CN101157907B - Recombinant salmonella choleraesuis strain for expression of pig origin bordetella bronchisepatica fhaB and prn gene segment, bacterin and uses thereof - Google Patents
Recombinant salmonella choleraesuis strain for expression of pig origin bordetella bronchisepatica fhaB and prn gene segment, bacterin and uses thereof Download PDFInfo
- Publication number
- CN101157907B CN101157907B CN200710053386A CN200710053386A CN101157907B CN 101157907 B CN101157907 B CN 101157907B CN 200710053386 A CN200710053386 A CN 200710053386A CN 200710053386 A CN200710053386 A CN 200710053386A CN 101157907 B CN101157907 B CN 101157907B
- Authority
- CN
- China
- Prior art keywords
- vaccine
- pya
- strain
- gene
- porcine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention pertains to the animal bacteria gene engineering field, relating to construction, vaccine preparation and application of salmonella choleraesuis of recombinant porcine with fhaB and prngene fragment of porcine bordetella bronchiseptica from expression which contains no resistance markers. A strain of salmonella choleraesuis of recombinant porcine of C501 (pYA-F1P2 (preservation number is: CCTCC NO: M207138) with fhaB and prn gene fragment of porcine bordetella bronchiseptica from expression which contains no resistance markers is provided by the invention. The stain of asd genelacks of samonella choleraesuis, and contains plasmid of pYA-F1P2 which can express asd in the strain and fhaB and prn gene fragment of porcine bordetella bronchiseptica. The invention discloses a preparation method of the recombination stain and vaccine and application in the preparation of the vaccine of the porcine salmonella choleraesuis and the porcine bordetella bronchiseptica. The gene engineering vaccine of the invention can stimulate porcine to produce an immune reaction to protect porcine from the salmonella choleraesuis and the porcine bordetella bronchiseptica and can effectively prevent from being infected by the salmonella choleraesuis and the porcine bordetella bronchiseptica.
Description
Technical field
The invention belongs to the animal bacteria gene engineering technology field, be specifically related to structure, vaccine production and the application of the segmental recombinant salmonella choleraesuis living vaccine of the R2 bacterial strain of a kind of Type I fragment of the expression pig source thread adhesin gene of segmental bronchus sepsis bordetella bacilli (fhaB) that does not contain resistance marker and PRN gene (prn).
Background technology
Salmonella choleraesuls (Salmonella choleraesuis) are the main pathogen that causes 2-4 monthly age necrotic enteritis, cause after the infected pigs with classical symptoms such as acute sepsis, chronic necrosis enteritis, intractable diarrheas, often cause the large quantities of morbidities of weanling pig, as occur together or other disease of secondary infection or treat untimely, mortality ratio is higher, causes heavy losses.Animal infects Salmonellas before death or its product is polluted, and the people is poisoned by food, so this cause of disease is also significant on public hygienics.
People prevent salmonellal typhoid fever with the whole-bacterial-vaccine of deactivation the earliest; because deactivation vaccine has shortcomings such as causing whole body and local reaction easily, can only excite humoral immunization, cross protection can not be provided, need repeatedly booster immunization, the application of this type of vaccine is restricted.Subsequently, it is found that weak malicious Salmonellas induce aspect body fluid and the cell immune response than deactivation or subunit vaccine more effective.So the weak malicious seedling of various Salmonellass has worldwide obtained widespread use, has obtained the good preventing effect.China is at the beginning of the sixties, after the Salmonella choleraesuls virulent strain that Fang Xiaowen etc. are good with antigenicity is inoculated and is passed hundreds of generations in the substratum that contains thaliium acetate, select the good low virulent strain of a strain immunogenicity, be named as C500 (Fang Xiaowen etc., the research of the weak toadstool seedling of necrotic enteritis, journal of animal science and veterinary medicine, 1981 (2): 29～36).The C500 bacterial strain is promoted the use of in the whole nation, makes China's necrotic enteritis be effectively controlled (Huang ChangBing etc., the weak malicious aerated culture freeze-dried vaccine oral immunity research of necrotic enteritis, Scientia Agricultura Sinica, 1981 (6): 89～94; Kang Kai, living paratyphoid vaccine for piglets, Chinese veterinary drug magazine, 2003 (37) 37-49.
Over nearly 30 years, people begin pay close attention to use attenuation salmonella as the various exogenous antigens of vector expression to prevent great this research field of people, animal transmissible disease.Using the range gene engineering method makes up the Salmonellas attenuated strain and utilizes attenuation salmonella to express the research focus that exogenous antigen development polyvalent vaccine etc. has become this field as live vector.Attenuation salmonella has many advantages as vaccine carrier: what (1) produced cytotoxic T cell kills and wounds reaction (ctl response); (2) attenuation salmonella can more effectively excite host's body fluid and cellular immunization because of invading lymphsystem; (3) by natural infection approach such as oral or intranasal vaccination, can activating system and mucosal immunoreaction; (4) has immunoadjuvant function; (5) immunity has persistence; (6) have the combined immunization effect, can stably express protokaryon and eukaryotic gene, itself is not pathogenic, and as antityphoid vaccine; (7) expressed target antigen need not purified, and preparation simply can be directly used in the immunoprotection test, has significantly reduced the cost of manufacture of vaccine; (8) inoculation is simple and convenient, (Curtiss such as easy handling, R etc., 1996, Strategies for the use of live recombinantavirulent bacterial vaccines for mucosal immunization, p.499-511, In H.Kiyono and M.F.Kagnoff (ed.), Essentials of mucosal immunology, Academic Press, San Diego etc., 2006.Rational design ofSalmonella-based vaccination strategies.Methods 38:133-143; Sirard J etc., 1999.Live attenuatedSalmonella:a paradigm ofmucosal vaccines.Immunol.Rev.171:5-26).
The development of recombinant salmonella vaccine usually needs to use selective marker owing to generally adopted in the past the expression plasmid that carries resistant gene, resistant gene become vitro conversion screening transformant and plasmid external heredity main mark.But microbiotic is the main medicine for the treatment of infectation of bacteria clinically, and the maximum fear that causes thus is that resistant gene is propagated in the 20th-century disease pathogenic microorganism, thereby weakens the effect of drugs of these pathogen infections of treatment.Therefore, antibiotics resistance plasmid selective system is not accepted by people.Nowadays, people have developed the multiple salmonella vaccine system that does not contain the antibiotics resistance mark, as with the exogenous antigen stable integration to Salmonellas karyomit(e), or with screening recombinate bacterium but do not need antibiotic plasmid equilibrium system (Balanced-lethal PlasmidStabilisation System) of selection.Wherein, using maximum systems is asd plasmid vector balanced lethal system.The asd genes encoding aspartic acid beta galactose desaturase (aspartate L-semialdehyde dehydrogenase) of Salmonellas, be diaminopimelic acid (diaminopimelic acid, DAP) indispensable enzyme in the biosynthetic pathway, and DAP is a component of gram-negative bacteria cell wall main chemical compositions peptidoglycan tetrapeptide side chain, the strain of asd disappearance can not form intact cell walls under no external source DAP condition, final bacteriolyze death.Owing to do not contain DAP in the mammalian tissues, so mutant bacteria is degraded all in the substratum that does not contain DAP or in the animal body.Goal gene is inserted the plasmid that contains asd, can form complementation behind the conversion asd host bacterium, the asd Salmonellas of asd plasmid loss is dead in vivo, and the Salmonellas that only contains the asd plasmid could survive, and the stable exogenous antigen of vivoexpression in vivo.Owing to replaced the antibiotics resistance mark with asd grain carrier balanced lethal system, therefore also safer (Nakayama, K etc., 1988.Construction of an Asd
+Expression-cloning vector:stable maintenance and high levelexpression of cloned genes in a Salmonella vaccine strain.Bio/Technology 6:693-697; Kang, H etc., 2002, Immune responses to recombinant pneumococcal PspA antigen delivered by live attenuatedSalmonella enterica serovar Typhimurium vaccine.Infect.Immun., 70:1739-1749).
Segmental bronchus sepsis bordetella bacilli (Bordetella bronchiseptica, Bb) with Whooping cough bordetella bacilli (Bordetella pertussis, Bp), parapertussis bordetella bacilli (Bordetella parapertussis, Bpp) belong to the Podbielniak Pseudomonas together, both common infected person of back mainly cause people particularly infant's Whooping cough and parapertussis.Segmental bronchus sepsis bordetella bacilli can extensively infect multiple Mammals, and also infected person once in a while shows as the acute or chronic inflammation of respiratory tract, is referred to as Podbielniak bacterium disease (Bordetellosis).In swinery, the independent infection of segmental bronchus sepsis bordetella bacilli can cause pig generation pneumonia and atrophic rhinitis.In addition, bigger harm is that the infection in advance of this pathogenic bacteria is easy to cause other multiple cause of disease of pig secondary infection, as pasteurella multocida (Pasteurella multicida, Pm), swine streptococcus (Streptococcus suis, S.suis), haemophilus parasuis (Haemophilus suis, HPS), porcine reproductive and respiratory syndrome virus (Porcine reproductive and respiratory Syndrome virus, PRRSV) etc., thereby improve the sickness rate of respiratory tract disease and increase the severity of disease, cause bigger loss (Brockmeier, S etc., Effects of intranasalinoculation with Bordetella bronchiseptica, porcine reproductive and respiratory syndrome virus, ora combination of both organisms on subsequent infection with Pasteurella multocida in pigs.Am.J etc., 1992.Enhanced adherence of Pasteurella multocidato porcine tracheal rings preinfected withBordetella bronchiseptica.Can J Vet Res.56:260-264; Vecht, U etc., 1992., Virulence ofStreptococcus suis type 2strains in newborn germfree pigs depends on phenotype, Infect.Immun.60:550-556; Brockmeier S.L.2004.Prior infection with Bordetella bronchiseptica increases nasalcolonization by Haemophilus parasuis in swine.Vet Microbiol.99:75-78; De Jong M.F.1999.Progressive and nonprogressive atrophic rhinitis.In Straw B.E., d ' Allaire S., Mengeling W.L.andTaylor D.J. (eds.), Diseases of swine.Ames, IA:Iowa State University Press, p.355-384).Up to now, people just recognize gradually the harm that segmental bronchus sepsis bordetella bacilli causes swinery underestimated far away (Borckmeier S.Therole of Bordetella bronchiseptica inrespiratory diseases of swine:atrophic rhinitis and beyond.PigProgress (special) .2003,6:20-21).Simultaneously, people find that also this bacterium can form severe infections at immunodeficiency or low crowd's (in AIDS patient's body), therefore caused and shown great attention to (Valencia M.E., Enriquez A., Camino N., etal.Bordetella bronchiseptica pneumoniain patients with HIV.Enferm Infecc Microbiol Clin, 2004,22:502-503).
Segmental bronchus sepsis bordetella bacilli and Whooping cough bordetella bacilli, parapertussis bordetella bacilli sibship are nearer, and many virulence factors are that 3 kinds of pathogenic bacterias are common, comprise adhesin and toxin two big classes.Adhesin comprise filamentous hemagglutinin (filamentoushemagglutinin, FHA), PRN (pertactin, PRN), the tracheae adhesion factor (tracheal colonizationfactor, TcfA), pili (fimbriae, FIM) etc.; Toxin comprise dermatonecrotoxin (dermonecrotic toxin, DNT), tracheal cell toxin (tracheal cytotoxin), adenosine cyclase hemolysin (adenylate cyclase-hemolisin, AC-Hly) etc.The residing environment of the expression of these virulence factors and cause of disease has dependency closely, regulates by BvgA/S double factor regulation system and expresses.FHA and PRN are considered to most important adhesion factor and antigenic component, are main component (Greco, the D of widely used commercialization pertussis vaccine, Salmaso, S, Mastrantonio, P., Giuliano, M., Tozzi, A., Anemona, A., Ciofi degliAtti, M.L., Giammanco, A, Panei, P., Blackwelder, W.C., Klein, D.L, Wwassilak, S.G.F., andProgetto Pertosse Working Group.1996.A controlled trial of two acellular vaccines and onewhole-cell against pertussis.New Engl.J.Med.334:341-348; Gustafsson, L., Hallander, H.O., Olin, P., Reizensein, E.and Storsaeter, J.1996.A controlled trial of a two component acellular, afive-component acellular, and a whole-cell vaccine against pertussis vaccine.New Engl.J.Med.334:349-355).FHA is by a kind of secretor type large protein that mediates bacterial adhesion to host cell of fhaB genes encoding, plays a key effect in the process of bacterial adhesion host cell, can directly adhere to the cilium film glycine sphingolipid as host receptor.Simultaneously, the mucous membrane of FHA mediation is grown function surely also has great role for the automatic removing of bacterium opposing mucomembranous cilium.FHA has good antigen protectiveness, two protective antigen zones of TypeII of containing the TypeI and the N end of C end, thereby, TypeI has better antigen protectiveness (Leininger E. and having comprised more epitope than TypeII, Bowen S., Renauld-Mongenie G., RouseJ.H., Menozzi F.D., Locht C., Heron I., Brennan M.J.1997.Immunodominant domains present onthe Bordetella pertussis vaccine component filamentous hemagglutinin.J Infect Dis.175:1423-1431; Piatti is of immunodominant epitopes in the filamentoushemagglutinin of Bordetella pertussis.FEMS Immunol Med Microbiol.23:235-241 G.1999.Idenitification; J.B.Knight, Y.Y.Huang, S.A.Halperin, R.Anderson, A.Morris, A.MacMillan, T.Jones, D.S.Burt, G.Van Nest, S.F.Lee.2006.Immunogenicity and protective efficacy of a recombinant filamentoushaemagglutinin from Bordetella pertussis.Clinical ﹠amp; Experimental Immunology 144:543-551).PRN is a kind of segmental bronchus sepsis bordetella bacilli outer membrane protein composition with antigen protectiveness by the prn genes encoding, also is its important adhesion factor.In the infection experiment of pig, protection ratio of swinery and PRN antibody horizontal are linear, are considered to the topmost protective antigen of segmental bronchus sepsis bordetella bacilli.PRN comprises R1 (GGXXP
n) and R1 (PQP
n) two amino acid tumor-necrosis factor glycoproteins zones.The R1 district is near a RGD sequence, and the RGD sequence mainly has the eukaryotic function of adhesion, therefore infer that the R1 district may relevant (Leininger E. with adhesion function, Ewanowich C.A., Bhargava A., Peppler M.S., Kennmer J.G., Brennan M.J.1992.Comparative roles of the Arg-Gly-Asp sequence present in the Bordetellapertussis adhesins pertactin and filamentous hemagglutinin.Infect Immun 60:2380-2385).The R2 district is accredited as the main protection antigen epi-position (Charles of PRN; I.G.; J.Li; M.Roberts; K.Beesley, M.Romanos, D.J.Pickard; M.Francis; D.Campbell, G.Dougan, M.J.Brennan; C.R.Manclark; M.Au Jensen, I.Heron, A.Chubb; P.Novotny, and N.F.Fairweather.1991.Identification and characterization of aprotective immunodominant B cell epitope of pertactin (P.69) from Bordetella pertussis.Eur.J.Immunol.21:1147-1153).
Worldwide widespread use of the various segmental bronchus sepsis of commercialization bordetella bacilli vaccine (mainly being adjuvant inactivated vaccine) at present, but immune effect is generally relatively poor, and (Backstrom is uses of and experiences with swine vaccines.In:Veterinary vaccines and diagnostics.San Diego:Academic Press L.1999.Present to remain very important problem of harm pig industry by caused atrophic rhinitis of segmental bronchus sepsis bordetella bacilli and pneumonia; United States Department ofAgriculture.2001.Part I:reference of swine health and management in the United States, 2000.CO:National Animal Health Monitoring System, Fort Collins, #N338.0801:2001:39; United StatesDepartment of Agriculture.2002.Part II:reference of swine health and health management in theUnited States, 2000.CO:USDA:APHIS:VS, CEAH, National Animal Health Monitoring System, Fort Collins, #N355.0202:2002:29).Therefore, safer, efficient, the cheap new generation vaccine of exploitation is pressing for of world's pig industry.
Different with inactivated vaccine and simple subunit vaccine; when natural infection of recombinant salmonella living vaccine or experimental infection induce anti-any allos serotype Salmonellas to protect; Salmonellas is because of invading lymphsystem, can more effectively excite the host to produce at advantages such as the body fluid of heterologous antigen and cell immune responses.Like this, perhaps the reorganization attenuated live vaccines is to solve the insufficient a kind of feasible method of current segmental bronchus sepsis bordetella bacilli commercialized vaccine.There are a lot of defectives in the traditional method that makes up the Salmonellas recombinant bacterial strain.As generally adopted the expression plasmid that carries resistant gene in the past, do not accepted by people because of there being the Biosafety problem.Asd plasmid vector balanced lethal system has the expression amount height, advantages such as purifying antibiotic-free resistance marker are stablized, do not needed to exogenous gene expression; in view of the good immunogenicity of Salmonella choleraesuls C500, it is developed as the live recombined vaccines of expressing pig source segmental bronchus sepsis bordetella bacilli antigen protective gene has broad application prospects simultaneously.
Summary of the invention
The objective of the invention is to overcome the defective that prior art exists, obtain a kind of immunogenicity is better and security the is stronger expression pig source segmental bronchus sepsis bordetella bacilli fhaB and the recombinant salmonella choleraesuis strain of prn gene fragment;
Second purpose of the present invention is to utilize the recombinant salmonella choleraesuis strain of expressing pig source segmental bronchus sepsis bordetella bacilli fhaB and prn gene fragment to prepare Salmonella choleraesuls and pig source segmental bronchus sepsis bordetella bacilli bivalent genetic engineering vaccine;
The 3rd purpose of the present invention is to express the application of recombinant salmonella choleraesuis strain in preparation Salmonella choleraesuls and pig source segmental bronchus sepsis bordetella bacilli bivalent genetic engineering vaccine of pig source segmental bronchus sepsis bordetella bacilli fhaB and prn gene fragment.
The present invention is achieved through the following technical solutions:
A kind ofly do not contain (the classification name: C501 (pYA-F1P2) Salmonella choleraesuis) of the expression pig source segmental bronchus sepsis bordetella bacilli fha of resistance marker and the recombinant salmonella choleraesuis strain of prn gene fragment, on September 6th, 2007 was deposited in Chinese typical culture collection center (CCTCC), and its deposit number is: CCTCC NO:M207138.
The recombinant salmonella choleraesuis strain of described expression pig source segmental bronchus sepsis bordetella bacilli fhaB that does not contain resistance marker and prn gene lacked cell walls essential in the salmonella strain genome form genes involved asd gene (plasmid that need contain the asd gene be present in the thalline or external source add on the substratum of DAP could normal growth, breeding), this recombinant bacterial strain contains exogenous plasmid pYA-F1P2 (containing the asd gene) simultaneously, and this recombinant bacterial strain has kept the immunological characteristic of parent strain C500 as the Salmonella choleraesuls attenuated vaccine strain.Plasmid pYA-F1P2 can express the TypeI zone (called after F1 of the present invention) of asd gene and pig source segmental bronchus sepsis bordetella bacilli immunogenic gene fhaB and R2 zone (the called after P2 of the present invention) fragment of prn in this bacterial strain.Wherein, the asd gene expression product provides salmonella strain essential cell walls forms relevant composition.FhaB gene F1 fragment and the segmental expression product of prn gene P2 provide the good immunogenicity at pig source segmental bronchus sepsis bordetella bacilli.
The expression pig source segmental bronchus sepsis bordetella bacilli fhaB of resistance marker and the recombinant salmonella choleraesuis strain of prn gene fragment of not containing of the present invention, its engineering strain are derived from China and have used commercialization Salmonella choleraesuls attenuated vaccine strain C500 for many years (available from country of China Veterinery Drug Inspection Office veterinary microorganism preservation center commercial strain; Huang ChangBing etc., the weak malicious aerated culture freeze-dried vaccine oral immunity research of necrotic enteritis, Scientia Agricultura Sinica, 1981 (6): 89～94; Kang Kai, living paratyphoid vaccine for piglets, Chinese veterinary drug magazine, 2003 (37), 37:49).Described recombinant salmonella choleraesuis strain has lacked the asd gene in the C500 strain gene group, has inserted simultaneously to contain asd gene and pig source segmental bronchus sepsis bordetella bacilli fhaB gene F1 fragment and the segmental plasmid pYA-F1P2 of prn gene P2.Owing to need the recombinant bacterial strain that exists of pYA-F1P2 to survive, therefore improved the stability of plasmid pYA-F1P2 (just fhaB gene F1 fragment and prn gene P2 fragment) in recombinant bacterial strain greatly.FhaB gene F1 fragment and the stably express of prn gene P2 fragment in recombinant bacterial strain make it to have at the good immune protective efficiency of pig source segmental bronchus sepsis bordetella bacilli.
Basic construction method of the present invention is: utilize genetic engineering technique to make Salmonella choleraesuls attenuated vaccine strain C500 (be called for short C500, together following) thus essential cell walls forms genes involved asd, and genetically deficient is built into new bacterial strain, and we should new bacterial strain called after C501.Make up simultaneously and contain asd gene and pig source segmental bronchus sepsis bordetella bacilli fhaB gene F1 fragment and the segmental plasmid pYA-F1P2 of prn gene P2.This plasmid pYA-F1P2 is changed in the C501asd gene-deleted strain, owing to coexistence is stablized in need the plasmid pYA-F1P2 and the complementation of C500asd gene-deleted strain of growth, form the expression pig source segmental bronchus sepsis bordetella bacilli fhaB that does not contain resistance marker of our invention and recombinant C 501 (pYA-F1P2) bacterial strain of prn gene fragment.Recombinant bacterial strain by a large amount of biological experiment digital proof the present invention preparation can be used for preparing the bivalent vaccine at Salmonella choleraesuls and pig source segmental bronchus sepsis bordetella bacilli.
Major advantage of the present invention is:
1, the pig source segmental bronchus sepsis bordetella bacilli fhaB gene F1 fragment and the prn gene P2 fragment of the engineering strain expression of the present invention's preparation are the important immunogenic gene fragment of pig source segmental bronchus sepsis bordetella bacilli, have good immune protection.Because segmental bronchus sepsis bordetella bacilli harm in pig source is serious day by day, and extensive stock pig segmental bronchus sepsis bordetella bacilli vaccine (mainly being adjuvant inactivated vaccine) immune effect is generally relatively poor in the market.Therefore, the vaccine made from engineering strain of the present invention has wide market application prospect.
2, the engineering strain of the present invention's preparation is derived from China and has used commercialization Salmonella choleraesuls attenuated vaccine strain C500 for many years, has kept the immune efficacy of C500 at Salmonella choleraesuls fully.And, engineering strain virulence of the present invention than C500 slightly a little less than, thereby have better biological safety.
3, the engineering strain of the present invention's preparation can provide the protection at Salmonella choleraesuls and two kinds of cause of diseases of segmental bronchus sepsis bordetella bacilli simultaneously.
4, the engineering strain of the present invention's preparation does not contain resistance marker, meets the requirement of vaccine biological safety fully.
Description of drawings
Fig. 1: the physical map that is the transferring plasmid pREasd12 for preparing of the present invention.
Fig. 2: the enzyme that is the transferring plasmid pREasd12 for preparing of the present invention is cut qualification result.
M:DNA marker among the figure (DL 15,000) 1:pREasd12/Xba I+Kpn I
Fig. 3: be the schema that the transferring plasmid pREasd12 for preparing of the present invention makes up.
Fig. 4: be that the PCR that does not contain the Salmonella choleraesuls attenuated vaccine bacterial strain C500asd genetically deficient mutant strain of resistance marker among the present invention detects electrophoretogram.
Fig. 4 A:asd
-Deletion mycopremna PCR identifies figure (Pa5/Pa6), M1:DNA marker among the figure (DL 2,000); M2:DNA marker (DL 15,000); 1-6 is the asd of screening
-Deletion mycopremna; 7-12 is parent strain C500 contrast; 13 are the contrast of pREasd12 plasmid; 14 is H
2The O contrast.
Fig. 4 B:asd
-Deletion mycopremna PCR identifies figure (Pa7/Pa6), M1:DNA marker among the figure (DL 2,000); M2:DNA marker (DL 15,000); 1-4 is the asd of screening
-Deletion mycopremna; 5 are parent strain C500 contrast; 6 are the contrast of pREasd12 plasmid; 7 is H
2The O contrast
Fig. 5: the physical map that is the recombinant plasmid pYA-F1P2 for preparing of the present invention.
Fig. 6: the enzyme that is the recombinant plasmid pYA-F1P2 for preparing of the present invention is cut qualification result.
M:DNA marker among the figure (DL 15,000) 1:pYA-F1P2/EcoR I+HindIII
Fig. 7: be the schema that the recombinant plasmid pYA-F1P2 for preparing of the present invention makes up.
Fig. 8: be a kind of expression pig source segmental bronchus sepsis bordetella bacilli fhaB of resistance marker and PCR evaluation electrophoretogram of the segmental recombinant salmonella choleraesuis living vaccine of prn bacterial strain C501 (pYA-F1P2) of not containing among the present invention.
Fig. 8 A: be recombinant bacterial strain asd
-Disappearance PCR identifies figure, M:DNAmarker among the figure (DL 15,000); 1 and 2 is recombinant bacterial strain; 3 are parent strain C500 contrast.
Fig. 8 B: be the segmental PCR evaluation of fhaB gene F1 figure in this reorganization bacterium, M:DNA marker among the figure (DL2,000); 1 is parent strain C500 contrast; 2 is recombinant bacterial strain
Fig. 8 C: be the segmental PCR evaluation of prn gene P2 figure in this reorganization bacterium, M:DNA marker among the figure (DL 2,000); 1 is parent strain C500 contrast; 2 is recombinant bacterial strain
Fig. 9: be a kind of expression pig source segmental bronchus sepsis bordetella bacilli fhaB of resistance marker and SDS-PAGE and Western-blot analytical results of the segmental recombinant salmonella choleraesuis living vaccine of prn bacterial strain C501 (pYA-F1P2) of not containing among the present invention.
Fig. 9 A: be to detect fhaB gene F1 fragment and prn gene P2 fragment fusion rotein rF1P2 with the SDS-PAGE method, 1 is recombinant bacterial strain among the figure; 2 are parent strain C500 contrast; Arrow is depicted as amalgamation and expression albumen rF1P2.
Fig. 9 B: be to detect fhaB gene F1 fragment and prn gene P2 fragment fusion rotein rF1P2 with the Western-blot method, 1 is recombinant bacterial strain among the figure; 2 are parent strain C500 contrast
Figure 10: be a kind of genetic stability experimental result that does not contain the expression pig source segmental bronchus sepsis bordetella bacilli fhaB and the segmental recombinant salmonella choleraesuis living vaccine of the prn bacterial strain of resistance marker among the present invention.
Figure 10 A: the PCR of fhaB gene fragment identifies figure, M:DNA marker among the figure (DL 2,000) in this reorganization bacterium; 1 is parent strain C500 contrast; 2-7 is that 1-50 is for recombinant bacterial strain
Figure 10 B: the PCR of prn gene fragment identifies figure, M:DNA marker among the figure (DL 2,000) in this reorganization bacterium; 1-6 is that 1-50 is for recombinant bacterial strain; 7 are parent strain C500 contrast
Embodiment
The present invention is further illustrated below in conjunction with Figure of description.
The structure of embodiment 1 Salmonella choleraesuls C500asd genetically deficient bacterial strain
1, design of primers (being used for gene clone and Molecular Detection)
With reference to Salmonella typhimurium LT2 strain asd gene order (GenBankNo:AE008863) design 2 couples of primers (pa1/pa2 and pa3/pa4 of having reported, see Table 1), asd gene upstream and downstream fragment asd1 (upper arm) and asd2 (underarm) increase respectively from Salmonella choleraesuls attenuated vaccine strain C500 (available from country of China Veterinery Drug Inspection Office veterinary microorganism preservation center commercial strain) genome, the amplified fragments size is respectively 2112bp and 2069bp, the upper arm two ends are introduced Xba I and BamH I restriction enzyme site respectively, and the underarm two ends are introduced BamH I and Kpn I restriction enzyme site respectively.Other designs 2 pairs of primers (pa5/pa6 and pa7/pa6 see Table 1) and carries out the evaluation of C500 parent strain and asd deletion mycopremna.Primer is synthetic by Shanghai bio-engineering corporation.
Table 1:PCR primer
| The gene title | The primer title | Primer sequence (5 '-3 ') | Purpose fragment length (bp) | Restriction enzyme site (underscore) |
| The asd1 upper arm | pa1 pa2 | TT TCTAGACGCTTTGAGCACGACTAA TT GGATCCTGCGTTAGGAAGGGAATC | 2112 | Xba BamH |
| The asd2 underarm | pa3 pa4 | TT GGATCCAGGGTAGCTTAATCCCAC TT GGTACCACCGAGCGTTCATTGTCA | 2069 | BamH Kpn |
| asd/asd - | pa5 pa6 | TTGCTTTCCAACTGCTGAGC TCCTATCTGCGTCGTCCTAC | 1803(wt) 315(asd-) | / |
| The gene title | The primer title | Primer sequence (5 '-3 ') | Purpose fragment length (bp) | Restriction enzyme site (underscore) |
| asd/asd - | pa7 pa6 | TTGGACAATGTTACCGATAA TCCTATCTGCGTCGTCCTAC | 3717(wt) 2229(asd-) | / |
2, the clone of Salmonella choleraesuls C500asd gene upstream and downstream fragment asd1 (upper arm) and asd2 (underarm)
Freeze dried Salmonella choleraesuls C500 is rule on the LB solid plate, cultivate 16h for 37 ℃.Picking list colony inoculation is in the LB liquid nutrient medium, and 37 ℃, 200r/min jolting are cultivated 16h.Extracting test kit (available from Beijing TIANGEN company) specification sheets extraction genome by bacterial genomes is pcr template.
Asd and asd2 amplified reaction all carry out in the system of 25 μ L, and reaction system (the PCR related reagent is all available from the precious biotechnology in Dalian company limited) is as follows: template DNA 1 μ L, 10 * PCR damping fluid, 2.5 μ L, 25mmol/L MgCl
22 μ L, each 1 μ L of 10 μ mol/L upstream and downstream primers, 2mmol/L dNTPs 1 μ L, 2U/ μ L Taqase 0.5 μ L, ddH
2O 16 μ L.
Asd1 and asd2 amplification condition are: enter circulation behind 95 ℃ of sex change 5min, loop parameter is 94 ℃ of 1min, 57 ℃ of 1min, 72 ℃ of 2.5min.After 30 circulations, 72 ℃ are extended 10min.Amplification PCR products is through 0.8% agarose gel electrophoresis analysis, and 2 clip size that increase and expection sizableness are respectively 2112bp and 2069bp.The goal gene that obtains is cloned into pMD18-T carrier (available from the precious biotechnology in Dalian company limited), send Dalian precious biotechnology company limited to carry out the mensuration of exogenous gene sequence.
3, the structure of pREasd12 transferring plasmid
With XbaI and BamHI double digestion asd1 and pBluescriptSK (+) carrier (available from U.S. Stratagene company), use T behind the recovery purifying
4DNA ligase (available from the precious biotechnology in Dalian company limited) connects, and 16 ℃ of water-bath 12h transform DH5
αCompetence bacterium (available from the precious biotechnology in Dalian company limited), 37 ℃ at solid LB substratum (10g Tryptones, the 5g yeast extract, 5g sodium-chlor, the 15g agar powder, distilled water is settled to 1000mL, 121 ℃ of high pressure 25min) cultivate 12h, choose bacterium to liquid LB substratum (10g Tryptones, 5g yeast extract, 5g sodium-chlor, distilled water is settled to 1000mL, 121 ℃ of high pressure 25min), 37 ℃, 225r/min jolting cultivation 12h use plasmid extraction kit (available from Beijing TIANGEN company) thereby preparing plasmid in a small amount obtains plasmid pSKasd1.Use BamHI and KpnI double digestion asd2 and plasmid pSKasd1 again.Use T after the recovery
4DNA ligase connects, and transforms DH5 α competence bacterium, cultivates 12h for 37 ℃, chooses bacterium to liquid LB substratum, and 37 ℃, 225r/min jolting cultivation 12h obtain plasmid pSKasd12 thereby prepare plasmid in a small amount.(be so kind as to give with XbaI and KpnI double digestion transferring plasmid pSKasd12 and suicide plasmid pRE112 by Dr.Roy Curtiss professor III of Washington, DC university; Miller, V.L., Mekalanos J.J.1988.A novel suicide vector and its use in construction oninsertion mutations:osmoregulation of outer membrane proteins and virulence determinants inVibrio cholerae requires toxR.J.Bacteriol.170:2575-2583), reclaim asd1+asd2 fragment and plasmid pRE112, use T
4DNA ligase connects, 16 ℃ of water-bath 12h, electricity transform (Huang Peitang etc. translate. Sa nurse Brooker J, Russell D W work. molecular cloning experiment guide (third edition). Beijing: Science Press, 2002) intestinal bacteria χ 7213 (is so kind as to give by Dr.Roy Curtiss professor III of Washington, DC university; Edwards, R.A., L.H.Keller, and D.M.Schifferli.1998.Improved allelicexchange vectors and their use to analyze 987P fimbria gene expression.Gene 207:149-157) makes up recombinant bacterial strain χ 7213 (pREasd12), cultivate 12h for 37 ℃ and choose bacterium to liquid LB substratum, 37 ℃, 225r/min jolting cultivation 12h obtain the pREasd12 transferring plasmid thereby prepare plasmid in a small amount, and its physical map is seen Fig. 1.Qualification result confirms that the transferring plasmid pREasd12 that makes up is correct (see figure 2), and transferring plasmid pREasd12 makes up flow process as shown in Figure 3.
4, the structure of asd gene-deleted strain C501
With χ 7213 (pREasd12) is the donor bacterium, and C500 is that recipient bacterium carries out conjugal transfer.Donor bacterium and recipient bacterium be overnight incubation in the LB substratum respectively, sterile phosphate damping fluid (PBS, NaCl 8.0g, KCl 0.2g, Na
2HPO
4.12H
2O 2.9g, KH
2PO
40.2g distilled water adds to 1000mL, through 121 ℃ of autoclaving 30min) wash twice, adjust bacteria concentration to OD
600Be 0.8, respectively get 100 μ L bacteria suspensions and mix.Aseptic nitrocellulose is affixed on the solid LB flat board that contains diaminopimelic acid (diaminopimelic acid, DAP is available from U.S. Sigma company), the mixed bacterium drop on filter membrane, is cultivated 12h for 37 ℃, do the contrast of donor and acceptor simultaneously.Wash bacterium liquid on the filter membrane, aseptic PBS washes twice, and coating contains the solid LB flat board of paraxin (Cm, final concentration 30 μ g/ml), cultivates 12h for 37 ℃, and Cm resistance bacterium colony is transferred simultaneously contains the LB flat board of Cm and 5% sucrose, screening Cm resistance (Cm
r) zygote, extract genome, identify (seeing Fig. 4 A) with primer pa5/pa6 (seeing Table 1) amplification.Positive zygote is not cultivated 12h in non-resistant has the LB liquid nutrient medium of NaCl, continuous 10 times of dilutions, and coating contains the solid LB flat board of the no NaCl of 5% sucrose, and picking list bacterium colony is replicated in the solid plate that contains Cm and 5% sucrose, screening Cm sensitivity (Cm
s) bacterium colony.Extract genome, identify with primer pa5/pa6 amplification once more, the strain of asd disappearance further uses primer pa6/pa7 (table 1) to identify (seeing Fig. 4 B).The asd gene-deleted strain of C500 is owing to disappearance asd gene loses the ability of synthesizing DAP, so can not grow on the substratum of no external source DAP.The result shows, constructed asd gene-deleted strain asd
-C500 is correct, and we are with its called after C501.
The structure of embodiment 2 recombinant plasmid pYA-F1P2
1, design of primers
With reference to the segmental bronchus sepsis bordetella bacilli fhaB (GenBank No:NC002927) that has reported and 2 pairs of primers of prn (GenBank No:AJ245927) gene order design, the F1 fragment of fhaB gene and the P2 fragment of prn gene increase from the genome of pig source segmental bronchus sepsis bordetella bacilli (Bordetella broadlisepuca) HH0809 (this bacterial strain is deposited in Chinese typical culture collection center (CCTCC) on September 18th, 2007, and preserving number is CCTCC NO:M207148) respectively.The amplified fragments size is respectively 465bp and 300bp, and pf1 and pf2 introduce EcoRI and SalI restriction enzyme site respectively, and pp1 and pp2 introduce SalI and Hind III restriction enzyme site respectively.Primer sequence is as follows:
pf1：5’-TTTAA
GAATTCCTGACTGCCCTGGACAAT-3’(EcoRI)
Pf2:5 '-TTTAA
GTCGACTCGCAGATCCGCGGCAAA-3 ' is F1 fragment 465bp (SalI)
pp1：5’-TAATT
GTCGACAACACCATGCTGCTGGTG-3’(SalI)
Pp2:5 '-TTTAA
CTGCAGGGCGGACAACTCCCTGCC-3 (Hind III) P2 fragment 300bp
2, the clone of pig source segmental bronchus sepsis bordetella bacilli F1 and P2 gene fragment
The segmental bronchus sepsis bordetella bacilli HH0809 strain of pig source is taken off and cultivated 48h on Bao-Jiang Shi (available from U.S. Difco company) flat board of fine sheep blood containing 15%, and aseptic PBS washes, and extracting the test kit specification sheets by bacterial genomes, to extract genome be pcr template.
F1 and the reaction of P2 gene fragment amplification are all carried out in the system of 25 μ L, and reaction system is as follows: template DNA 1 μ L, 10 * PCR damping fluid, 2.5 μ L, 25mmol/L MgCl
22 μ L, each 1 μ L of 10 μ mol/L upstream and downstream primers, 2mmol/LdNTPs 1 μ L, 2U/ μ L Taq 0.5 μ L, ddH
2O 16 μ L.
F1 and P2 gene fragment amplification condition are: enter circulation behind 95 ℃ of sex change 5min, loop parameter is 94 ℃ of 30s, 58 ℃ of 30s, 72 ℃ of 30s.After 30 circulations, 72 ℃ are extended 10min.Amplification PCR products is through 0.8% agarose gel electrophoresis analysis, and 2 clip size that increase and expection sizableness are respectively 465bp and 300bp.
3, the structure of recombinant plasmid pYA-F1P2 and evaluation
With EcoRI and SalI double digestion F1 and pMD18-T carrier, use T behind the recovery purifying
4DNA ligase connects, and 16 ℃ of water-bath 12h transform DH5
αThe competence bacterium is cultivated 12h for 37 ℃, chooses bacterium to liquid LB substratum, and 37 ℃, 225r/min jolting cultivation 12h obtain plasmid pMD18-F1 thereby prepare plasmid in a small amount.Use SalI and Hind III double digestion P2 and transferring plasmid pMD18-F1 again, use T behind the recovery purifying
4DNA ligase connects, and 16 ℃ of water-bath 12h transform DH5
αThe competence bacterium is cultivated 12h for 37 ℃, chooses bacterium to liquid LB substratum, and 37 ℃, 225r/min jolting cultivation 12h obtain plasmid pMD18-F1P2 thereby prepare plasmid in a small amount.(be so kind as to give with F1P2 fragment and shuttle plasmid pYA3493 among EcoR I and the Hind III double digestion plasmid pMD18-F1P2 by Dr.Roy Curtiss professor III of Washington, DC university; Kang, H.Y., J.Srinivasan, and R.Curtiss III.2002.Immune responses to recombinant pneumococcal PspA antigen delivered by liveattenuated Salmonella enterica serovar Typhimurium vaccine.Infect.Immun.70:1739-1749), use T behind the recovery purifying
4DNA ligase connects, 16 ℃ of water-bath 12h, and electric transformed into escherichia coli χ 6097 (is so kind as to give by Dr.Roy Curtiss professor III of Washington, DC university; Nakayama, K., S.M.Kelly, and R.Curtiss III.1988.Construction ofan Asd
+Expression-cloning vector:stable maintenance and high level expression of cloned genes ina Salmonella vaccine strain.Bio/Technology 6:693-697) competent cell, cultivate 12h for 37 ℃, choose bacterium to liquid LB substratum, 37 ℃, 225r/min jolting cultivation 12h, obtain plasmid pYA-F1P2 thereby prepare plasmid in a small amount, its physical map is seen Fig. 5.Qualification result confirms that the recombinant plasmid pYA-F1P2 that makes up is correct (see figure 6), and recombinant plasmid pYA-F1P2 makes up flow process as shown in Figure 7.
The asd gene-deleted strain C501 of C500 loses the ability of synthetic DAP owing to disappearance asd gene, so can not on the substratum of no external source DAP, grow, but contain the ability that will obtain to synthesize DAP behind the recombinant plasmid pYA-F1P2 of asd gene when its acquisition, recover do not containing the ability of growing on the DAP substratum.Recombinant shuttle plasmid pYA-F1P2 electricity is transformed the asd gene-deleted strain C501 of C500, at the negative dull and stereotyped enterprising row filter positive colony of DAP, picking list bacterium colony is cultivated, and carries out PCR with primer pa7/pa6, pf1/pf2 and pp1/pp2 and identify (seeing Fig. 8 A, Fig. 8 B and Fig. 8 C respectively).The result shows that the C501 recombinant bacterial strain that obtains to contain the pYA-F1P2 plasmid is correct, and we are with its called after C501 (pYA-F1P2).
Embodiment 4 expresses the biological characteristics of the recombinant bacterial strain of F1 and P2 gene fragment
1, the preparation of F1 and P2 gene fragment e. coli expression product rabbit anti-serum
With F1P2 fragment and the pET-28a among EcoR I and the HindIII double digestion plasmid pMD18-F1P2, use T behind the recovery purifying
4DNA ligase connects, transformed into escherichia coli DH5
αThe competence bacterium is cultivated 12h for 37 ℃ on solid LB flat board, prepare plasmid acquisition expression plasmid pET28a-F1P2 in a small amount thereby choose bacterium.The pET28a-F1P2 plasmid is carried out sequencing, after confirming that the clone is correct, transformed into escherichia coli BL21 (available from the precious biotechnology in Dalian company limited), containing kantlex (Kan, final concentration 50 μ g/mL) the picking positive transformant is to liquid LB substratum on the solid LB flat board, and 37 ℃, 200r/min are cultured to logarithmic phase (light absorption value OD
600=0.6～1.0) add IPTG (final concentration 1mM) and carry out abduction delivering 4h, use the Histidine fusion rotein to extract the process specifications that test kit HIS-Bind Purification Kit (available from U.S. Qiagen company) provides by the said firm, to expressing product purification, obtaining concentration is the amalgamation and expression albumen of 320 μ g/mL, called after HIS-F1P2.With 100 μ g expression product HIS-F1P2 and equal-volume Freund's complete adjuvant (available from U.S. Sigma company) uniform mixing, subcutaneous injection new zealand white rabbit (available from Hubei Province Preventive Medicine Academy's Experimental Animal Center), respectively at 3 weeks (two exempt from) and 5 weeks (three exempt from) each booster immunization of back 1 time (using Freund's incomplete adjuvant) available from U.S. Sigma company.Exempt from back 10d blood sampling 3, extract serum, 0.22 μ m membrane filtration degerming, put-20 ℃ standby.
2, the expression characterization analysis of C501 (pYA-F1P2) recombinant bacterial strain
Single bacterium colony of picking recombinant bacterial strain C501 (pYA-F1P2) is in the LB liquid nutrient medium, 37 ℃, 200r/min cultivates 16h, 8, the centrifugal collection thalline of 000r/min, carry out polyacrylamide gel electrophoresis (SDS-PAGE, Huang Peitang etc. translate. Sa nurse Brooker J. Russell D W work. and molecular cloning experiment guide (third edition). Beijing: Science Press, 2002), and use the anti-HIS-F1P2 serum of rabbit carry out Western-blotting analyze (Huang Peitang etc. translate. Sa nurse Brooker J, Russell D W work. molecular cloning experiment guide (third edition). Beijing: Science Press, 2002).The result shows that C501 (pYA-F1P2) can express size and be the recombinant protein of 29.5kDa (called after rF1P2), and the recombinant protein of expressing has good immunological response originality (see figure 9).
3, the phenotypic evaluation of C501 (pYA-F1P2) recombinant bacterial strain
With C501 (pYA-F1P2) recombinant bacterial strain and parent plant C500 streak inoculation solid LB flat board, carbon source and H such as glucose, lactose, sucrose, rhamnosyl, seminose, pectinose, wood sugar, galactitol, urea then transfer
2Biochemical identification pipes such as S (available from sky, Hangzhou and company) carry out biochemical reaction.By serum factor (available from China Veterinary Drugs Supervisory Inst.) specification sheets and carry out O and H antigen is identified.The result shows that the biochemical characteristic of recombinant bacterial strain C501 (pYA-F1P2) is consistent with parent plant C500.Both all can not produce H
2S can not utilize lactose, sucrose, pectinose, melampyrum and urea, but can utilize maltose, glucose, rhamnosyl, seminose and wood sugar is unique charcoal source.The serotype of recombinant bacterial strain C501 (pYA-F1P2) is 6,7:C:1, and 5, C500 is consistent with parent plant.These results show that the biochemical characteristic of recombinant bacterial strain C501 (pYA-F1P2) is consistent with parent strain C500, meet the typical phenotypic characteristic of Salmonella choleraesuls.
4, the growth characteristics analysis of C501 (pYA-F1P2) recombinant bacterial strain
C501 (pYA-F1P2) recombinant bacterial strain is cultivated 12h for dull and stereotyped 37 ℃ at LB, and its diameter of bacterium colony is about 1.7mm, and is slightly littler than C500 strain (2mm) than the parent.Parent plant C500 and C501 (pYA-F1P2) recombinant bacterial strain is from 10
6CFU/ml begins to cultivate, every 1h sampling, and carry out live bacterial count.The result shows that C501 (pYA-F1P2) the recombinant bacterial strain speed of growth is slower than parent plant C500 slightly, and its average length of generation (Mean generation time) is 30.7min, prolongs 2.8min than parent plant (27.9min).
5, the genetic stability of C501 (pYA-F1P2) recombinant bacterial strain
C501 (pYA-F1P2) recombinant bacterial strain of the present invention's preparation is streak culture on solid LB flat board, picking list bacterium colony is in liquid LB substratum, 37 ℃, 200r/min are cultivated 16h, by volume 1: 1,000 ratio is transferred in the LB liquid nutrient medium and cultivates 12h, by volume 1: 1 once more, 000 ratio was transferred in the LB liquid nutrient medium, carried out 10 switchings continuously.Carry out pcr amplification with primer pf1/pf2 and pp1/pp2, the hereditary situation of amplification plasmid in the reorganization bacterium seen Figure 10.Figure 10 shows that the result of each amplification does not all have observable difference, shows that C501 (pYA-F1P2) recombinant bacterial strain that the present invention prepares can genetic stability.
The preparation of embodiment 5C501 (pYA-F1P2) recombinant bacterial strain vaccine
C501 (pYA-F1P2) recombinant bacterial strain that obtains is identified, in per generation, be inoculated on the LB substratum, utilize primer pya/pf2 to carry out the genetic stability that PCR detect to identify recombinant bacteria, find that through 20 backs of going down to posterity still can amplify size is respectively the 645bp fragment, its heritability is stablized.Detect to find by Western-blotting, the rF1P2 recombinant protein can be in recombinant bacterial strain stably express, and have good immunological response originality.This C501 (pYA-F1P2) recombinant bacterial strain is cultivated on the LB solid medium, and picking list bacterium colony is cultivated in the LB liquid nutrient medium, reaches 1 * 10 up to viable bacteria concentration
10CFU/mL.In bacterium liquid: gelatin protective material (volume: be that 7: 1 ratio adds the gelatin protective material (this gelatin protective material compound method is: in every 100mL deionized water with sucrose 40g volume); gelatin 8g; after fully melting; preservation is standby after putting 121 ℃ of 30min that sterilize down); in sterilization freeze-drying bottle, press the packing of 2.0mL/ bottle; put freeze-drying in-50 ℃ of freeze driers; freeze-drying 36-40h rear pressing cover; with 10% aluminium glue physiology salt dissolving and carry out live bacterial count (CFU); and determine there is not living contaminants; it is standby to put-20 ℃ of preservations, as the vaccine strains of development recombiant vaccine.
The safety evaluation of embodiment 6C501 (pYA-F1P2) recombinant bacterial strain vaccine
1, the safety evaluation of mouse peritoneal route of infection
For the recombinant bacterial strain C501 (pYA-F1P2) that measure to make up security to BALB/c mouse, 32 Bab/C mouse are equally divided into 2 big groups, every big component is 4 groups.The 1st big group mouse carries out abdominal channels and infects C501 (pYA-F1P2), and every of every group injects 2.1 * 10 respectively
5CFU, 2.1 * 10
6CFU, 2.1 * 10
7CFU and 2.1 * 10
8CFU; The 2nd big group is carried out abdominal cavity inoculation parent bacterium C500, and every of every group injects 2.1 * 10 respectively
5CFU, 2.1 * 10
6CFU, 2.1 * 10
7CFU and 2.1 * 10
8CFU.Write down death condition and calculate mouse mld (LD according to Reed and Muench method
50).Estimate that C501 (pYA-F1P2) recombinant bacterial strain compares with parent strain C500 whether virulence weakens and to mouse safety whether.Test-results sees Table 2: the LD that shows C501 (pYA-F1P2) recombinant bacterial strain and parent strain C500
50Be respectively 1.5 * 10
7CFU and 3.3 * 10
6
Table 2 dual-gene deletion of vaccine bacterial strain of the present invention and the comparison test of parent plant virulence
CFU, calculating as can be known, the virulence of recombinant bacterial strain has reduced by 4.5 times than parent strain C500.This illustrates that C501 of the present invention (pYA-F1P2) recombinant bacterial strain compares with being proved to be safe attenuated vaccine parent plant C500, and virulence is lower, should be safer to pig.
2, recombinant bacterial strain C501 of the present invention (pYA-F1P2) is to the safety evaluation of pig
Immunizing dose (3 * 10 with parent strain C500
9CFU) be reference data, respectively by musculi colli injection weanling pig in 4 age in week and farrowing sow (the results are shown in Table x).C501 (pYA-F1P2) recombinant bacterial strain of the present invention's preparation (contains 5 * 10 by every pig injection 2mL
9The CFU viable count) 10 of the weanling pigs in 4 ages in week of inoculation, the spiritual appetite of all piglets is normal, and no abnormality seen changes, and all can detect the specific antibody of antibodies toward salmonella and rF1P2 recombinant protein after immune 2 weeks.The piglet (promptly contrasting 1) of parent strain C500 inoculation does not have unusual clinical manifestation yet.C501 of the present invention (pYA-F1P2) recombinant bacterial strain (contains 1 * 10 by every pig injection 4mL
10The CFU viable count) the inoculation pregnant sow is 5, and the spiritual appetite of all pregnant sows is normal, and no abnormality seen changes, and all can detect the specific antibody of antibodies toward salmonella and rF1P2 recombinant protein after immune 2 weeks; Compare with nonvaccinated pregnant sow, the nest litter size is suitable substantially, stillborn foetus, mummy tire etc. all do not occur.These two tests confirm that C501 (pYA-F1P2) recombinant bacterial strain of the present invention's preparation also is safe to pregnant sow.
Embodiment 7 recombinant bacterial strain C501 of the present invention (pYA-F1P2) detect at the intravital immune efficacy of mouse
1, the immune programme for children of mouse:
The BALB/c mouse of using 5-6 age in week is divided into 3 groups as the immune efficacy evaluation according to test requirements document, is respectively C501 (pYA-F1P2) recombinant bacterial strain vaccine group, C500 parent strain vaccine group and the non-immune blank group of the present invention's preparation.Immunization route is that subcutaneous injection 0.2mL in back (contains 1.2 * 10
8CFU viable bacteria amount) bacterium liquid or LB substratum, booster immunization is 1 time after 14 days.Respectively at immunity preceding 0 day, head exempts to detect in back 14 days and 28 days Salmonellas serum antibody (standard ELISA method, with reference to Covone, M.G., M.Brocchi, E.Palla, W.Dias, da, Silveira, R.Rappuoli, and C.L.Galeotti.1998.Levels of expression and immunogenicity of attenuated Salmonella enterica serovar Typhimuriumstrains expressing Escherichia coli mutant heat-labile enterotoxin.Infect.Immun.66:224-231).Histidine fusion expressed product HIS-F1P2 with preparation among the embodiment 4 is that antigen (100ng/ hole) bag is by elisa plate simultaneously, (method is with reference to Liu Zhonghui etc. to press indirect ELISA method, immunology common experimental technology, Beijing: Science Press, 2002) detection rF1P2 recombinant protein antibody horizontal.
2, immune mouse humoral immunization antibody horizontal detects
Blood sampling before the mouse immune, second and third time blood sampling exempt to carry out in back 14,28 days at head respectively, choose 5 through the blood sampling of tail vein negative pressure for every group, and separation of serum detects anti-salmonella serum antibody, rF1P2 specific antibody titres respectively, averages.The results are shown in Table 3.As can be seen from Table 3, head exempts from back the 2nd all C501 of the present invention (pYA-F1P2) reorganization bacteria vaccine group and C500 parent bacteria vaccine group antibodies toward salmonella is 1: 384 and 1: 448, two exempt from 2 weeks of back (being that head exempts from 4 weeks of back), and C501 of the present invention (pYA-F1P2) reorganization bacteria vaccine group and C500 parent bacteria vaccine group antibodies toward salmonella are tired and risen to respectively at 1: 3584 and 1:: 4096.And the LB that carries out synchronously contrast all negative (＜1: 10).It is 1: 512 that head exempts from 2 all C501 of the present invention (pYA-F1P2) reorganization bacteria vaccine group rF1P2 specific antibody titres, and two exempt from 2 weeks of back, and C501 of the present invention (pYA-F1P2) reorganization bacteria vaccine group rF1P2 antibody titer rises to 1: 3328.And contrast parent strain C500 that carries out synchronously and PBS contrast all negative (＜1: 10).Two exempt from 2 weeks of back (being that head exempts from 4 weeks of back), and C501 (pYA-F1P2) the reorganization bacteria vaccine group of the present invention's preparation and the ELISA antibody that C500 parent bacteria vaccine immune group produces all have rising to a certain degree, and it is approaching to tire.C501 (pYA-F1P2) the reorganization bacteria vaccine group of the present invention's preparation can produce the rF1P2 specific antibody, and the antibody titer mean level (ML) is 1: 3328, LB control group antibody test still negative (＜1: 10).The above results can induce body to produce the humoral immunoresponse(HI) of specific anti-salmonella and segmental bronchus sepsis bordetella bacilli after showing C501 (pYA-F1P2) the reorganization bacteria vaccine immune mouse that the present invention prepares.
Reorganization bacterium C501 (pYA-F1P2) the vaccine immune mouse Serum Antibody Detection (ELISA method) of table 3 the present invention preparation
3, the protectiveness test of C501 (pYA-F1P2) reorganization bacteria vaccine immunity BALB/c mouse:
With 90 of the negative BALB/c mouse of 5-6 Salmonellas in age in week, be equally divided into three groups, i.e. C501 (pYA-F1P2) the reorganization bacteria vaccine group of the present invention preparation, C500 parent bacteria vaccine group control group, LB control group.(viable bacteria content 1.2 * 108CFU) nutrient solutions are by back subcutaneous injection BALB/c mouse with 0.2mL for C501 (pYA-F1P2) the reorganization bacteria vaccine group of the present invention's preparation and C500 parent bacteria vaccine group control group; Every back subcutaneous injection of LB control group 0.2mL LB substratum.Booster immunization is 1 time after 14 days.
Two exempt from the 2nd week of back (head exempts from 4 weeks of back), from 10 of each group mouse picked at random, all use 100 * LD
50(contain 2.6 * 10
6CFU) Salmonella choleraesuls virulent strain C78-1 (parent strain of attenuated vaccine bacterial strain C500 is available from country of China Veterinery Drug Inspection Office veterinary microorganism preservation center commercial strain) to the mouse oral challenge, observed 30 days.The LB control group mice attack poison back 6h begin to present spirit depressed, do not eat, flock together; Began in the 2nd day death to occur, dead peak occurs the 5th day, and is all dead by the 8th day.C501 (pYA-F1P2) the recombiant vaccine group of the present invention preparation with attack poison after tangible disease symptom does not appear, do not have death condition to take place.C500 parent bacteria vaccine control group situation is similar to C501 (pYA-F1P2) reorganization bacteria vaccine group.C501 (pYA-F1P2) the reorganization bacteria vaccine group of this explanation the present invention preparation can be resisted 100 * LD
50The attack of Salmonella choleraesuls intensity strain C78-1.Attacking poison back protection ratio situation is shown in Table 4.
Reorganization bacterium C501 (pYA-F1P2) vaccine of table 4 the present invention preparation is attacked the protectiveness evaluation of BALB/c small white mouse to Salmonella choleraesuls C78-1 virulent strain
| The test grouping | Subcutaneous immunizing dose (CFU) | Oral challenge dosage (CFU) | Survival number/sum | Protection ratio (%) |
| Reorganization bacterium C501 of the present invention (pYA-F1P2) vaccine group | 1.2×10 8 | 2.6×10 6 | 10/10 | 100 |
| Parent bacterium C500 vaccine group | 1.2×10 8 | 2.6×10 6 | 10/10 | 100 |
| The PBS control group | 200μL | 2.6×10 6 | 0/10 | 0 |
Two exempt from back 16 days (head exempted from back 30 days), each group residue mouse (every group remains 20) are used for the attack of pig source segmental bronchus sepsis bordetella bacilli.With segmental bronchus sepsis bordetella bacilli virulent strain HH0809 contain 15% take off cultivate 48h on the Bao-Jiang Shi flat board of fine sheep blood after, wash with the PBS that contains 1% casamino acids, (30 μ L contain 5.2 * 10 to adjust to the suitable malicious concentration of attacking
6The CFU viable bacteria).Every mouse lies on the back it by abdominal injection 0.2mL narcotics (containing 0.25mg xylazine and 1.25mg ketamine) anesthetized mice, contains 5.2 * 10 with 30 μ L then
6The injection of solution of CFU viable bacteria allows it absorb fully in the nostril of mouse.Observed 30 days.C500 parent bacteria vaccine control group and LB blank group mouse are attacked and all show behind the poison One's spirits are droopingly, do not eat, and begin to occur dead behind the 8h, and dead peak appears at 3-4d, and death stops behind the 7d.Dead mouse is cutd open the visible lung of inspection tangible necrosis, hemorrhage, and transudate increases, retrogradation; Liver, intestines and internal organs of the body device are hemorrhage, downright bad, and the surface is many with one deck pseudomembranes, easily peels off; All can be separated to infectious bacteria from dead mouse painstaking effort, liver, spleen, lungs and kidney.20 mouse of C501 of the present invention (pYA-F1P2) reorganization bacteria vaccine group all survive, and any incidence do not occur after attacking poison, and protection ratio is 100% (20/20).And C500 parent bacteria vaccine control group (20) and LB blank group mouse (20) survive 3 and 4 respectively.Reorganization bacterium C501 (pYA-F1P2) vaccine group of this explanation the present invention preparation can be resisted 4 * LD
50The attack of pig source segmental bronchus sepsis bordetella bacilli intensity strain HH0809.Attacking poison back protection ratio situation is shown in Table 5.
The recombiant vaccine C501 (pYA-F1P2) of table 5 the present invention preparation attacks the protectiveness of BALB/c small white mouse to pig source segmental bronchus sepsis bordetella bacilli wild-type virulent strain HH0809
| The test grouping | Subcutaneous immunizing dose (CFU) | Nasal cavity is attacked toxic agent amount (CFU) | Survival number/sum | Survival rate (%) |
| Reorganization bacterium C501 of the present invention (pYA-F1P2) vaccine group | 1.2×10 8 | 5.2×10 5 | 20/20 | 100 |
| Parent bacterium C500 vaccine group | 1.2×10 8 | 5.2×10 5 | 3/20 | 15 |
| The PBS control group | 200μL | 5.2×10 5 | 4/20 | 5 |
The reorganization bacteria vaccine C501 (pYA-F1P2) of embodiment 8 the present invention preparation detects at the intravital immune efficacy of pig
1, the immune programme for children of pig:
24 of the piglets of selection 20-25 age in days, Salmonellas and segmental bronchus sepsis bordetella bacilli feminine gender, test divides 3 groups, the 1st group is the LB control group, numbering 1-8, the 2nd group is C500 parent bacteria vaccine control group, numbering the 9～16,3rd group is C501 of the present invention (pYA-F1P2) reorganization bacteria vaccine group, numbering 17～24.
Every pig injection of LB control group 1mL LB substratum, C500 parent bacteria vaccine control group and every pig musculi colli injection of reorganization bacteria vaccine C501 of the present invention (pYA-F1P2) group 1mL culture (viable bacteria content 4 * 10
9CFU), immunity 2 times, 2 weeks at interval.Exempt from 2 weeks of back and two one and exempt from each blood sampling of 2 weeks of back once, detect Salmonellas serum antibody (standard ELISA method with the ELISA method respectively, with reference to Covone, M.G., M.Brocchi, E.Palla, W.Dias, da, Silveira, R.Rappuoli, and C.L.Galeotti.1998.Levels of expression and immunogenicity of attenuated Salmonella entericaserovar Typhimurium strains expressing Escherichia coli mutant heat-labile enterotoxin.Infect.Immun.66:224-231) and rF1P2 recombinant protein antibody horizontal (method is with embodiment 7).Test grouping, immunization route and immunizing dose details see Table 6.
2, immune piglet ELISA antibody horizontal detects
In 2 weeks of immunity back and immunity back 2 all precaval vein blood samplings for the second time for the first time, separation of serum adopts indirect ELISA method to detect Salmonellas serum antibody, rF1P2 specific antibody titres respectively, averages respectively.The results are shown in Table 6: head exempts from back the 2nd all reorganization bacteria vaccine C501 of the present invention (pYA-F1P2) group and C500 parent bacteria vaccine group antibodies toward salmonella is 1: 320, two exempt from 2 weeks of back (being that head exempts from 4 weeks of back), of the present invention) reorganization bacteria vaccine C501 (tire and rise to respectively at 1: 2816 and 1: 3072 by pYA-F1P2 group and C500 parent bacteria vaccine group antibodies toward salmonella.And the LB that carries out synchronously contrast all negative (＜1: 5).It is 1: 288 that head exempts from 2 all reorganization bacteria vaccine C501 of the present invention (pYA-F1P2) group rF1P2 specific antibody titres, and two exempt from 2 weeks of back, and the rF1P2 antibody titer rises to 1: 1920.And C500 parent strain control group that carries out synchronously and LB control group all negative (＜1: 5).The above results can induce body to produce the humoral immunoresponse(HI) of specific anti-salmonella and rF1P2 specific antibody after showing C501 (pYA-F1P2) the reorganization bacteria vaccine immunity piglet that the present invention prepares.
The immune piglet Serum Antibody Detection of reorganization bacteria vaccine C501 (pYA-F1P2) (ELISA method) of table 6 the present invention preparation
3, the protectiveness test of the immune piglet of reorganization bacteria vaccine C501 (pYA-F1P2) of the present invention's preparation:
Two exempted from the back the 16th day, and (head exempted from back 30 days) chooses 4 for every group from the 1st, 2 and 3 group, and every pig ear vein injection 1mL C78-1 virulent strain bacterium liquid (contains the 5 * LD that has an appointment
50, about 2 * 10
9The CFU viable bacteria) attacks poison, observed 30 days.LB control group piglet shows as fervescence to 41-42 ℃ after attacking poison, and lassitude is lain prostrate, appetite stimulator or useless exhausted, and expiratory dyspnea, walking is rocked, vomiting and diarrhoea.Limb end and belly cyanosis.It is dead to attack poison beginning in back 3 days, all dead in 7 days.Reorganization bacteria vaccine C501 of the present invention (pYA-F1P2) group and C500 parent bacteria vaccine group piglet are attacked the no obvious disease symptom in poison back, all survivals.This explanation C501 (pYA-F1P2) recombiant vaccine has kept the ability of the opposing Salmonella choleraesuls infection of C500 parent bacteria vaccine, can resist 5 * LD
50The attack of Salmonella choleraesuls intensity strain C78-1.Attacking poison back protection ratio situation is shown in Table 8.
The recombiant vaccine C501 (pYA-F1P2) of table 8 the present invention preparation attacks the protectiveness of piglet to Salmonella choleraesuls C78-1 wild-type virulent strain
| The test grouping | Subcutaneous immunizing dose (CFU) | Ear vein is attacked toxic agent amount (CFU) | Survival number/sum | Protection ratio (%) | |
| Reorganization bacterium C501 of the present invention (pYA-F1P2) vaccine group | 4×10 9 | 2×10 9 | 4/4 | 100 | |
| Parent bacterium C500 vaccine group | 4×10 9 | 2×10 9 | 4/4 | 100 | |
| The PBS | 1mL | 2×10 9 | 0/4 | 0 |
Two exempted from the back the 16th day, and (head exempted from back 30 days) is used for each group residue piglet (every group remains 4) attack of pig source segmental bronchus sepsis bordetella bacilli.With segmental bronchus sepsis bordetella bacilli virulent strain HH0809 contain 15% take off cultivate 48h on the Bao-Jiang Shi flat board of fine sheep blood after, wash with the PBS that contains 1% casamino acids, adjust to the suitable malicious concentration (2 * 10 of attacking
11The CFU/mL viable bacteria).Every piglet contains 4 * 10 by pars cervicalis tracheae injection 2mL
11The injection of solution of CFU viable bacteria allows it absorb fully in respiratory tract.Attacking the poison back observes a week continuously.After attacking poison, parent bacterium C500 vaccine control group and LB blank group piglet all show fervescence, cough, and expiratory dyspnea is not eaten, and has a running nose, and sickness rate is 100%.Any obvious incidence sickness rate does not appear in 4 piglets of reorganization bacterium C501 of the present invention (pYA-F1P2) vaccine group after attacking poison be 0.Attack poison all piglet anatomic observation pathological changes in back 7 days.Attack poison back protection situation and see Table 9
The recombiant vaccine C501 (pYA-F1P2) of table 9 the present invention preparation attacks the protection result of piglet to segmental bronchus sepsis bordetella bacilli wild-type virulent strain HH0809
A, the lesion degree of b pneumonia and trachitis :-, do not have; +, slight; ++, moderate; +++, is serious
C respiratory rate: per 15 seconds frequency of respiration
The d expiratory dyspnea: 0, normal; 1, slight; 2, moderate; 3, serious
The drowsiness degree of e: 0, normal; 1, slight; 2, moderate; 3, serious
F appetite situation (in the 36h): 0, food; 1, do not eat food
The g bacterium separates :+, can separate from lung;-, can not separate
The test-results of the embodiment of the invention all clearly shows, a kind of expression pig source segmental bronchus sepsis bordetella bacilli fhaB of resistance marker and high Salmonella choleraesuls antibody of tiring of recombinant salmonella choleraesuis strain C501 (pYA-F1P2) vaccine energy excitating organism generation of prn gene fragment of not containing of the present invention, and produce high tire at pig segmental bronchus sepsis bordetella bacilli FHA and the antigenic specific antibody of PRN immunity, very low to mouse and pig toxicity, security is good.In the immune protective efficiency test, Salmonella choleraesuls and pig source segmental bronchus sepsis bordetella bacilli all had the very high malicious protection ratio of attacking.
Claims (3)
1. recombinant salmonella choleraesuis strain (Salmonella choleraesuis) C501 (pYA-F1P2) who expresses pig source segmental bronchus sepsis bordetella bacilli fhaB and prn gene fragment, be deposited in Chinese typical culture collection center, its preserving number is CCTCC NO:M207138.
2. the described preserving number of claim 1 is the vaccine at Salmonella choleraesuls and pig source segmental bronchus sepsis bordetella bacilli of recombinant bacterial strain C501 (pYA-F1P2) preparation of CCTCC NO:M207138.
The described preserving number of claim 1 be CCTCC NO:M207138 recombinant bacterial strain C501 (pYA-F1P2) the preparation at the purposes in the vaccine of Salmonella choleraesuls and pig source segmental bronchus sepsis bordetella bacilli.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200710053386A CN101157907B (en) | 2007-09-27 | 2007-09-27 | Recombinant salmonella choleraesuis strain for expression of pig origin bordetella bronchisepatica fhaB and prn gene segment, bacterin and uses thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200710053386A CN101157907B (en) | 2007-09-27 | 2007-09-27 | Recombinant salmonella choleraesuis strain for expression of pig origin bordetella bronchisepatica fhaB and prn gene segment, bacterin and uses thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101157907A CN101157907A (en) | 2008-04-09 |
| CN101157907B true CN101157907B (en) | 2010-05-19 |
Family
ID=39306146
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200710053386A Expired - Fee Related CN101157907B (en) | 2007-09-27 | 2007-09-27 | Recombinant salmonella choleraesuis strain for expression of pig origin bordetella bronchisepatica fhaB and prn gene segment, bacterin and uses thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101157907B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101575586B (en) * | 2009-05-31 | 2011-01-19 | 华中农业大学 | Bordetella bronchiseptica gene deleted vaccine and application |
| CN101880647B (en) * | 2009-09-11 | 2012-04-25 | 华中农业大学 | Recombinant salmonella choleraesuis, bivalent genetic engineering vaccine and application |
| CN101926987B (en) * | 2010-08-17 | 2012-05-23 | 北京中海生物科技有限公司 | Method for producing piglet paratyphoid live vaccine by using synthetic medium |
| CN103013895B (en) * | 2011-09-23 | 2014-07-16 | 华中农业大学 | Genetic engineering live vaccine of recombinant Salmonella choleraesuis and Porcine epidemic diarrhea virus, preparation and application |
| CN103421729B (en) * | 2012-10-24 | 2015-06-17 | 华中农业大学 | Gene recombined swine cholera salmonella choleraesuis vaccine for blue-ear disease and application thereof |
| CN106729683B (en) * | 2016-12-16 | 2019-12-03 | 青岛易邦生物工程有限公司 | A kind of B.bronchisepticai disease vaccine |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1046532A (en) * | 1989-03-31 | 1990-10-31 | 华盛顿大学 | Bordetella vaccines |
-
2007
- 2007-09-27 CN CN200710053386A patent/CN101157907B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1046532A (en) * | 1989-03-31 | 1990-10-31 | 华盛顿大学 | Bordetella vaccines |
Non-Patent Citations (4)
| Title |
|---|
| 徐引弟等.猪霍乱沙门氏菌C500株△crp△asd缺失株平衡致死载体系统的构建及鉴定.生物工程学报22 03期.2006,22(03期),366-371. |
| 徐引弟等.猪霍乱沙门氏菌C500株△crp△asd缺失株平衡致死载体系统的构建及鉴定.生物工程学报22 03期.2006,22(03期),366-371. * |
| 裴洁.猪支气管败血波氏杆菌分离鉴定及疫苗菌株的生物学特性研究.中国优秀硕士学位论文全文数据库农业科技辑(季刊) 2007年第2期.2007,(2007年第2期),1.2.2节. |
| 裴洁.猪支气管败血波氏杆菌分离鉴定及疫苗菌株的生物学特性研究.中国优秀硕士学位论文全文数据库农业科技辑(季刊) 2007年第2期.2007,(2007年第2期),1.2.2节. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101157907A (en) | 2008-04-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Tarahomjoo | Development of vaccine delivery vehicles based on lactic acid bacteria | |
| CN101157907B (en) | Recombinant salmonella choleraesuis strain for expression of pig origin bordetella bronchisepatica fhaB and prn gene segment, bacterin and uses thereof | |
| CN103013895B (en) | Genetic engineering live vaccine of recombinant Salmonella choleraesuis and Porcine epidemic diarrhea virus, preparation and application | |
| Levine et al. | A roadmap for enterotoxigenic Escherichia coli vaccine development based on volunteer challenge studies | |
| CN101880647B (en) | Recombinant salmonella choleraesuis, bivalent genetic engineering vaccine and application | |
| CN101603024B (en) | Porcine mycoplasmal pneumonia and porcine infectious actinobacillus pleuropneumoniae serum 1 type gene engineering strain vaccine and application thereof | |
| WO2012092226A1 (en) | Veterinary vaccine composition against infections caused by salmonella | |
| JP5745731B2 (en) | Salmonella vaccine | |
| US9358283B2 (en) | Diatom-based vaccines | |
| ES2824402T3 (en) | Attenuated vaccines against Pasteurella multocida and procedures for their manufacture and use | |
| CN102140430B (en) | Mouse-typhus salmonella gene-deletion mutant strain without containing resistance marks, vaccine and application thereof | |
| Roland et al. | Expression of Escherichia coli antigens in Salmonella typhimurium as a vaccine to prevent airsacculitis in chickens | |
| ES2279582T3 (en) | MUTANT OF DELETION OF LKTA OF P. HEMOLITICA. | |
| CN103275228A (en) | K99-987P-F41 recombinant protein and application thereof | |
| CN103421731B (en) | A kind of haemophilus parasuis attenuation salmonella seedling | |
| CN102732473A (en) | Recombinant salmonella choleraesuis expressing mycoplasma hyopneumoniae p46 protein, preparation method and application thereof | |
| CN105154377B (en) | Recombinant salmonella pullorum, preparation method and application | |
| BR112015010364B1 (en) | Attenuated mannheimia haemolytica vaccines and methods of production and use | |
| CN103421733B (en) | A kind of haemophilus parasuis-Salmonella choleraesuls bigeminy gene engineering vaccine | |
| JP2009529895A (en) | Attenuated Salmonella live vaccine | |
| CN102676421B (en) | Bordetella bronchiseptica gene deletion strain, vaccine prepared from Bordetella bronchiseptica gene deletion strain and application | |
| CN103421732B (en) | Express the Salmonella choleraesuls attenuated vaccine of haemophilus parasuis surface antigen | |
| CN101962625A (en) | Salmonella choleraesuis gene deletion mutant without resistant marker and vaccine thereof | |
| CN102732442A (en) | Salmonella choleraesuis double-gene-deletion strain free of resistance marker and application thereof | |
| CN103421729B (en) | Gene recombined swine cholera salmonella choleraesuis vaccine for blue-ear disease and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| ASS | Succession or assignment of patent right |
Owner name: WUHAN KEQIAN ANIMAL BIOLOGICAL PRODUCTS CO., LTD. Free format text: FORMER OWNER: HUAZHONG AGRICULTURAL UNIVERSITY Effective date: 20110816 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20110816 Address after: 430070 lion mountain street, Hongshan District, Hubei, Wuhan Patentee after: Wuhan Keqian Animal Biological Products Co., Ltd. Address before: 430070 Wuhan, Hongshan Province, lion street, No. 1 District, No. Patentee before: Huazhong Agricultural University |
|
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20100519 Termination date: 20160927 |