CN103275228A - K99-987P-F41 recombinant protein and application thereof - Google Patents

Abstract

The invention relates to a K99-987P-F41 recombinant protein, wherein the amino acid sequence thereof is shown by SEQ ID No.2. The invention also provides a coding gene of the recombinant protein, a preparation method and an application in preparing an enterotoxigenic escherichia coli (ETEC) vaccine. The three-section target genes ETEC adhesins K99, 987P and F41 are serially connected and sub-cloned to an escherichia coli prokaryotic expression vector pET30a(+), and can be used for preparing an escherichia coli K99-987-F41 series connection expression subunit vaccine; multiple antibodies can be obtained by immunizing once, and the vaccine is convenient to use and overcomes the shortcomings of a monovalent vaccine; meanwhile, since a few surface proteins are contained, many unrelated antigenic determinants of bacteria and side reaction caused by crude extraction or semi-purification preparation are eliminated; and the K99-987P-F41 recombinant protein has the characteristics of good safety and good stability, can overcome the shortcomings of whole-cell inactivated vaccines, and has the advantage of high specificity of subunit vaccines.

Description

K99-987P-F41 recombinant protein and application thereof

Technical field

The invention belongs to animal molecular biology and genetically engineered field, relate to a kind of K99-987P-F41 recombinant protein and application thereof.

Background technology

(Enterotoxigenic Escherichia coli is the modal reason of calf diarrhea ETEC), causes animal acute diarrheas such as ox, pig usually to produce enterotoxigenic escherichia coli.ETEC mainly acts on jejunum, ileum, especially ileum.The virulence factor of ETEC comprises adhesin (also claiming pili) and enterotoxin.The mechanism of causing a disease of ETEC is specificity pili and the combination of host's mucous membrane of small intestine epithelial cell specific receptors, and then is colonizated in mucous membrane of small intestine, prevents that it runs off because of intestines peristalsis and intestinal contents mobilization, and ETEC is breeding in a large number in enteron aisle, the secretion enterotoxin.Enterotoxin can cause the small intestinal cell secreting function to strengthen and absorptive function descends, and makes retention large quantity of moisture and ionogen in the enteron aisle, causes diarrhoea.ETEC can enter environment by the ox that infects usually, and the calf of birth is caused a disease.Usually have some calves and can obtain natural immunoprotection, yet under herding in modern age envrionment conditions, this provide protection can not be protected calf usually, even the calf infection rate raises.Since the ability that new-born calve is resisted extraneous pathogen infection relatively a little less than, ETEC fall ill anxious death also have little time soon the treatment, can use microbiotic for the chronic sick ox of commentaries on classics treats, but the lack of standardization or long-term prescription of drug use clinically, cause the enhancing of ETEC resistance or Resistant strain occurs, clinical therapeutic efficacy is not remarkable, and has increased medical expense.Need develop effective vaccine prevents.ETEC also is that a kind of Amphixenosis is former simultaneously, can cause neonatal diarrhea, therefore carries out the anti-system of calf colibacillosis, also has important public health meaning.

K99,987P and F41 are three kinds of important adhesins of enterotoxigenic escherichia coli, below these three kinds of adhesins are elaborated

(1) K99:1972, Smith and Linggood have at first reported from diarrhoea calf and lamb and have been separated to the e. coli k99 adhesin.Under electron microscope, the K99 adhesin negative staining electron microscopic observation of purification is shaft-like microfilament structure, and has very strong gathering tendency.In the SDS-PAGE electrophoresis, it presents the protein band that a molecular weight is about 18ku, and its iso-electric point is 9.75 after measured.K99 sees ox, sheep, pig source property ETEC, and adhesion only limits to the small intestine back segment of young animal, has seminose resistance and blood coagulation activity.Pili type F5(K99) mediation ETEC specifically mucous membrane on calf, lamb and piglet intestinal mucosa surface.Gene related in the biosynthesizing of K99 adhesin is cloned, and is positioned on the nonconjugative plasmid of a 87.8kb, this plasmid can also encode ST and some antibiotics resistance genes.The protein expression of 8 uniquenesses of synthetic needs of K99 pili: fanA～H.FanC, the K99 pili of main subunit and immunogenic polypeptide is expressing K 99 genes of topnotch.The result shows that the expression amount that some ETEC K99+ bacterial strains detect K99 is variable.Therefore, use the Minca substratum, can improve the K99 resolution.These experiments show that glucose suppresses K99 expresses.Several bacteriotoxic synthetic glucose that are subjected to occur and suppress, comprise mutant heat-stable enterotoxin and staphylococcus aureus toxin A, B and C.Add ectogenic ring-type adenosine phosphate (cAMP) can make heat-staple enterotoxigenic intestinal bacteria overcome glucose mediation to suppress thermally-stabilised enterotoxin synthetic.But the K99 that Exogenous cAMP can not make the K99 intestinal bacteria overcome the glucose mediation suppresses phenomenon.Except the regulation and control of glucose mediation, the expression of K99 and detection also are subjected to other mechanism regulatings.For example, found that, before inoculation is dull and stereotyped, by increasing grow aerobically in the ETEC liquid medium within, can improve K99 recall rate among the K99+ETEC.

The K99+ bacterial strain separates from clinical samples recently can not appear at external synthetic K99 usually; Yet behind the biography several generations, K99 is detectable in the liquid medium within.It is relevant with the pod membrane mutant to appear at the liquid nutrient medium result.The supposition mucous bursa has been covered some ETEC K99, and therefore, the pod membrane mutant detects K99 and is more suitable for.The expression of K99 also depends on the temperature of cell growth.In the time of 18 ℃, can expressing K 99 pili in the Bacillus coli cells, then do not express at 37 ℃, do not express other pili yet.The K99 pili is combined acceptor of needs with cell, i.e. N-hydroxy acid GM3, and it is arranged in enteral host cell, and this position is bacterial reproduction and the place that excretes poison, and causes suffering from diarrhoea after K99 pili and receptors bind.Be suppressed when adhering to of ETEC host cell, bacterium can not be accumulated in the enteron aisle, does not then cause disease.

(2) 987P:1976 Nagy etc. finds the 987P adhesin.Observe under electron microscope, diameter is 7nm, about length 2～4 μ m.Quite similar with I type pili on the morphology, be a kind of long and hard filament, be hollow structure.The molecular weight of its protein subunit is about 18.9ku, and the protein band of an about 20ku of molecular weight only appears in purifying antigen in the SDS-PAGE electrophoresis, and iso-electric point is 3.7.987P does not have hemagglutination activity, and this pili with external all adsorbable in intestinal epithelial cell and brush border, is not suppressed by seminose in vivo.In preserving, the laboratory loses easily.987P sees some ox, pig source property ETEC, and adhesion is limited to the small intestine back segment epithelial cell of young animal.

The gene of coding 987P adhesin is positioned on the plasmid.The 987P biosynthesizing needs fasA～fasH8 kind gene.Except positive regulon fasH, there are three kinds of structural protein to comprise FasA, FasF and FasG, fasA is unique adhesin subunit factor of determination that sticks characteristic that possesses, and four kinds of pili essential attached albumen biologically, as FasD outer membrane protein pilot protein, FasB is a kind of pericentral siphon chaperone of the main FasA of subunit, and FasC can interact with specificity with adhesivity FasG is stable, and chaperone FasE.The bacterial pilli biological study that is found to be of the different chaperones of 987P subunit provides new thinking.

(3) F41:1978, Morris etc. propose to contain two kinds of proteantigens of yin, yang ion in the K99 antigen thing of ox source B41 bacterial strain first.Proved through scientist that positively charged ion antigen was the K99 pili in 1980, and negatively charged ion antigen is a kind of new pili.Nineteen eighty-two, the negatively charged ion antigens of having purified from the mutant strain of B41 bacterial strain such as De Graaf: the F41 pili, encoding gene is present on the bacterial chromosome.Be filamentary texture, diameter is 3.2nm, and through the SDS-PAGE gel electrophoresis analysis, molecular weight is about 29.5ku, and iso-electric point is 4.6.Add L-Ala and can suppress to generate pili.The hereditary property of F41 depends on chromosomal DNA but not plasmid DNA.At present, the F41 pili of the ETEC bacterial strain of different sources is only with to contain two serological type strains of O9 or O101 relevant, in the bacterial strain with these two kinds of O antigens, but the F41 pili on a bacterial strain both single expression also can occur simultaneously with the K99 pili.The F41 pili only produces ST usually, and does not produce LT, compares with the K99 pili, and adhesive capacity is stronger, can also be suppressed by suitable antibodies and Fab fragment thereof, but not influenced by seminose.Can produce the antibody that height is tired with the antigen-immunized animal body that has the F41 pili.

At present, the vaccine of ETEC is mainly the whole cell inactivated vaccine, and deactivation vaccine is treated and deadly pathogenic agent, and security is good, and itself can not cause primary disease.Inactivated vaccine is more stable, difficultly loses efficacy because dealing with improperly, is applied to prevent in actual production all obtained effect preferably in the diarrhoea of pig, chicken, duck, ox, sheep.Wang Zhaojun etc. are to the clinical chicken colibacillosis that is separated in locality, and serotype is O32, O68 and O78 type, the preparation oil adjuvant killed vaccine.Test-results shows, this vaccine stable in properties, safe and reliable, can induce body to produce good immune response, can protect chicken to resist local popular coli-infection effectively.Liu Di qins etc. prepare inactivated vaccine, immune pregnant sow with the popular bacterial strain of local intestinal bacteria after the rejuvenation of piglet virulence.Confirm this inactivated vaccine safely, have no side effect, can make pregnant sow produce good immune effect.As to yak protectiveness research object, the result has confirmed the yak antibody titer through 2 immunity to this pearl of Soinam etc. with yak intestinal bacteria inactivated vaccine immune time, and protection ratio obviously is better than 1 immunity.Li Zhenqing is according to local intestinal bacteria popularity, utilize O78 type intestinal bacteria and O92 type pest of duck Lee Mo Shi bacillus of clinical separation to prepare bivalent inactivated vaccine, find behind the immunity meat duck and duckling, this vaccine tool stimulates body to produce higher antibody horizontal, can prevent the attack of intestinal bacteria and pest of duck Lee Mo Shi bacillus.Gao Rui filters out serotype in the virulence medium tenacity flora of Shanxi Province's calf diarrhea be O2, O86 and O101 three strain bacteriums, prepares oily adjuvant tervalence inactivated vaccine, and immunizing rabbit has been obtained good immune effect.Cui Yudong etc. do bacterial classification with the ox source intestinal bacteria isolated strains that has K99, F41 pili antigen simultaneously, have prepared the inactivated vaccine immune animal, show that inactivated vaccine can induce body to produce good immunne response.ETEC serotype is numerous, and conventional whole cell inactivated vaccine only has restraining effect to certain serotype E TEC.Though oneself seedling immune effect is relatively good, only can among a small circle, be suitable for.In addition, the productive expense of inactivated vaccine is higher, and need improve the immunne response of body with adjuvant.In addition, important antigen is lost, immunity not exclusively.Therefore, need the invention new generation vaccine, to overcome the defective of whole cell inactivated vaccine.

Subunit vaccine can induce body to produce the vaccine of protection antibody.The main surface protein that has only minority, thus eliminate the many incoherent antigenic determinants of bacterium and slightly carry or half purifying preparation causes side reaction.Its advantage is, this vaccine only comprises the immunogenic composition of necessary protective immunological reaction, does not contain communicable material, and security is good.Do not take place after the inoculation acute, persistence or latent infection, and can be used in some cases.Transfer to non-virulent, but harmless microorganism, the immunogenic vaccine for scale operation has also improved security.Immunosuppression anaphylactogen and other adverse reaction have reduced untoward reaction.This vaccine has good stability, the convenient storage and transportation.Disease control vaccine can be used for the pathogenic agent of external disease and can not cultivate pathogenic agent, has enlarged use range.It induces body to produce immune response, can distinguish immune response and infection, thereby is more suitable in control and elimination epidemic.

Summary of the invention

First purpose of the present invention provides a kind of K99-987P-F41 recombinant protein and encoding gene thereof.

Second purpose of the present invention provides the preparation method of above-mentioned recombinant protein.

The 3rd purpose of the present invention provides the purposes of above-mentioned recombinant protein.

The present invention is achieved through the following technical solutions:

One, a kind of K99-987P-F41 recombinant protein, its aminoacid sequence is shown in SEQ ID No.2.

Two, the gene of the above-mentioned K99-987P-F41 recombinant protein of coding, its nucleotide sequence is shown in SEQ ID No.1.

Three, a kind of preparation method of K99-987P-F41 recombinant protein, this method may further comprise the steps:

(1) enterotoxigenic escherichia coli adhesin K99, the 987P that has delivered according to GenBank, F41 gene complete sequence (accession number is respectively M35282.1, M35257.1, M21788.1) design primer, genome with intestinal bacteria C83912, intestinal bacteria C83916, intestinal bacteria C83919 is template, and PCR amplifies the purpose fragment respectively; Wherein, the primer sequence is as follows:

P1：K99(F)：CGG GGTACCATGACTATTAACTTCAATGGCAAA（KpnI）（SEQ ID No.3）；

P2：K99(R)：CGC GGATCCTGAAGTAGTAAATACGCCAGC(BamHI)（SEQ ID No.4）；

P3：987P(F)：CGC GGATCCGGTGGTGGTGGTTCTGCTGAAAACAACACCAGCCAG(BamHI)（SEQ ID No.5）；

P4：987P(R)：C GAGCTCACTAGCAGTGACAGTACCGGC(SacI)（SEQ ID No.6）；

P5：F41(F)：C GAGCTCGGCGGTGGCGGCAGCGTATCTGGTTCAGTGATGGCT(SacI)（SEQ ID No.7）；

P6：F41(R)：AAGGAAAAAA GCGGCCGCACTGAGGTCATCCCAATTGTG(NotI)（SEQ ID No.8）。

(2) three fragment series connection are connected into carrier pET30a, construction of expression vector pET30a-K99-987P-F41;

(3) expression vector pET30a-K99-987P-F41 is converted into competent escherichia coli cell, and the IPTG abduction delivering obtains recombinant protein.

Four, the application of K99-987P-F41 recombinant protein in preparation enterotoxigenic escherichia coli vaccine.

Adopt the positively effect of technique scheme: the present invention is with ETEC adhesin K99,987P, three sections goal gene series connection of F41 subclone is to escherichia coli prokaryotic expression carrier pET30a (+), between the two neighboring sections gene, introduced flexible Linker, avoid the interactional function that influences between the target protein, can be used for preparing e. coli k99-987P-F41 tandem expression subunit vaccine, once immunity can obtain multiple antibody, easy to use, overcome the shortcoming of univalent vaccine, simultaneously owing to only contain the surface protein of minority, thereby eliminate the many incoherent antigenic determinants of bacterium and slightly carry or side reaction that half purifying preparation causes, characteristics with the good and good stability of security, can overcome the shortcoming of full bacterium inactivated vaccine, have the high advantage of subunit vaccine specificity.

Description of drawings

Fig. 1 is genome pcr amplification figure as a result;

Among the figure, M.DL2000DNA Marker; 1. negative control; 2.K99PCR product; 3.987P PCR product; 4.F41PCR product;

Fig. 2 is recombinant plasmid pcr amplification figure as a result;

Among the figure, M.DL2000DNA marker; 1.k99 amplification; 2.987P amplification; 3.F41 amplification; 4.K99-987P-F41 amplification;

Fig. 3 is that the pET30a-K99-987P-F41 enzyme is cut qualification result;

Among the figure, M.DL2000DNA marker; 1.K99; 2.987P; 3.F41; 4.K99-987P-F41;

Fig. 4 is recombinant protein SDS-PAGE analytical results;

Among the figure, M. dyes albumen marker in advance; 1.pET30a after inducing; 2. do not induce the reorganization bacterium; 3. induce back reorganization bacterium ultrasonication supernatant; 4. induce back reorganization ultrasonication precipitation

Fig. 5 is recombinant protein Western blot detected result;

Among the figure, M. dyes protein standard in advance; 1.K99 natural common pili polyclonal antibody is primary antibodie; 2.987P natural common pili polyclonal antibody is primary antibodie; 3.F41 natural common pili polyclonal antibody is primary antibodie; 4.K99 the reorganization common pili polyclonal antibody is primary antibodie; 5.987P the reorganization common pili polyclonal antibody is primary antibodie; 6.F41 the reorganization common pili polyclonal antibody is primary antibodie; 7.PBS control group.

Embodiment

Below in conjunction with embodiment and Comparative Examples technical scheme of the present invention is described further, but should not be construed as limitation of the present invention:

Biological material source among the present invention:

1, reference culture intestinal bacteria C83912, intestinal bacteria C83916, intestinal bacteria C83919 bacterial strain are available from Chinese veterinary microorganism culture presevation administrative center;

2, used carrier pMD-18T and pET30a all purchase the company in Takara;

3, the primer is for designing voluntarily and entrusting Harbin Bo Shi biotech firm synthetic.

Embodiment 1

Enterotoxigenic escherichia coli adhesin K99,987P, the F41 gene complete sequence (accession number is respectively M35282.1, M35257.1, M21788.1) delivered according to GenBank design primer, genome with intestinal bacteria C83912, intestinal bacteria C83916, intestinal bacteria C83919 is template, and PCR amplifies the purpose fragment respectively; Wherein, intestinal bacteria C83912, intestinal bacteria C83916, intestinal bacteria C83919 contain adhesin K99, adhesin 987P and adhesin F41 respectively, and the primer sequence is as follows:

P1：K99(F)：CGG GGTACCATGACTATTAACTTCAATGGCAAA（KpnI）（SEQ ID No.3）；

P2：K99(R)：CGC GGATCCTGAAGTAGTAAATACGCCAGC(BamHI)（SEQ ID No.4）；

P3：987P(F)：CGC GGATCCGGTGGTGGTGGTTCTGCTGAAAACAACACCAGCCAG(BamHI)（SEQ ID No.5）；

P4：987P(R)：C GAGCTCACTAGCAGTGACAGTACCGGC(SacI)（SEQ ID No.6）；

P5：F41(F)：C GAGCTCGGCGGTGGCGGCAGCGTATCTGGTTCAGTGATGGCT(SacI)（SEQ ID No.7）；

P6：F41(R)：AAGGAAAAAA GCGGCCGCACTGAGGTCATCCCAATTGTG(NotI)（SEQ ID No.8）。

1, at first adopting Auele Specific Primer P1/P2, is template with the genome of intestinal bacteria C83912, carries out pcr amplification respectively, and the PCR reaction system is popular response system in the prior art.The PCR response procedures: 98 ℃ of pre-sex change 10s, 98 ℃ of sex change 30s, 51 ℃ of annealing 30s, 72 ℃ are extended 1min, circulate 25 times, and last 72 ℃ are extended 10min, 4 ℃ of preservations.

2, reclaim test kit with PCR product glue and carry out the recovery of K99PCR product, step is as follows:

1) under ultraviolet lamp, uses knife blade to downcut purpose fragment sepharose fast, put into the 1.5mL centrifuge tube.

2) ratio in 1:3 adds Extraction Buffer.

3) place 10min at 50 ℃ of thermostat water baths, softly put upside down every 2min.

4) mixed solution in the previous step is added among the Spin column, the centrifugal 1min of 6000 * g outwells collection tube liquid.

5) in Spin column, add 500 μ L Extraction Buffer, in the centrifugal 1min of 12000 * g, discard and connect liquid in the liquid.

6) in Spin column, add 750 μ L Wash Buffer, in the centrifugal 1min of 12000 * g, discard liquid in the adapter.

7) Spin column is put back in the collection tube the centrifugal 1min of 12000 * g.Spin column is put in the aseptic 1.5mL EP pipe.

8) in Spin column, add 50 μ L Elution Buffer, and leave standstill 1min in room temperature.In the centrifugal 1min of 12000 * g, contain target DNA fragment in the solution in the Eppendorf tube.Deposit-20 ℃.

3, add the A test kit according to flat terminal dna fragmentation, concrete steps are as follows

1) to add A reaction solution system as follows in configuration:

2) 72 ℃ of temperature are bathed 30min.

3) leave standstill 2min on ice and make the reaction cooling.

4, pMD-18T carrier ligation

Reaction system is as follows:

Solution I 5μL

Add A product 4 μ L

PMD-18T 1μL

16 ℃ of connections are spent the night.

5, transform: from-70 ℃, take out competent cell and imbed in the ice cube, from 16 ℃ of water-baths, take out and connect product, remove and seal film, be placed on ice, treat that competent cell melts after, will connect all adding 100 μ L DH5 α competent cells of product, mixings.Act on 30min on ice.42 ℃ of heat shock 90s act on 2min on ice.Add 800 μ L LB then, 37 ℃ of shaking table 170r/min concussion 1h.The centrifugal 5min of culture 5000r/min.Discard the part supernatant, stay 100 μ L approximately, be coated with kana resistance LB flat board behind the mixing.Hatch 12～16h for 37 ℃.

6, plasmid DNA is extracted in a small amount

1) get the fresh bacterium liquid of 2mL, the centrifugal 1min of 12000 * g outwells supernatant.

2) add 250 μ L Buffer S1 suspension bacterial precipitations, suspending needs mixing, should not leave little bacterium piece.

3) add 250 μ L Buffer S2, gentleness also spins upside down fully to mix for 4～6 times and makes the abundant cracking of thalline.

4) add 350 μ L Buffer S3, gentle also spinning upside down fully mixed the centrifugal 10min of 12000 * g 6～8 times.

5) draw supernatant liquor and transferring in the preparation pipe, the centrifugal 1min of 12000 * g outwells filtrate.

6) add 500 μ L Buffer W1 in the preparation pipe, the centrifugal 1min of 12000 * g abandons filtrate.

7) will prepare pipe and put back to collection tube, and add 700 μ L Buffer W2, the centrifugal 1min of 12000 * g abandons filtrate; In kind again with 700 μ L Buffer W2 washing once.Abandon filtrate.

8) the centrifugal 1min of 12000 * g.

9) will prepare pipe and move in the new 1.5mL centrifuge tube, central authorities add 70 μ L Eluent at the preparation pipe, and room temperature leaves standstill 1min.The centrifugal 1min of 12000 * g.-20 ℃ of preservations.

7, the evaluation of recombinant plasmid

1) PCR of recombinant plasmid identifies

The plasmid that extracts is carried out pcr amplification, 1% agarose gel electrophoresis, observations.

2) double digestion of recombinant plasmid is identified

Carry out enzyme with KpnI, BamHI and cut, the double digestion system is as follows:

Behind the mixing, 37 ℃ of 5min, 80 ℃ stop 5min.1% agarose gel electrophoresis qualification result.The called after pMD-18T-K99-DH5 α that the result is correct.

8, the enzyme of purpose fragment and carrier is cut: will identify that correct plasmid and pET30a cut evaluation with KpnI and BamHI enzyme, step is the same.Enzyme is cut product and is carried out purifying with PCR product purification test kit, and concrete steps are as follows:

1) agarose gel electrophoresis is analyzed the PCR product.

2) determine PCR product volume, product is transferred in the 1.5 mL centrifuge tubes, add 4～5 times of volume Buffer CP then.

3) vortex shakes thorough mixing, and brief centrifugal removal covers liquid.

4) HiBind DNA column is put into the 2mL collection tube.

5) sample in the step 3 is moved among the HiBind DNA column, in the centrifugal 1min of room temperature 1000 * g.

6) discard filtrate, HiBind DNA column is put back in the collection tube.

7) add 700 μ L DNA Wash Buffer, in the centrifugal 1min of room temperature 1000 * g.

8) abandon filtrate.Repeating step 7 adds 700 μ L DNA Wash Buffer, in the centrifugal 1min of room temperature 1000 * g.

9) the centrifugal 2min of 13000 * g.

10) HiBind DNA column is moved in the new 1.5mL centrifuge tube, central authorities add 20 μ L Elution buffer at the preparation pipe, and room temperature leaves standstill 1min.The centrifugal 1min of 13000 * g.-20 ℃ of preservations.

9, connect

Linked system is as follows:

22 ℃ connect 20min.

10, will connect product and get 10 μ L, be converted in the 100 μ L DH5 α competent cells, send order-checking with being accredited as positive plasmid pET30a-K99.

Embodiment 2

Adopting the method identical with embodiment 1, utilize P3/P4, is template with intestinal bacteria C83916 genome, amplifies 987P.Glue reclaims, and connects pMD-18T, is converted into DH5 α competent cell, identifies with double digestion through PCR and identifies, will be decided to be positive plasmid called after pMD-18T-987P-DH5 α respectively.Carry out double digestion with BamHI and the pMD-18T-987P-DH5 α of SacI and pET30a-K99, cut glue and reclaim the purpose fragment, connect then, make up pET30a-K99-987P, the performing PCR of going forward side by side, double digestion are identified.Utilizing P5/P6, is template with intestinal bacteria C83919 genome, amplifies F41.Glue reclaims, and connects pMD-18T, is converted into DH5 α competent cell, identifies with double digestion through PCR and identifies, will be decided to be positive plasmid called after pMD-18T-F41-DH5 α respectively.Carry out double digestion with SacI and the pMD-18T-F41-DH5 α of NotI and pET30a-K99-987P, cut glue and reclaim the purpose fragment, connect then, make up pET30a-K99-987P-F41, the performing PCR of going forward side by side, double digestion are identified.Three kinds of fragment PCR amplifications as shown in Figure 1.The PCR of recombinant plasmid detects as shown in Figure 2, and enzyme is cut evaluation as shown in Figure 3.Positive plasmid is served the Hai Shenggong order-checking.Positive plasmid transforms BL21 (DE3) competent cell, called after pET30a-K99-987P-F41-BL21 (DE3).

Embodiment 3

The abduction delivering of present embodiment explanation recombinant protein.

Positive recombinant expression plasmid pET30a-K99-987P-F41-BL21 (DE3) is converted into e. coli bl21 (DE3), and the single bacterium colony of picking is 37 ℃ of shaking culture in containing the LB liquid nutrient medium of Kana.Treat that the OD600 value reaches at 0.6 o'clock, adding IPTG is that 0.5mmol/L induces to final concentration.The expression vector control group is set simultaneously, and 5h gets bacterium liquid behind the abduction delivering, and the centrifugal 1min of 12000r/min preserves precipitation.The resuspended bacterial sediment of PBS, behind the ultrasonic degradation, the centrifugal 20min of 10000r/min, cleer and peaceful precipitation is carried out the SDS-PAGE electrophoresis in the collection, and the result is as shown in Figure 4.

Embodiment 4

The Western blot of present embodiment explanation recombinant protein detects.

To express respectively 5h reorganization bacterium pET30a-K99-987P-F41 protein sample with induce before protein sample carry out the SDS-PAGE electrophoresis, take out gel.Press gel size clip filter paper and pvdf membrane.Pvdf membrane soaks 15s in methanol solution after, soak 15min in the transfering buffering liquid with filter paper, gel.Carry out the protein immunoblotting reaction at half dry type electricity transfer printing instrument then, be filter paper, pvdf membrane, gel, filter paper successively from the anode to the negative electrode, whenever put one deck and all will drain bubble as far as possible, cover anode cover, the constant voltage 20V 30min that switches on, the protein in the gel will be transferred on the pvdf membrane.4 ℃ of sealings are spent the night.PBST washing 3 times, each 5min; Pvdf membrane is immersed in the natural pili K99 common pili polyclonal antibody of 1:200 dilution, 37 ℃ of 1h, PBST washing 3 times, each 5min; Then film is immersed in the anti-mouse IgG of the HRP labelled goat antibody of 1:5000 dilution 37 ℃ of 1h; Add the colour developing of DAB solution, and observations.

Target protein is transferred on the pvdf membrane after the SDS-PAGE electrophoresis, with non-reorganization common pili polyclonal antibody K99,987P and F41 and reorganization common pili polyclonal antibody K99,987P and F41 as primary antibodie.Mountain sheep anti mouse HRP IgG is anti-as two.Western blot detected result such as Fig. 5 show that they a positive band all occurs about 60KDa.The reactionless band of control group.Confirmed that recombination fusion protein K99-987p-F41 can be identified by the anti-recombinant antigen polyclone body that reaches of non-recombinant antigen polyclone simultaneously specifically.Illustrate that this fusion rotein has good immunologic competence.

Comparative Examples 1

Compare experiment with intestinal bacteria whole cell tervalence inactivated vaccine, the natural pili K99 of intestinal bacteria, 987P and F41 trivalent subunit vaccine, intestinal bacteria reorganization pili K99,987P and F41 trivalent subunit vaccine and intestinal bacteria pET30a-K99-987P-F41-BL21 (DE3) tandem expression subunit vaccine.

(1) preparation of intestinal bacteria whole cell tervalence inactivated vaccine:

Select three strain coli strains as vaccine strain, earlier according to the research of univalent vaccine program, with the 1:1:1 mixed, final concentration is 2 * 10 again ¹⁰CFU carries out according to the trivalent vaccine procedure of development.

(2) preparation of the natural pili K99 of intestinal bacteria, 987P and F41 trivalent subunit vaccine:

With natural pili K99,987P and F41 according to the pili purification liquid concentration that records by the 1:1:1 mixed.Final concentration is 50 μ g/0.1ml.

(3) preparation of intestinal bacteria reorganization pili K99,987P and F41 trivalent subunit vaccine:

With recombinant protein K99,987P and F41 according to the concentration that records by the 1:1:1 mixed, final concentration is 50 μ g/0.1ml.

(4) preparation of intestinal bacteria pET30a-K99-987P-F41-BL21 (DE3) tandem expression subunit vaccine:

According to the concentration that records, it is 50 μ g/0.1ml that concentration is adjusted into final concentration with purifying pET30a-K99-987P-F41-BL21 (DE3) albumen.

Test is divided into 5 groups, be test group one: intestinal bacteria reorganization pili K99-987P-F41 subunit vaccine, test group two: the non-reorganization pili of intestinal bacteria K99,987P and F41 trivalent subunit vaccine, three: intestinal bacteria whole cell tervalence inactivated vaccine, test four: intestinal bacteria reorganization pili K99,987P and F41 trivalent subunit vaccine, and control group: PBS.Every group of 10 mouse.

The tail vein takes blood to prepare serum before the immunity.Test group one, two and four will quantitatively be respectively 0.1mg/ml purifying protein and Freund's complete adjuvant with the 1:1 mixed, after the emulsification, with experimental group one respectively with 0.2ml/ subcutaneous injection immune mouse.One exempts from back 14d tail vein takes blood to prepare serum.Experimental group one, two and four will quantitatively be respectively 0.1mg/ml purifying protein and Freund's incomplete adjuvant with the 1:1 ratio, with test group three respectively with 0.2ml/ subcutaneous injection immune mouse.Carry out two and exempt from, 14d after the immunity second time, tail vein blood prepares serum.Carry out immunity for the third time, immunity back 14d tail vein blood prepares serum for the third time.

At immunity back 14d for the third time, experimental group one, two, three, four and control group get 10 mouse respectively and attack intestinal bacteria respectively, use mld dosage, namely the toxic agent amount of attacking of every mouse is 5.0 * 10 ⁸CFU/mL, attacking malicious position is subcutaneous injection.Observe a week continuously, infection number and the death toll of statistics mouse also calculated protection ratio.The result is as shown in table 1.

Table 1 is attacked malicious experimental result

As shown in Table 1, attack all death of poison back control group.Wherein the total protection ratio of test group protection ratio is 60%～80%; Tandem expression K99-987P-F41 subunit vaccine and whole cell deactivation vaccine protection ratio are 80%, and reorganization K99,987P and F41 pili trivalent subunit vaccine take second place, and are non-reorganization pili K99,987P and F41 trivalent subunit vaccine at last.Find that four kinds of vaccines have all obtained immunity, immune effect: intestinal bacteria whole cell tervalence inactivated vaccine〉intestinal bacteria reorganization series connection K99-987P-F41 protein subunit vaccine〉the non-reorganization pili of intestinal bacteria K99,987P and F41 trivalent subunit vaccine〉intestinal bacteria reorganization pili K99,987P, F41 trivalent subunit vaccine.Though the difference of intestinal bacteria reorganization series connection K99-987P-F41 protein subunit vaccine and intestinal bacteria whole cell tervalence inactivated vaccine is little; but because the whole cell inactivated vaccine a large amount of does not have related substance with immunogenicity because containing; effectively the content of antigen can reduce significantly; may change the antigen protein conformation after the deactivation; the vaccine protection ratio is low, and series connection K99-987P-F41 protein subunit vaccine then these problems can not occur.Simultaneously, series connection K99-987P-F41 protein subunit vaccine is through once immunity, can induce to produce multiple antibody, overcome the non-reorganization pili of intestinal bacteria K99,987P and F41 trivalent subunit vaccine and intestinal bacteria reorganization pili K99,987P, the inconvenient problem of F41 trivalent subunit vaccine preparation.Therefore, intestinal bacteria reorganization series connection K99-987P-F41 protein subunit vaccine has broad application prospects.

Claims (5)

1. K99-987P-F41 recombinant protein, its aminoacid sequence is shown in SEQ ID No.2.

2. the gene of coding claim 1 described K99-987P-F41 recombinant protein, its nucleotide sequence is shown in SEQ ID No.1.

3. the preparation method of the described K99-987P-F41 recombinant protein of claim 1, it is characterized in that: this method may further comprise the steps:

(1) enterotoxigenic escherichia coli adhesin K99, the 987P that has delivered according to GenBank, F41 gene complete sequence (accession number is respectively M35282.1, M35257.1, M21788.1) design primer, genome with intestinal bacteria C83912, intestinal bacteria C83916, intestinal bacteria C83919 is template, and PCR amplifies the purpose fragment respectively;

(2) three fragment series connection are connected into carrier pET30a, construction of expression vector pET30a-K99-987P-F41;

(3) expression vector pET30a-K99-987P-F41 is converted into competent escherichia coli cell, and the IPTG abduction delivering obtains recombinant protein.

4. preparation method according to claim 3, it is characterized in that: described primer sequence is as follows, and wherein underscore is restriction enzyme site:

P1：K99(F)：CGG GGTACCATGACTATTAACTTCAATGGCAAA（KpnI）（SEQ ID No.3）；

P2：K99(R)：CGC GGATCCTGAAGTAGTAAATACGCCAGC(BamHI)（SEQ ID No.4）；

P3：987P(F)：CGC GGATCCGGTGGTGGTGGTTCTGCTGAAAACAACACCAGCCAG(BamHI)（SEQ ID No.5）；

P4：987P(R)：C GAGCTCACTAGCAGTGACAGTACCGGC(SacI)（SEQ ID No.6）；

P5：F41(F)：C GAGCTCGGCGGTGGCGGCAGCGTATCTGGTTCAGTGATGGCT(SacI)（SEQ ID No.7）；

P6：F41(R)：AAGGAAAAAA GCGGCCGCACTGAGGTCATCCCAATTGTG(NotI)（SEQ ID No.8）。

5. the application of the described K99-987P-F41 recombinant protein of claim 1 in preparation enterotoxigenic escherichia coli vaccine.

Images