CN101121936A - Colibacillus gene engineering bacterin 987P-ST-F41 for firstborn piglet diarrhea and construction method thereof - Google Patents
Colibacillus gene engineering bacterin 987P-ST-F41 for firstborn piglet diarrhea and construction method thereof Download PDFInfo
- Publication number
- CN101121936A CN101121936A CNA2007100239807A CN200710023980A CN101121936A CN 101121936 A CN101121936 A CN 101121936A CN A2007100239807 A CNA2007100239807 A CN A2007100239807A CN 200710023980 A CN200710023980 A CN 200710023980A CN 101121936 A CN101121936 A CN 101121936A
- Authority
- CN
- China
- Prior art keywords
- gene
- fasa
- subunit gene
- sta
- fragment
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention relates to Escherichia coli genetic engineering vaccine 987P-ST-F41 for curing diarrhea of baby pigs and a constitution method, pertaining to the field of veterinary technology. The major subunit gene fasA segment of expanded 987P, the major subunit gene sta segment of ST and the major subunit gene f41 segment of F41 are linked to the pronucleus expression vector pGEX-6P-1 in series in a fasA-sta-f41 manner; after transformation of host bacteria BL21, IPTG induction expression is conducted, and proved by SDS-PAGE and Western-blot that the objective gene is expressed. The vaccine is capable to prevent diarrhea of baby pigs, and the safety and immunogenicity are reliable.
Description
Technical field
The present invention relates to the development of newborn piglet diarrhoea bacillus coli vaccine, belong to the animal and veterinary technical field.
Background technology
(Enterotoxigenic Escherichia coli, the newborn piglet that ETEC) causes diarrhoea (Neonatal diarrhea) is a kind of important transmissible disease that causes newborn piglet death to produce enterotoxigenic escherichia coli by particular serotype.Newborn piglet diarrhoea shows as sudden onset more, draws yellow watery stools, rapidly dehydration and electrolyte imbalance.The morbidity pig can be dead in several hours, and it is just dead that diarrhoea does not appear in the piglet that has.The intestinal bacteria of particular serotype are the main pathogen that causes newborn piglet diarrhoea, it mainly produces F4 (K88), F5 (K99), F6 (987P) and F41 four class adhesins, simultaneously can produce heat-stable toxin (heat-stable enterotoxin, ST) or/and heat-labile toxin (heat-labile enterotoxin, LT).In view of K88, K99,987P, F41 four class adhesins causing the newborn piglet higher dependency between colibacillary high occurrence rate and ST, LT of suffering from diarrhoea, can assert that above-mentioned six kinds of antigens are the main virulence factors that cause newborn piglet diarrhoea ETEC.
Aspect the newborn piglet diarrhoea prevention; at present; the colibacillus gene engineering bacterin that domestic prevention newborn piglet commonly used is suffered from diarrhoea is a K88-K99 divalence seedling; and the result of epidemiology survey shows that K88, K99,987P, F41, ST, LT are main virulence factor or the protective antigens that causes China newborn piglet diarrhoea ETEC at present; therefore; China to be effectively controlled by the newborn piglet diarrhoea that ETEC causes, development should be paid attention to the recombinant vaccine of above-mentioned whole 6 kinds of virulence factors.Clinically, the bacillus coli vaccine of alternative another prevention newborn piglet diarrhoea is the thalline deactivation vaccine, the thalline deactivation vaccine need add a plurality of bacterial strains, even if reach limited effect, each bacterial strain all need reach finite concentration, several bacterial strains add and certainly will cause in the vaccine bacterium total concn higher together, have side effects inevitably, and immune effect is limited.Therefore developing the recombinant vaccine that immune protective effect is good, side effect is low is trend of the times.The recombinant vaccine product of three kinds of tandem expression in the domestic and international above-mentioned six kinds of protective antigen genes of no-trump still.
Summary of the invention
The purpose of this invention is to provide a kind of recombinant vaccine 987P-ST-F41 that prevents newborn piglet diarrhoea.
The present invention is composed in series by the main subunit gene fasA fragment of 987P, the main subunit gene sta fragment of ST, main subunit gene f41 fragment and the prokaryotic expression carrier pGEX-6P-1 of F41.
Through a series of immunoprotection tests, prove the present invention for prevention newborn piglet diarrhoea, be a kind of diarrhoea of newborn piglet efficiently colibacillus gene engineering bacterin, security and immunogenicity are reliable.
Second purpose of the present invention also is to invent the construction process of a kind of said gene engineered vaccine 987P-ST-F41:
With the main subunit gene f41 fragment of the main subunit gene sta fragment of the main subunit gene fasA fragment of the 987P that amplifies, chemosynthesis ST, F41 by 987P-ST-F41 mode orienting series in prokaryotic expression carrier pGEX-6P-1.
In addition, be used to the to increase segmental primer of main subunit gene fasA of 987P is:
PA：
GGATCCGCGCCCGCTGAAAACAA
BamH I
PB：
CTGCAGCGGTGTACCTGCTGAACGAA
Pst I
Segmental two single stranded DNAs of main subunit gene sta that are used for chemosynthesis ST are:
PC：GAATAGTAGCAATTACTGCTGTGAATTGTGTTGTAATCCTGCTTGTACCG
GGTGCTATA
PD：AGCTTATAGCACCCGGTACAAGCAGGATTACAACACAATTCACAGCAGT
AATTGCTACTATTCTGCA
The segmental primer of main subunit gene f41 of F41 of being used to increase is:
PE：
AAGCTTGCTGATTGGACGGAAGGT
HindIII
PF：
CTCGAGTTAACTATAAATAACGGTGATAGTC
Xho I
The present invention is according to the gene order of disclosed fasA (987P), sta (ST), f41 (F41) subunit, and design contains the primer of special restriction enzyme site; So that suffer from diarrhoea colibacillary plasmid or genomic dna of newborn piglet is template, adopts the PCR method to amplify above-mentioned protective antigen gene fasA and f41, and chemosynthesis sta gene; The said gene orienting series in expressivity plasmid pGEX-6P-1, after transforming host bacterium BL21, is carried out the IPTG abduction delivering, and really express through SDS-PAGE and Western-blot proof goal gene; Reorganization bacterium BL21 (pFSF41) immune mouse of above-mentioned 3 kinds of protective antigen genes be will express again, its immunogenicity and security estimated.
The present invention is by the reorganization bacterium of construction expression intestinal bacteria immune protective antigen 987P, ST, F41 gene; and mouse carried out peritoneal immunity; in the mice serum of result's demonstration after the reorganization bacterial immunity; produced respectively IgG at 987P, F41 antigen-specific; the corresponding antibody level progressively raises from immunity beginning in back 7 days; reached higher level in back about 21 days in immunity for the second time; and provide better protecting to mouse attacking poison back, reached 83.3%, 100% respectively at the immune protective rate of reference culture C83710, the C83707 of 987P, F41.
Description of drawings
Fig. 1 is a structure mode chart of the present invention.
Fig. 2 is the SDS-PAGE analytical results figure of GST-FasA-STA-F41 associating expression product.
Fig. 3 is the Western-blot analytical results figure of GST-FasA-STA-F41.
Fig. 4 be behind the mouse immune in the serum at 987P antigen-specific IgG detected result line chart.
Fig. 5 be behind the mouse immune in the serum at F41 antigen-specific IgG detected result line chart.
Embodiment
One, biomaterial
1, protective antigen sequence
The gene order of the main subunit of 3 kinds of protective antigens comes among the GenBank of Internet, wherein:
1. the accession number of fasA (987P) in GenBank is M35257, and login time is 1993-4-26.
2. the accession number of sta (ST) in GenBank is M18345, and login time is 1993-4-26.
3. the accession number of f41 (F41) in GenBank is X14354, and login time is 2004-9-9.
2, expression plasmid
Expression plasmid is pGEX-6P-1, available from Amersham Pharmacia company.
3, the source of bacterial classification
The recombinant plasmid that contains protective antigen gene is expressed in the BL21 host bacteria.BL21 host bacterium also is a commercialization host bacterium, also available from Amersham Pharmacia company.
Two, building process
1, the segmental acquisition of protectiveness purpose
Design according to the gene order of these subunits among the GenBank of Internet and to contain two pairs of primers of specificity restriction enzyme site, synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd, see Table 1.
The primer of table 1 reorganization bacterium 987P-ST1-F41
| Gene | Primer | Primer sequence (5 ' end-3 ' end) | Length (bp) |
| fasA (987P) (f41) F41 | PA PB PE PF | GGATCCGCGCCCGCTGAAAACAA BamH I CTGCAGCGGTGTACCTGCTGAACGAA Pst I AAGCTTGCTGATTGGACGGAAGGT HindIII CTCGAGTTAACTATAAATAACGGTGATAGTC Xho I | 23 26 24 31 |
Segmental two single stranded DNAs of the main subunit gene sta of chemosynthesis ST are (two ends add Pst I, HindIII restriction enzyme site respectively):
PC：GAATAGTAGCAATTACTGCTGTGAATTGTGTTGTAATCCTGCTTGTACCG
GGTGCTATA
PD：AGCTTATAGCACCCGGTACAAGCAGGATTACAACACAATTCACAGCAGT
AATTGCTACTATTCTGCA
The preparation of template DNA is undertaken by full bacterium cracking process.With above-mentioned bacterium is template, react 2 target gene fragment that acquisition needs by PCR, fasA, f41 size are respectively 520bp and 700bp, sta is a synthetic, and size is 57bp, subsequently it is connected to pGEM-T easy carrier, difference called after pfasA, psta and pf41, cut evaluation and sequencing by enzyme, examining order is finished by Shanghai associating genome company, and what prove acquisition is correct fragment.
2, the structure of recombinant expression vector pFSF41 (pGEX-6P-1-fasA-sta-f41)
With restriction enzyme BamH I, Pst I fasA is downcut from carrier pfasA, restriction enzyme site conflict because of carrier pGEX-6P-1, so middle cloning vector pBlueScript-SK that introduces, carrier pBlueScript-SK is carried out enzyme with the identical enzyme system of cutting cut the purifying recovery, two kinds of enzymes are cut back to close fragment to be connected with suitable mol ratio, the transformed competence colibacillus bacillus coli DH 5 alpha through restriction analysis and evaluation, filters out the positive recombinant plasmid of pBlueScript-SK-fasA.
According to the method described above, plasmid psta and pBlueScript-SK-fasA enzyme are cut, reclaim endonuclease bamhi respectively, connect conversion, filter out the positive recombinant plasmid of pBlueScript-SK-fasA-sta with restriction enzyme Pst I, Hind III.
According to the method described above, with restriction enzyme Hind III, Xho I plasmid pf41 and pBlueScript-SK-fasA-sta enzyme are cut, reclaim endonuclease bamhi respectively, connect conversion, the positive recombinant plasmid of screening pBlueScript-SK-fasA-sta-f41 (pFSF41).
With restriction enzyme BamH I, Xho I the fasA-sta-f41 fragment of connecting is downcut from positive recombinant plasmid pFSF41, plasmid vector pGEX-6P-1 is carried out enzyme with the identical enzyme system of cutting cut the purifying recovery, two kinds of enzymes are cut back to close fragment to be connected with 3: 1 mol ratios, the transformed competence colibacillus e. coli bl21, through restriction analysis and evaluation, filter out the positive recombinant plasmid of pGEX-6P-1-fasA-sta-f41, the name of reorganization bacterium BL21 (pFSF41), i.e. the gene engineering vaccine 987P-ST-F41 that contain this plasmid.
The construction of recombinant expression plasmid pattern is seen Fig. 1.
Three, the SDS-PAGE of gene engineering vaccine 987P-ST-F41 expression product, Western-blot identify
Enzyme carries out the IPTG abduction delivering after cutting and identifying that correct recombinant plasmid pFSF41 transforms host bacterium BL21, and proves that through SDS-PAGE (seeing Fig. 2 for details) and Western-blot (seeing Fig. 3 for details) goal gene really expresses.Recombinant plasmid pFSF41 transformed bacteria a specific proteins band occurs at about 78kD place after IPTG induces, consistent with the fusion rotein size of expection.
Among Fig. 2:
1, protein molecular weight standard
2, the fusion protein expression products of pFSF41 recombinant plasmid transformed bacterium after 0.6mmol/L IPTG induces
3, the fusion protein expression products of pFSF41 recombinant plasmid transformed bacterium after 1.0mmol/L IPTG induces
4, the expression product of pGEX-6P-1 plasmid transformed bacteria GST after IPTG induces
5, without inductive pFSF41 recombinant plasmid transformed bacterium.
Among Fig. 3:
1, protein molecular weight standard
2, sample is the reorganization split product of bacterium 987P-ST-F41 after IPTG induces, and one anti-ly is the ascites monoclonal antibody of 987P pili
3, sample is the reorganization split product of bacterium 987P-ST-F41 after IPTG induces, and one anti-ly is the polyvalent antibody of F41 pili.
Four, the immune effect of gene engineering vaccine 987P-ST-F41
The present invention is by construction expression intestinal bacteria immune protective antigen 987P; ST; the reorganization bacterium BL21 (pFSF41) of F41 gene; be prepared into oil emulsion vaccine respectively mouse is carried out peritoneal immunity; in the mice serum of result's demonstration after the reorganization bacterial immunity; produced respectively at 987P; the IgG of F41 antigen-specific; the corresponding antibody level progressively raises from immunity beginning in back 7 days; reached higher level in back about 21 days in immunity for the second time; illustrating that the reorganization bacterium can be induced simultaneously produces high-caliber antibody at two kinds of pili protective antigens; and after attacking poison, provide better protecting, at 987P to mouse; the reference culture C83710 of F41; the immune protective rate of C83707 reaches 83.3% respectively; 100%.
Its grouping situation and immune effect to the mouse immune protection test sees table 2 for details.
See Table 3 and Fig. 4 at 987P antibody changing conditions; See Table 4 and Fig. 5 at F41 antibody changing conditions.
Table 2 gene engineering vaccine 987P-ST-F41 immunity test grouping situation and immunoprotection result
| Group | Immunization route | Immunizing dose (CFU/ only) | The immunity age in days | Attack malicious material | Attack toxic agent amount (CFU/ only) | Attack malicious age in | Protection ratio | |
| 1 2 3 4 5 6 7 | 987P-ST-F41 deactivation vaccine immune group 987P-ST-F41 deactivation vaccine immune group 6P-1 deactivation vaccine group 6P-1 deactivation vaccine group C83710 deactivation vaccine immune group C83707 deactivation vaccine immune group |
1×10 9 1×10 9 1×10 9 1×10 9 4×10 8 4×10 8 / / | 35，49 35，49 35，49 35，49 35，49 35，49 / / | C83710 bacterium C83707 bacterium C83710 bacterium C83707 bacterium C83710 bacterium C83707 bacterium C83710 |
4×10 8 4×10 8 4×10 8 4×10 8 4×10 8 4×10 8 4×10 8 4×10 8 | 63 63 63 63 63 63 63 63 | 83.3％ (5/6) 100％ (6/6) 16.7％ (1/6) 16.7％ (1/6) 100％ (6/6) 100％ (6/6) 0 0 |
Immune protective rate=(attacking malicious control group mortality ratio-vaccine immunity group mortality ratio)/attack malicious control group mortality ratio * 100%
Behind the table 3 mouse immune gene engineering vaccine 987P-ST-F41 in the serum at 987P antigen-specific IgG detected result
| Test group | The mouse number of elements | Behind the mouse immune in the serum at 987P antigen-specific IgG detected value | ||||
| Before the immunity | One exempted from back 7 days | One exempted from back 14 days | Two exempted from back 7 days | Two exempted from back 14 days | ||
| The non-immune control group of 987P-ST-F41 deactivation vaccine immune group C83710 bacterium deactivation vaccine immune group | 6 6 6 | 0.037± 0.019 a 0.047± 0.010 a 0.084± 0.739 b | 0.221±0.084 a 0.392±0.169 b 0.123±0.050 c | 0.293±0.121 a 0.982±0.464 b 0.084±0.074 a | 1.215±0.161 a 1.143±0.393 a 0.331±0.215 b | 1.157±0.101 a 1.356±0.085 a 0.366±0.241 b |
IgG antibody detected value=average antibody detected value ± standard deviation, a, b, c have significant difference (P＜0.05); Test of significance is different vaccine immunity groups and the comparison between the antibody horizontal in the identical moment serum after immunity of normal healthy controls group mouse.
Behind the table 4 mouse immune gene engineering vaccine 987P-ST-F41 in the serum at F41 antigen-specific IgG detected result
| Test group | The mouse number of elements | Behind the mouse immune in the serum at F41 antigen-specific IgG detected value | ||||
| Before the immunity | One exempted from back 7 days | One exempted from back 14 days | Two exempted from back 7 days | Two exempted from back 14 days | ||
| The non-immune control group of 987P-ST-F41 deactivation vaccine immune group C83707 bacterium deactivation vaccine immune group | 6 6 6 | 0.037± 0.019 a 0.047± 0.017 a 0.050± 0.074 b | 0.172±0.065 a 0.539±0.386 b 0.123±0.125 a | 0.179±0.075 a 0.849±0.357 b 0.053±0.015 a | 1.183±0.200 a 1.359±0.068 b 0.186±0.123 c | 1.027±0.206 a 1.327±0.026 a 0.168±0.040 b |
Above-mentioned data have illustrated intuitively that the reorganization bacterium that the present invention relates to can be induced simultaneously and have produced high-caliber antibody at two kinds of protective antigens, provide better protecting to mouse attacking the poison back.
The present invention clone and expression cause newborn piglet diarrhoea intestinal bacteria immune protective antigen 987P, ST, F41 gene, thereby develop corresponding recombinant vaccine 987P-ST-F41.Through a series of immunoprotection tests, prove the high efficiency of the colibacillus gene engineering bacterin of the prevention newborn piglet diarrhoea of developing.
＜110〉Yangzhou University
＜120〉the colibacillus gene engineering bacterin 987P-ST-F41 and the construction process thereof of newborn piglet dysentery
<160>6
<210>1
<211>23
<212>DNA
＜213〉artificial sequence
<220>
＜223〉the main subunit gene fasA fragment according to 987P designs
<400>1
ggatccgcgc ccgctgaaaa caa
<210>2
<211>26
<212>DNA
＜213〉artificial sequence
<220>
＜223〉the main subunit gene fasA fragment according to 987P designs
<400>2
ctgcagcggt gtacctgctg aacgaa
<210>3
<211>59
<212>DNA
＜213〉artificial sequence
<220>
＜223〉the main subunit gene sta fragment according to chemosynthesis ST designs
<400>3
gaatagtagc aattactgct gtgaattgtg ttgtaatcct gcttgtaccg ggtgctata
<210>4
<211>67
<212>DNA
＜213〉artificial sequence
<220>
＜223〉the main subunit gene sta fragment according to chemosynthesis ST designs
<400>4
agcttatagc acccggtaca agcaggatta caacacaatt cacagcagta attgctacta ttctgca
<210>5
<211>24
<212>DNA
＜213〉artificial sequence
<220>
＜223〉the main subunit gene f41 fragment according to F41 designs
<400>5
aagcttgctg attggacgga aggt
<210>6
<211>31
<212>DNA
＜213〉artificial sequence
<220>
＜223〉the main subunit gene f41 fragment according to F41 designs
<400>6
ctcgagttaa ctataaataa cggtgatagt c
Claims (5)
1. the colibacillus gene engineering bacterin 987P-ST-F41 of newborn piglet diarrhoea is characterized in that being composed in series by the main subunit gene fasA fragment of 987P, the main subunit gene sta fragment of ST, main subunit gene f41 fragment and the prokaryotic expression carrier pGEX-6P-1 of F41.
2. construction process of the colibacillus gene engineering bacterin 987P-ST-F41 of newborn piglet diarrhoea according to claim 1, the main subunit gene f41 fragment of main subunit gene sta fragment, F41 that it is characterized in that main subunit gene fasA fragment, the chemosynthesis ST of the 987P that will amplify by fasA-sta-f41 mode orienting series in prokaryotic expression carrier pGEX-6P-1.
3. according to the construction process of the colibacillus gene engineering bacterin 987P-ST-F41 of the described newborn piglet of claim 2 diarrhoea, the segmental primer of main subunit gene fasA of the 987P that it is characterized in that being used to increasing is:
PA：
GGATCCGCGCCCGCTGAAAACAA
BamH I
PB：
CTGCAGCGGTGTACCTGCTGAACGAA
Pst I
4. according to the construction process of the colibacillus gene engineering bacterin 987P-ST-F41 of the described newborn piglet of claim 2 diarrhoea, it is characterized in that segmental two single stranded DNAs of main subunit gene sta that are used for chemosynthesis ST are:
PC：GAATAGTAGCAATTACTGCTGTGAATTGTGTTGTAATCCTGCTTGTACCG
GGTGCTATA
PD：AGCTTATAGCACCCGGTACAAGCAGGATTACAACACAATTCACAGCAGT
AATTGCTACTATTCTGCA
5. according to the construction process of the colibacillus gene engineering bacterin 987P-ST-F41 of the described newborn piglet of claim 2 diarrhoea, the segmental primer of main subunit gene f41 of the F41 that it is characterized in that being used to increasing is:
PE：
AAGCTTGCTGATTGGACGGAAGGT
HindIII
PF：
CTCGAGTTAACTATAAATAACGGTGATAGTC
Xho I
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007100239807A CN101121936B (en) | 2007-07-02 | 2007-07-02 | Colibacillus gene engineering bacterin 987P-ST-F41 for firstborn piglet diarrhea |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007100239807A CN101121936B (en) | 2007-07-02 | 2007-07-02 | Colibacillus gene engineering bacterin 987P-ST-F41 for firstborn piglet diarrhea |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101121936A true CN101121936A (en) | 2008-02-13 |
| CN101121936B CN101121936B (en) | 2011-06-08 |
Family
ID=39084434
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2007100239807A Expired - Fee Related CN101121936B (en) | 2007-07-02 | 2007-07-02 | Colibacillus gene engineering bacterin 987P-ST-F41 for firstborn piglet diarrhea |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101121936B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103275228A (en) * | 2013-06-05 | 2013-09-04 | 黑龙江八一农垦大学 | K99-987P-F41 recombinant protein and application thereof |
| CN109293753A (en) * | 2018-09-29 | 2019-02-01 | 赛法特（长沙）生物技术有限公司 | A kind of enterotoxigenicEscherichia coli tetravalence dynein immunogene and preparation method thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1683018A (en) * | 2005-03-15 | 2005-10-19 | 扬州大学 | Gene engineering vaccine for weaning pigling diarrhea and pig hydrops disease |
-
2007
- 2007-07-02 CN CN2007100239807A patent/CN101121936B/en not_active Expired - Fee Related
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103275228A (en) * | 2013-06-05 | 2013-09-04 | 黑龙江八一农垦大学 | K99-987P-F41 recombinant protein and application thereof |
| CN109293753A (en) * | 2018-09-29 | 2019-02-01 | 赛法特（长沙）生物技术有限公司 | A kind of enterotoxigenicEscherichia coli tetravalence dynein immunogene and preparation method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101121936B (en) | 2011-06-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101121937B (en) | Colibacillus gene engineering bacterin K88-K99-LT for firstborn piglet diarrhea | |
| Judge et al. | Plant cell-based intimin vaccine given orally to mice primed with intimin reduces time of Escherichia coli O157: H7 shedding in feces | |
| CN107432930B (en) | Group I4 avian adenovirus DNA vaccine and preparation method and application thereof | |
| CN102281895A (en) | A vaccine for porcine post-weaning diarrhea caused by enterotoxigenic escherichia coli | |
| Hunter et al. | Evaluation of a toxoid fusion protein vaccine produced in plants to protect poultry against necrotic enteritis | |
| CN101092605A (en) | Mutant strain of Brucella bacterin with weak poison, constructing method, and application | |
| CN113943714A (en) | Cat calicivirus strain and application thereof | |
| CN101121936B (en) | Colibacillus gene engineering bacterin 987P-ST-F41 for firstborn piglet diarrhea | |
| Egelkrout et al. | Oral delivery of maize-produced porcine epidemic diarrhea virus spike protein elicits neutralizing antibodies in pigs | |
| CN103275228A (en) | K99-987P-F41 recombinant protein and application thereof | |
| CN101914564B (en) | Fusion of multiple enterotoxin genes of escherichia coli and application thereof | |
| Singh et al. | Molecular detection and cloning of thermostable hemolysin gene from Aeromonas hydrophila | |
| CN105734001A (en) | O antigen carbohydrate chain elongation salmonella paratyphi A and use thereof | |
| Bhatia et al. | B-cell epitope of beta toxin of Clostridium perfringens genetically conjugated to a carrier protein: expression, purification and characterization of the chimeric protein | |
| Mostaan et al. | In silico analysis of Pasteurella multocida PlpE protein epitopes as novel subunit vaccine candidates | |
| CN107974458A (en) | Express gene gapdh and its recombination bacillus coli and the application of bacillus rhusiopathiae suis recombinant protein GAPDH | |
| CN1683018A (en) | Gene engineering vaccine for weaning pigling diarrhea and pig hydrops disease | |
| CN101386831B (en) | Recombinant bacterium of brucella abortus with immunity labeling and use thereof | |
| CN107625960B (en) | Universal swine colibacillosis vaccine and preparation method thereof | |
| CN111840543B (en) | Porcine epidemic diarrhea virus attenuated vaccine mucosal immunopotentiator, preparation process and application thereof | |
| You et al. | Chicken egg yolk immunoglobulin (IgY) developed against fusion protein LTB–STa–STb neutralizes the toxicity of Escherichia coli heat‐stable enterotoxins | |
| CN104946615A (en) | Preparation and application of tilapia-derived Streptococcus agalactiae recombinant GPI (glycosyl phosphatidyl inositol) protein vaccine | |
| Benčina et al. | Isolation of Mycoplasma capricolum-like strains from chickens | |
| Vemulapalli et al. | Cloning and molecular analysis of genes encoding two immunodominant antigensofEhrlichia risticii | |
| CN107988130A (en) | Stablize lactic acid bacteria genetic engineering subunit vaccine strain of expression porcine rotavirus VP4 albumen and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20110608 Termination date: 20140702 |
|
| EXPY | Termination of patent right or utility model |