGTTAGCC?TTTAAGAATG

TCACTAGTGG?TGCTGTTTAT?TCTGTTACGC?CATGTTCTTT?TTCAGAGCAG

GCTGCATATG?TTGATGATGA?TATAGTGGGT?GTTATTTCTA?GTTTGTCTAA

CTCCACTTTT?AACAATACCA?GGGAGTTGCC?TGGTTTCTTC?TACCATTCTA

ATGATGGCTC?CAATTGTACA?GAGCCTGTGT?TGGTGTATAG?TAACATAGGT

GTCTGTAAAT?CTGGCAGTAT?TGGCTATGTC?CCACTTCAGG?ATGGCCAAG

TCAAGATTGC?ACCCATGGTT?ACTGGGAATA?TTAGTATTCC?CACCAACTTT

AGTATGAGTA?TT。

4. Salmonella choleraesuls and porcine epizootic diarrhea bivalent genetic engineering vaccine; its feature comprises; this vaccine contains Salmonella choleraesuls C501-COE claimed in claim 1 and C501-SD; according to volume ratio, the bacterium liquid of Salmonella choleraesuls C501-COE and C501-SD and gelatin protective material ratio are 2: 1.

5. the application of recombinant salmonella choleraesuis claimed in claim 1 in preparation Salmonella choleraesuls and porcine epizootic diarrhea bivalent genetic engineering vaccine.