CN101979501A

CN101979501A - Recombinant Salmonella choleraesuis for expressing surface antigen gene sao of streptococcus suis type 2, vaccine and application

Info

Publication number: CN101979501A
Application number: CN 201010286731
Authority: CN
Inventors: 金梅林; 石建; 陈焕春; 黄灿辉; 康超; 郭爱珍; 徐高原; 吴斌
Original assignee: WUHAN KEQIAN ANIMAL BIOLOGICAL PRODUCTS CO Ltd; Huazhong Agricultural University
Current assignee: WUHAN KEQIAN BIOLOGICAL CO., LTD.; Huazhong Agricultural University
Priority date: 2010-09-17
Filing date: 2010-09-17
Publication date: 2011-02-23
Anticipated expiration: 2030-09-17
Also published as: CN101979501B

Abstract

The invention belongs to the field of animal bacterium gene engineering, and in particular relates to construction of resistance marker-free recombinant Salmonella choleraesuis for expressing surface antigen sao gene segment of streptococcus suis type 2, preparation of a vaccine and application. The resistance marker-free recombinant Salmonella choleraesuis for expressing the surface antigen sao gene segment of the streptococcus suis type 2, namely asd-C500/Pya-saoA is obtained, and the collection number is CCTCC NO: M2010156. The asd gene of the Salmonella choleraesuis is deleted in the recombinant strain, and the recombinant strain contains plasmid pYA-saoA capable of expressing the asd and the sao gene segment of the streptococcus suis type 2. The invention also discloses a method for preparing the recombinant strain and the vaccine, and application in preparing Salmonella choleraesuis-streptococcus suis type 2 vaccines.

Description

Express recombinant salmonella choleraesuis and vaccine and the application of streptococcus suis 2-type surface antigen gene sao

Technical field

The invention belongs to animal bacteria genetically engineered field, be specifically related to a kind of structure, vaccine production and application that does not contain the segmental recombinant salmonella choleraesuis bacterial strain of expression streptococcus suis 2-type surface antigen gene sao of resistance marker.

Background technology

(Streptococcus suis is a kind of important cause of disease that endangers pig industry now S.suis) to swine streptococcus, is the The main pathogenic fungi that causes Streptococcus suis at present.Also sick concurrent or secondary infection cause of disease such as Chang Zuowei swine fever, pig blue-ear disease, pig circular ring virus 2 viral disease, eperythrozoon suis, porcine contagious pleuropneumonia, the development of China and even world's pig industry in serious harm.Wherein streptococcus suis 2-type (Streptococcus suis serotype 2, SS2) pathogenic strong, popular wide, also be the highest serotype of clinical in recent years cross frequence.Streptococcus suis 2-type can cause meningitis and septicemia etc., and the people also can infect this bacterium by specific approach, is a kind of important infecting both domestic animals and human cause of disease bacterium.Vaccine immunity is this disease of control one of efficient strategy the most, though inactivated vaccine can be controlled the infection of homologous strain effectively, but owing to there are problems such as immune efficacy is low, side reaction is big, therefore, be badly in need of the swine streptococcus vaccine of development of new, the engineering carrier vaccine is considered to control at present one of this sick available strategy.

Along with the Protocols in Molecular Biology development, people begin to pay close attention to the use attenuation salmonella as this research field of the various exogenous antigens of vector expression.The using gene engineering method makes up the Salmonellas attenuated strain and utilizes attenuation salmonella to express the research focus that exogenous antigen development polyvalent vaccine etc. has become this field as live vector.Attenuation salmonella has many advantages as vaccine carrier: what (1) produced cytotoxic T cell kills and wounds reaction (ctl response); (2) attenuation salmonella can more effectively excite host's body fluid and cellular immunization because of invading lymphsystem; (3) by natural infection approach such as oral or intranasal vaccination, can activating system and mucosal immunoreaction; (4) has immunoadjuvant function; (5) immunity has persistence; (6) have the combined immunization effect, can stably express protokaryon and eukaryotic gene, itself is not pathogenic, and as antityphoid vaccine; (7) expressed target antigen need not purified, and preparation simply can be directly used in the immunoprotection test, has significantly reduced the cost of manufacture of vaccine; (8) inoculation is simple and convenient, (Curtiss such as easy handling, R etc., 1996, Strategies for the use of live recombinant avirulent bacterial vaccines for mucosal immunization, p.499-511, In H.Kiyono and M.F.Kagnoff (ed.), Essentials of mucosal immunology, Academic Press, San Diego etc., 2006.Rational design of Salmonella-based vaccination strategies.Methods 38:133-143; Sirard J etc., 1999.Live attenuated Salmonella:a paradigm of mucosal vaccines.Immunol.Rev.171:5-26).

Nowadays, people have developed the multiple salmonella vaccine system that does not contain the antibiotics resistance mark, as with the exogenous antigen stable integration to Salmonellas karyomit(e), or with not needing antibiotic plasmid equilibrium system (Balanced-lethal Plasmid Stabilisation System).Wherein, using maximum systems is asd plasmid vector balanced lethal system.The asd genes encoding aspartic acid beta galactose desaturase (aspartate L-semialdehyde dehydrogenase) of Salmonellas, be diaminopimelic acid (diaminopimelic acid, DAP) indispensable enzyme in the biosynthetic pathway, and DAP is a component of gram-negative bacteria cell wall main chemical compositions peptidoglycan tetrapeptide side chain, the strain of asd disappearance can not form intact cell walls under no external source DAP condition, final bacteriolyze death.Do not contain DAP in the mammalian tissues, so mutant bacteria is degraded all in the substratum that does not contain DAP or in the animal body.Goal gene is inserted the plasmid that contains asd, transform asd ^-Can form complementation behind the host bacterium, the asd of asd plasmid loss ^-Salmonellas is dead in vivo, and the Salmonellas that only contains the asd plasmid could survive, and the stable exogenous antigen of vivoexpression in vivo.Owing to replaced the antibiotics resistance mark with asd plasmid vector balanced lethal system, therefore also safer (Nakayama, K etc., 1988.Construction of an Asd ⁺Expression-cloning vector:stable maintenance and high level expression of cloned genes in a Salmonella vaccine strain.Bio/Technology 6:693-697; Kang, H etc., 2002, Immune responses to recombinant pneumococcal PspA antigen delivered by live attenuaed Salmonella enterica serovar Typhimurium vaccine.Infect.Immun., 70:1739-1749).

China is at the beginning of the sixties, after the Salmonella choleraesuls virulent strain that Fang Xiaowen etc. are good with antigenicity is inoculated and is passed hundreds of generations in the substratum that contains thaliium acetate, select the good low virulent strain of a strain immunogenicity, be named as C500 (Fang Xiaowen etc., the research of the weak toadstool seedling of necrotic enteritis, journal of animal science and veterinary medicine, 1981 (2): 29～36).The C500 bacterial strain is promoted the use of in the whole nation, makes China's necrotic enteritis be effectively controlled (Huang ChangBing etc., the weak malicious aerated culture freeze-dried vaccine oral immunity research of necrotic enteritis, Scientia Agricultura Sinica, 1981 (6): 89～94; Kang Kai, living paratyphoid vaccine for piglets, Chinese veterinary drug magazine, 2003 (37) 37-49).Based on the good immunogenicity of C500, the asd plasmid vector balanced lethal system of utilization Protocols in Molecular Biology structure C500 is used to the research of multiple swine disease engineering carrier vaccine, potentiality (the Zhao Zhanqin etc. that shown the application that this cover system vaccine is huge, the biological characteristics of Salmonella choleraesuls AasdC500 strain and as the application of living vaccine expression vector, the biotechnology journal, 2009,25 (1): 29-36).

Asd plasmid vector balanced lethal system has the expression amount height, advantages such as purifying, antibiotic-free resistance marker are stablized, do not needed to exogenous gene expression; in view of the good immunogenicity of Salmonella choleraesuls C500, it is developed as the live recombined vaccines of expressing the streptococcus suis 2-type protective antigen gene has application promise in clinical practice simultaneously.

Summary of the invention

First purpose of the present invention is to overcome the prior art defective, obtains the recombinant salmonella choleraesuis strain of the good expression streptococcus suis 2-type sao gene fragment of the excellent and security of a kind of immunogenicity.

Second purpose of the present invention is to utilize the recombinant salmonella choleraesuis strain of expressing streptococcus suis 2-type sao gene fragment to prepare Salmonella choleraesuls-streptococcus suis 2-type bigeminy recombinant vaccine.

The 3rd purpose of the present invention is to express the application of recombinant salmonella choleraesuis strain in preparation Salmonella choleraesuls-streptococcus suis 2-type bigeminy recombinant vaccine of streptococcus suis 2-type sao gene fragment.

The present invention is achieved through the following technical solutions:

A kind of recombinant salmonella choleraesuis strain that does not contain the expression streptococcus suis 2-type sao gene fragment of resistance marker, its classification called after Salmonella choleraesuls (Salmonella choleraesuis) asd ^-C500/Pya-saoA, on June 24th, 2010 was deposited in the Chinese typical culture collection center (CCTCC) in the Wuhan University of Wuhan City, Hubei Province, and its deposit number is CCTCC NO:M2010156.

1. express the recombinant salmonella choleraesuis strain asd of streptococcus suis 2-type sao gene fragment ^-The construction step of C500/pYA-saoA

Recombinant salmonella choleraesuis strain asd ^-The constructing technology route of C500/pYA-saoA is seen Fig. 1.Its step is as follows:

1) the asd gene-deleted strain asd of structure salmonella choleraesuis strain C500 ^-C500.

2) clone of streptococcus suis 2-type surface antigen gene sao: with streptococcus suis 2-type (Streptococcus suis2, SS2) genome is a template, obtain the part fragment of streptococcus suis 2-type surface antigen gene sao by the PCR method amplification, called after saoA, primer sequence is seen embodiment 2, the amplified fragments nucleotide sequence is shown in SEQ ID NO:1, and its aminoacid sequence is shown in SEQ ID NO:2.

3) structure of prokaryotic expression plasmid pYA-saoA: with step 2) obtain saoA and insert prokaryotic expression carrier pYA3493 (asd+, pBRori, β-lactamace signal sequence, the Dr.Roy Curtiss III of Washington, DC university is so kind as to give) BamH I and Pst I site between, make up and to obtain expression plasmid pYA-saoA.

4) recombinant bacterial strain asd ^-C500/pYA-saoA obtains: the expression plasmid pYA-saoA electricity of step 3) is transformed Salmonella choleraesuls asd ^-The C500 competent cell screens single recombinant salmonella, the PCR method screening positive clone with the LB substratum of antibiotic-free.

2. recombinant salmonella choleraesuis strain asd ^-The vaccine production of C500/pYA-saoA

With recombinant bacterial strain asd of the present invention ^-C500/pYA-saoA cultivates on the LB solid medium, and picking list bacterium colony is cultivated in the LB liquid nutrient medium, reaches 1 * 10 up to viable bacteria concentration ¹⁰CFU/mL.In bacterium liquid: gelatin protective material (volume: be that 7: 1 ratio adds the gelatin protective material (this gelatin protective material compound method is: in every 100mL deionized water with sucrose 40g volume); gelatin 8g; after fully melting; preservation is standby after putting 121 ℃ of 30min that sterilize down); in sterilization freeze-drying bottle, press the packing of 2.0mL/ bottle; put freeze-drying in-50 ℃ of freeze driers; freeze-drying 36-40h rear pressing cover; with 10% aluminium glue physiology salt dissolving and carry out live bacterial count (CFU); and determine there is not living contaminants; it is standby to put-20 ℃ of preservations, as the vaccine strains of development recombiant vaccine.

The recombinant salmonella choleraesuis strain asd of above-mentioned expression streptococcus suis 2-type sao gene fragment ^-C500/pYA-saoA can be used for researching and developing novel animal genetic engineering living vaccine.

Major advantage of the present invention is:

1. the streptococcus suis 2-type surface antigen gene sao of the genetic engineering recombination strain expression of the present invention's preparation is the important immunogenic gene fragment of streptococcus suis 2-type, not only has good immune protection, and in all conservative existence of each serotype kind.Swine streptococcus (Streptococcus suis) is a kind of important cause of disease that endangers pig industry now, is the The main pathogenic fungi that causes Streptococcus suis at present.Also sick concurrent or secondary infection cause of disease such as Chang Zuowei swine fever, pig blue-ear disease, pig circular ring virus 2 viral disease, eperythrozoon suis, porcine contagious pleuropneumonia, the development of China and even world's pig industry in serious harm.Therefore, the vaccine made from engineering strain of the present invention has wide market application prospect.

2. the engineering strain of the present invention's preparation is derived from China and has used commercialization Salmonella choleraesuls attenuated vaccine strain C500 for many years, has kept the immune efficacy of C500 at Salmonella choleraesuls fully.And, engineering strain virulence of the present invention than C500 slightly a little less than, thereby have better biological safety.

3. the engineering strain non-resistant mark of the present invention's preparation meets the requirement of vaccine biological safety fully.

Description of drawings

Fig. 1: be the technological line figure that recombinant bacterial strain of the present invention makes up.

Fig. 2: the signal collection of illustrative plates that is the transferring plasmid pREasd12 for preparing of the present invention.

Fig. 3: the enzyme that is the transferring plasmid pREasd12 for preparing of the present invention is cut qualification result.Swimming lane M is the dna molecular marker of 15000bp, and swimming lane 1 is cut product for pREasd12 through Xba I+Kpn I enzyme.

Fig. 4: be the Salmonella choleraesuls asd that the present invention prepares ^-The PCR of C500 detects electrophoretogram.Swimming lane M1 is the dna molecular marker of 2000bp, and swimming lane M2 is the dna molecular marker of 15000bp, and swimming lane 1-7 is the disappearance strain asd of screening ^-C500, swimming lane 8-12 is parent strain C500 contrast, and swimming lane 13 is the contrast of pREasd12 plasmid, and swimming lane 14 is H ₂The O contrast.

Fig. 5: be the report that uses of the present invention gene order accession number and (what be shown as underscore in the bracket is the accession number of described antigen gene sequences at Genebank in residing position in suis 05ZYH33, thereafter the numeral behind the colon is the position of gene order shown in this accession number in swine streptococcus 05ZYH33 genome, and the overstriking italics that shows behind this position is the bacterial strain number of described swine streptococcus).

Fig. 6: be the segmental pcr amplification figure of streptococcus suis 2-type surface antigen gene saoA of the present invention.Swimming lane 1 is the dna molecular marker of 2000bp, swimming lane 2 negative contrasts, and swimming lane 3 is the goal gene saoA of amplification.

Fig. 7: be the cloning vector pMD18-T plasmid map that the present invention uses.

Fig. 8: be the expression vector pYA3493 plasmid map that the present invention uses.

Fig. 9: be that the pYA-saoA double digestion that the present invention makes up is identified collection of illustrative plates.Swimming lane 1 is the dna molecular marker of 15000bp, and swimming lane 2 is the plasmid enzyme restriction product.

Figure 10: the PCR that is recombinant bacterial strain of the present invention identifies collection of illustrative plates.Swimming lane 1 is the dna molecular marker of 2000bp, and swimming lane 2 is asd ^-C500/pYA3493 strain PCR product, swimming lane 3 is reorganization bacterium asd ^-The PCR product of C500/pYA-saoA.

Figure 11: the SDS-PAGE collection of illustrative plates that is recombinant bacterial strain of the present invention.Swimming lane 1 is molecular weight of albumen marker, and swimming lane 2 is reorganization bacterium asd ^-The split product of C500/pYA-saoA, swimming lane 3 is asd ^-The split product of C500/pYA3493.

Figure 12: be that the recombinate Western-blot of bacterium of the present invention analyzes collection of illustrative plates.Swimming lane 1 is molecular weight of albumen marker, and swimming lane 2 is asd ^-The nutrient solution supernatant of C500/pYA3493, swimming lane 3 is reorganization bacterium asd ^-C500/pYA-saoA nutrient solution supernatant.

Figure 13: be the recombinate genetic stability pcr analysis collection of illustrative plates of bacterium of the present invention.Swimming lane 1 is the dna molecular marker of 2000bp, and swimming lane 2-7 is reorganization bacterium asd ^-The PCR product in C500/pYA-saoA original generation, 10 generations, 20 generations, 30 generations, 40 generations, 50 generations.

Figure 14: be reorganization bacterial immunity mouse inductive rSaoA antibody horizontal synoptic diagram of the present invention.

Embodiment

Embodiment 1 Salmonella choleraesuls asd genetically deficient bacterial strain asd ^-The structure of C500

1. design of primers

With reference to Salmonella typhimurium LT2 strain asd gene order (GenBank No:AE008863) design 2 couples of primers (pa1/pa2 and pa3/pa4 of having reported, see Table 1, asd gene upstream and downstream fragment asd1 and asd2 increase respectively from Salmonella choleraesuls attenuated vaccine strain C500 (available from China Veterinery Drug Inspection Office) genome, the amplified fragments size is respectively 2112bp and 2069bp, the upper arm two ends are introduced Xba I and BamHI restriction enzyme site respectively, and the underarm two ends are introduced BamHI and Kpn I restriction enzyme site respectively.Other designs 1 pair of primer (pa5/pa6 sees Table 1) and carries out the evaluation of C500 parent strain and asd deletion mycopremna.Primer is given birth to worker's biotechnology company limited by Shanghai and is synthesized.

Table 1:PCR primer

2.asd the clone of gene upstream and downstream fragment asd1 (upper arm) and asd2 (underarm)

Freeze dried Salmonella choleraesuls C500 is rule on the LB solid plate, cultivate 16h for 37 ℃.Picking list colony inoculation is in the LB liquid nutrient medium, and 37 ℃, 200r/min jolting are cultivated 16h.Extracting test kit (available from Beijing TIANGEN company) specification sheets extraction genome by bacterial genomes is pcr template.

Asd1 and asd2 amplified reaction all carry out in the system of 25 μ L, and reaction system (the PCR related reagent is all available from precious biotechnology Dalian company limited) is as follows: template DNA 1 μ L, 10 * PCR damping fluid, 2.5 μ L, 25mmol/L MgCl ₂2 μ L, each 1 μ L of 10 μ mol/L upstream and downstream primers, 2mmol/L dNTPs 1 μ L, 2U/ μ L Taqase 0.5 μ L, distilled water 16 μ L.

Asd1 and asd2 amplification condition are: enter circulation behind 95 ℃ of sex change 5min, loop parameter is 94 ℃ of 1min, 57 ℃ of 1min, 72 ℃ of 2.5min.After 30 circulations, 72 ℃ are extended 10min.Amplification PCR products is through 0.8% agarose gel electrophoresis analysis, and 2 clip size that increase and expection sizableness are respectively 2112bp and 2069bp.The goal gene that obtains is cloned into pMD18-T carrier (available from company of the precious biotechnology in Dalian company limited).

3.pREasd12 the structure of transferring plasmid

With XbaI and BamHI double digestion asd1 and pBluescriptSK (+) carrier (available from U.S. Stratagene company), connect with T4 DNA ligase (available from precious biotechnology Dalian company limited) after reclaiming purifying, 16 ℃ of water-bath 12h, transform DH5a competence bacterium (available from precious biotechnology Dalian company limited), 37 ℃ at solid LB substratum (10g Tryptones, the 5g yeast extract, 5g sodium-chlor, the 15g agar powder, adding distil water is settled to 1000mL, at 121 ℃ of high pressure steam sterilization 25min) cultivation 12h, choose bacterium to liquid LB substratum (10g Tryptones, the 5g yeast extract, 5g sodium-chlor, adding distil water is settled to 1000mL, 121 ℃ of high pressure steam sterilization 25min), in 37 ℃, 225r/min jolting cultivation 12h uses plasmid extraction kit (available from Beijing TIANGEN company) thereby preparing plasmid in a small amount obtains plasmid pSKasd1.Use BamHI and KpnI double digestion asd2 and plasmid pSKasd1 again.Connect with T4 DNA ligase after reclaiming, transformed into escherichia coli DH5 α competence bacterium is cultivated 12h for 37 ℃, chooses bacterium to liquid LB substratum, and 37 ℃, 225r/min jolting cultivation 12h obtain plasmid pSKasd12 thereby prepare plasmid in a small amount.(be so kind as to give with XbaI and KpnI double digestion transferring plasmid pSKasd12 and suicide plasmid pRE112 by Dr.Roy Curtiss professor III of Washington, DC university; Miller, V.L., Mekalanos J.J.1988.A novel suicide vector and its use in construction on insertion mutations:osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR.J.Bacteriol.170:2575-2583), reclaim asd1+asd2 fragment and plasmid pRE112, connect with T4DNA ligase, 16 ℃ of water-bath 12h, the electricity conversion (Huang Peitang etc. translate. Sa nurse Brooker J, Russell D W work. molecular cloning experiment guide (third edition). Beijing: Science Press, 2002) intestinal bacteria χ 7213 (is so kind as to give by Dr.Roy Curtiss professor III of Washington, DC university; Edwards, R.A., L.H.Keller, and D.M.Schifferli.1998.Improved allelic exchange vectors and their use to analyze 987Pfimbria gene expression.Gene 207:149-157) makes up recombinant bacterial strain χ 7213/pREasd12, cultivate 12h for 37 ℃ and choose bacterium to liquid LB substratum, 37 ℃, 225r/min jolting cultivation 12h obtain the pREasd12 transferring plasmid thereby prepare plasmid in a small amount, and its physical map is seen Fig. 2.Qualification result confirms that the transferring plasmid pREasd12 that makes up is correct (see figure 3).

4.asd the structure of gene-deleted strain

With χ 7213/pREasd12 is the donor bacterium, and Salmonella choleraesuls C500 is that recipient bacterium carries out conjugal transfer.Donor bacterium and recipient bacterium be overnight incubation in the LB substratum respectively, with sterile phosphate damping fluid (PBS, NaCl 8.0g, KCl 0.2g, Na ₂HPO ₄.12H ₂O 2.9g, KH ₂PO ₄0.2g adding distil water is to 1000mL, through 121 ℃ of high pressure steam sterilization 30min) wash twice, adjust bacteria concentration to OD595 be 0.8, respectively get 100 μ L bacteria suspensions and mix.Aseptic nitrocellulose is affixed on the solid LB flat board that contains diaminopimelic acid (diaminopimelic acid, DAP is available from U.S. Sigma company), the mixed bacterium drop on filter membrane, is cultivated 12h for 37 ℃, do the contrast of donor and acceptor simultaneously.Wash bacterium liquid on the filter membrane, wash twice with aseptic PBS, coating contains paraxin (Cm, final concentration 30 μ g/ml) solid LB flat board, cultivate 12h for 37 ℃, Cm resistance bacterium colony is transferred simultaneously contains the LB flat board of Cm and 5% sucrose, screening Cm resistance zygote, extract genome, identify with primer pa5/pa6 amplification.Positive zygote is not cultivated 12h in non-resistant has the LB liquid nutrient medium of NaCl, continuous 10 times of dilutions, and coating contains the solid LB flat board of the no NaCl of 5% sucrose, and picking list bacterium colony is replicated in the solid plate that contains Cm and 5% sucrose, the responsive bacterium colony of screening Cm.Extract genome, identify that with primer pa5/pa6 amplification qualification result is seen Fig. 4 once more.The asd gene-deleted strain of C500 is owing to disappearance asd gene loses the ability of synthesizing DAP, so can not grow on the substratum of no external source DAP.The result shows, constructed asd gene-deleted strain asd ^-C500 is correct.

Embodiment 2: the clone of streptococcus suis 2-type surface antigen gene sao

1. genetic analysis and design of primers

Streptococcus suis 2-type 05ZYH33 strain (genebank NO.CP000407) sao gene order with reference to report; Use Tmpred (http://www.ch.emnet..org/software/tmpred_Form.html) and SignalP (http://www.cbs.dtu.dk/services/SignalP/) software to this coded by said gene Argine Monohydrochloride sequential analysis; Design upstream primer AAAGGATCCGCAACCTGATGGGGGAC and downstream primer GGGCTGCAGTCATTACATTGCTTCCTTA be used to increase sao gene A section (saoA, 777bp).Primer is given birth to worker's biotechnology company limited by Shanghai and is synthesized.05ZYH33 strain sao gene in the position of genbank as shown in Figure 5.

Streptococcus suis 2-type 05ZYH33 strain (genebank NO.CP000407) sao full length gene 1743bp, 581 amino acid of encoding.Sao Argine Monohydrochloride sequence is used Tmpred and SignalP software analysis, and the result shows: the film district is striden in two of Sao albumen existence, and (8-24aa 559-575aa), distinguishes corresponding N end signal peptide sequence and C terminal membrane anchor series; Be signal peptide cutting site between the 29th amino acids and the 30th amino acids.Report such as this cleavage site and Yuanyi Li (2006) is consistent; And known to the document, there is the amino acid repeat region before the Sao PROTEIN C terminal membrane anchorage zone, 05ZYH33 strain Sao amino acid sequence analysis is shown that this iteron is positioned at 300-550aa.To sum up, the design primer has been avoided signal peptide sequence and amino acid iteron, amplification sao gene 121bp-897bp, called after saoA.

2. streptococcus suis 2-type genome preparation

With streptococcus suis 2-type bacterial classification CVCC606 strain (available from the BeiJing, China, China Veterinery Drug Inspection Office) is inoculated on the TSA solid medium (available from Sigma company) that contains 10% deactivation new-born calf serum, the single colony inoculation of picking is in TSB liquid nutrient medium (available from Sigma company), place shaking table (150r/min), 37 ℃ of concussion overnight incubation.

Abide by the TIANGEN bacterial genomes and extract test kit (available from Wuhan strong wind Bioisystech Co., Ltd), extract the streptococcus suis 2-type genomic dna according to the working method that this test kit specification sheets provides.

3.PCR amplification

(25 μ L) is as shown in table 1 for PCR reaction system of the present invention:

Table 1PCR reaction system is formed

PCR condition of the present invention is 94 ℃, 5min, 1 circulation; 94 ℃, 1min, 52 ℃, 30sec, 72 ℃, 1min, 30 circulations; Last 72 ℃ are extended 10min.Agarose gel electrophoresis with 1.0% is identified recovery.

PCR the results are shown in Figure 6, and the saoA nucleotide sequence of amplification is seen SEQ ID NO:1.

4.PCR product reclaims

The UNIQ-10 pillar DNA glue that adopts Shanghai to give birth to worker's biotechnology company limited reclaims test kit and reclaims dna fragmentation, reclaims the step of the specification sheets of test kit according to the centrifugal dna gel of UNIQ-10 pillar and carries out, and the concrete operations step is as follows:

(1) with 0.8% agarose gel electrophoresis, target DNA fragment and other DNA are separated as far as possible, under long-wave ultra violet lamp, be used in the knife blade that burnt on the spirit lamp flame and downcut the agar block that contains target DNA fragment, put into 1.5ml sterilization centrifuge tube.

(2) add 400 μ l Binding Buffer by every 100mg agarose gel, put 10min in the 50-60 ℃ of water-bath, make sepharose thoroughly melt (when adding thermosol, every 2min mixing once).

(3) the UNIQ-10 post is put into collection tube, the sol solution that melts is transferred in the UNIQ-10 post, room temperature leaves standstill 2min, the centrifugal 1min of room temperature 8000rpm.

(4) take off the UNIQ-10 post, outwell the waste liquid in the collection tube, the UNIQ-10 post is put into same collection tube, add 500 μ l WashSolution, the centrifugal 1min of room temperature 8000rpm.

(5) repeating step 4, take off the UNIQ-10 post, outwell the waste liquid in the collection tube, and the UNIQ-10 post is put into same collection tube, the centrifugal 15sec of room temperature 12000rpm.

(6) the UNIQ-10 post is put into the 1.5ml centrifuge tube of a sterilization, according to PCR product amount relatively what, the film central authorities in the pillar bottom add 10～20 μ l Elution Buffer or ddH ₂O, room temperature or 37 ℃ of placement 2min.

(7) the centrifugal 1min of room temperature 12000rpm, the liquid in the centrifuge tube is the dna fragmentation of recovery, can use immediately or be stored in-20 ℃ standby.

Embodiment 3: the structure of prokaryotic expression plasmid pYA-saoA

1. the segmental TA of swine streptococcus type surface antigen gene saoA clones

The PCR of goal gene saoA is reclaimed product and carrier pMD18-T (available from precious biotechnology (Dalian) company limited) to spend the night in 16 ℃ of water-baths and carries out ligation, transform DH5 α competent cell, 37 ℃ are containing penbritin (AMP, 50 μ g/mL) cultivate on the LB solid medium, a plurality of single bacterium colonies of random choose therefrom, put into respectively and contain penbritin (AMP, 50 μ g/mL) 37 ℃ of cultivations were therefrom extracted plasmid after 12 hours in the LB liquid nutrient medium, screening obtains positive recombinant plasmid after enzyme is cut evaluation, with its called after pMD-saoA.The pMD18-T plasmid map as shown in Figure 7.

2. χ 6097 competent preparation (CaCl ₂Method)

Adopt CaCl ₂Legal system is equipped with intestinal bacteria χ 6097 (ara Δ (lac-pro) rpsl Δ asdA4 Δ [zhf-2::Tn10] thi Φ 580d/lacZ Δ M15, the Dr.Roy Curtiss III of Washington, DC university is so kind as to give) competent cell, concrete experimental procedure is as follows: after taking out intestinal bacteria χ 6097 from-70 ℃ of refrigerators, hold and thaw, directly dip in aseptic platinum filament and to get χ 6097 bacterial classifications on the LB planar surface of the diaminopimelic acid that contains 50 μ g/mL (DAP), be inverted in 37 ℃ of constant temperature and cultivate 16-18h; Picking list colony inoculation is to 5mL LB nutrient solution (containing 50 μ g/mL DAP), and 37 ℃, 230r/min constant-temperature shaking culture spend the night; Ratio was seeded to culture in an amount of LB nutrient solution (containing 50 μ g/mL DAP), in 37 ℃, 230r/min constant-temperature shaking culture 3-4h in 1: 100 by volume; Take out 100～200 μ L cultures and detect OD600, when OD600 is between 0.3-0.4, culture is placed ice bath 30min, make culture be cooled to 0 ℃; Hold the back at 4 ℃, centrifugal 10min collects thalline under the 5000-6000r/min, discards nutrient solution; The ice bath CaCl that adds about 1/2-1/5 culture volume ₂Solution (100mmol/L, 10% (V/V) glycerine), piping and druming gently, abundant resuspended bacterial precipitation, ice bath 15min; Repeat above-mentioned steps washing precipitation 2 times; In 4 ℃, the centrifugal 10min of 5000r/min collects thalline, abandons supernatant; The CaCl that adds about 1/50-1/25 culture volume ₂Solution (contains 100mmol/L CaCl ₂, 10% (V/V) glycerine), piping and druming gently, resuspended bacterium; Competent cell is sub-packed in the aseptic Eppendorf tube, and every pipe 100 μ L place-70 ℃ of refrigerators frozen standby.

3. the structure of expression plasmid pYA-saoA

Use restriction enzyme BamH I and Pst I to carry out enzyme to the plasmid pMD-saoA of step 1 preparation and cut, reclaim enzyme and cut product saoA and be connected in 16 ℃ of water-baths with pYA3493 (BamH I and Pst I linearization for enzyme restriction) and spend the night.χ 6097 competent cells that connect 2 preparations of product step of converting, cultivate on the LB solid medium in 37 ℃, a plurality of single bacterium colonies of random choose therefrom, put into 37 ℃ of cultivations of LB liquid nutrient medium respectively and therefrom extract plasmid after 12 hours, screening obtains positive recombinant plasmid after enzyme is cut evaluation, and called after pYA-saoA.The pYA3493 plasmid map as shown in Figure 8, recombinant plasmid pYA-saoA double digestion collection of illustrative plates is seen Fig. 9.

Embodiment 3: recombinant salmonella bacterial strain asd ^-The structure of C500/pYA-saoA

1. Salmonellas asd ^-The preparation of C500 competent cell

Take out Salmonellas asd from-70 ℃ of refrigerators ^-The C500 bacterial classification is held and is thawed, and directly dips in aseptic platinum filament and gets bacterial classification in the surperficial streak inoculation of LB flat board (containing 50 μ g/mLDAP), and 37 ℃ of constant temperature are inverted and are cultivated 16-18h; 1 diameter of picking is about single colony inoculation of 2-3mm to 4mL LB nutrient solution (containing 50 μ g/mL DAP), and 37 ℃, the 180r/min constant-temperature shaking culture is spent the night; Ratio was seeded to culture in the 50mL LB nutrient solution (containing 50 μ g/mL DAP) in 1: 100 by volume, 37 ℃, 230r/min constant-temperature shaking culture 2-3h; Take out 100-200 μ L culture and detect OD600, when OD600 is between 0.8-1.0, culture is placed ice bath 10min, make culture be cooled to 0 ℃; At 4 ℃, the centrifugal 10min of 5000r/min collects thalline, discards nutrient solution then; Sterile glycerol washing back with 2-5mL 10% concentration is centrifugal, repeats 3 times, uses the sterile glycerol suspension bacterium of 10% concentration again, and 100-150 μ L/ manages packing, indicates bacterial strain, volume and date, and it is frozen standby to put-70 ℃ of refrigerators.

2. the electricity of recombinant plasmid transforms

The recombinant plasmid pYA-saoA that gets 2-3 μ L process desalination joins competent cell asd ^-Among the C500, mixing.

The 0.2cm electricity of mixed solution being transferred to immediately precooling transforms in the cup, blots electric revolving cup outside water mark, puts into electroporation (BioRad GenePulser) sample cell then; Transform according to following electric commentaries on classics condition: voltage, 2.0KV; Electric capacity, 25 μ F; Pulse resistance, 200 Ω; Time, 4ms.

After the electric shock, at once take out electric revolving cup, add rapidly in the LB substratum of 37 ℃ of preheatings (containing 50 μ g/mL DAP), and bacterium liquid is transferred in the aseptic EP pipe; 37 ℃, 120r/min concussion are cultivated 45-60min, get 100-150 μ L bacterium liquid and coat LB solid culture primary surface, and flat board just is being put in 37 ℃ of incubators, treat that nutrient solution is absorbed fully after, be inverted and cultivate 16-18h.

3. recombinant bacterial strain asd ^-C500/pYA-saoA obtains

Recombinant plasmid pYA-saoA electricity is transformed asd ^-The recombinant bacterial strain that the C500 competent cell makes up has recovered the ability of growing on the LB liquid nutrient medium, this explanation recombinant plasmid pYA-saoA is at asd ^-Can express Asd albumen in the C500 bacterial strain and form complementation with the disappearance of the latter's asd gene.C500 is identical with parent plant, and the recombinant bacterial strain bacterium colony that takes on a red color on the maconkey agar with maltose grows up to colourless, smooth, moistening oyster white bacterium colony on the LB flat board.PCR identifies and shows that each strain reorganization bacterium all can amplify Salmonellas specific band (580bp) and exogenous genetic fragment band (777bp sees shown in the sequence table SEQ ID NO:1).PCR evaluation collection of illustrative plates is seen Figure 10.

Embodiment 4: recombinant bacterial strain asd ^-The biological characteristics of C500/pYA-saoA

1. recombinant bacterial strain asd ^-The expression characterization of C500/pYA-saoA

Bacterium asd will recombinate ^-C500/pYA-saoA is inoculated in the liquid LB substratum after 37 ℃ of joltings cultivate 15～16h, centrifugal thalline and the supernatant collected respectively.Add the resuspended precipitation of an amount of PBS, add the last sample Buffer of equal-volume 2 * SDS, boil 10min, carry out SDS-PAGE.Prepare separation gel and concentrated glue respectively by the data that table 2 provides.

Table 2SDS-PAGE separation gel and concentrated glue collocation method

After electrophoresis is complete, glue is placed staining fluid dyeing 3 hours, after destainer decolouring and use Quantity One software analysis expression.The culture supernatant that collects in the above-mentioned steps is filtered through the 0.22um filter; Got 900 μ L filtrates and 100 μ L100% trichoroacetic acid(TCA) mixings and ice bath 30 minutes, 12000rpm is supernatant discarded after centrifugal 5 minutes; Add 1mL precooling washing with acetone precipitation, the centrifugal acetone that goes repeats 2 times and thoroughly removes trichoroacetic acid(TCA); The air-dry acetone of removing; Precipitation is carried out SDS-PAGE with sample Buffer on the 20 μ L SDS after resuspended.SDS-PAGE analyzes collection of illustrative plates and sees Figure 11.

When the SDS-PAGE electrophoresis will finish,, dry with non-absorbent paper handkerchief with distilled water drip washing graphite cake.Put on one's gloves, cut 6 3mm filter paper and 1 nitrocellulose filter.Nitrocellulose filter float on a dish deionized water above, borrow earlier wicking action to make film wetting from the bottom up after, film is immersed in the water fully, soak 5min and remove bubble residual on the filter membrane, make marks for one jiao at filter membrane with soft pencil.Adding a small amount of electricity in a pallet changes damping fluid, and 6 filter paper are soaked in wherein.The installation transfer device that puts on one's gloves keeps flat bottom electrode (anode), Yi Bian graphite up, places 3 filter paper that soaked on this electrode, and accurately alignment is driven bubble out of with glass stick, and nitrocellulose filter is placed on the filter paper, and assurance is alignd, and does not have bubble.Take off gel from electrophoresis chamber, transfer to deionized water part omitted rinsing once, accurately lie against then on the nitrocellulose filter, the gel lower left corner and filter membrane label alignment are worn gloves and are got rid of bubble.Last 3 filter paper are placed on gel top, guarantee that equally accurate alignment do not stay bubble.The electrode (negative electrode) of top is placed on the interlayer thing,, connects power supply, press 0.65～1.0mA/cm according to the gel area Yi Bian graphite down ²Making current, electrotransfer 2h.Transfer printing places the TBST rinsing once with the NC film after finishing, and puts into confining liquid again, and 4 ℃ of reactions are spent the night.Then film is taken out, 37 ℃ of reactions of one anti-(streptococcus suis 2-type immune swine serum) 1h with the dilution of TBST damping fluid, TBST washing 4-6 time, each 5min, add the 37 ℃ of reactions 1h of two anti-(HRP mark goat-anti pig IgG antibody is available from BIOTECK companies), TBST washes 4-6 time, each 5min places film the moisture that blots the surface on the clean filter paper.Add ECL substrate solution A, B (available from Ameresco company) and earn in the plate, nitrocellulose filter is put into wherein (lucifuge), place Molecular Image station 2000MM (available from Kodak company) colour developing and exposure 3min, observations in dried.Western-blotting analyzes collection of illustrative plates and sees Figure 12.The configuration of SDS-PAGE damping fluid:

5 * Tris glycine electrophoretic buffer: Tris base 7.55g, (10%SDS (electrophoresis level) 25mL adds ddH to glycine for electrophoresis level, pH8.3) 47g ₂The O dissolving is settled to 500mL.

30% polyacrylamide mother liquor: with 29g acrylamide and 1gN, N-methylene radical acrylamide is dissolved in 60mL distilled water (ddH ₂O) in, be heated to 37 ℃ of dissolvings, be settled to 100mL, 4 ℃ keep in Dark Place standby.

2 * sds gel sample loading buffer: 100mmol/L Tris-HCI (pH6.8), 200mmol/L dithiothreitol (DTT) (DTT), 4%SDS (electrophoresis level), 0.2% tetrabromophenol sulfonphthalein, 20% glycerine.

Coomassie brilliant blue staining liquid (100mL): 45mL methyl alcohol, 45mL ddH2O, 10mL glacial acetic acid, 0.25g coomassie brilliant blue R250.Destainer (100mL): 45mL methyl alcohol, 45mL ddH ₂O, the 10mL glacial acetic acid.

The relevant damping fluid configuration of Western-blotting:

Electricity changes damping fluid: 39mmol/L glycine, 48mmol/L Tris alkali, 0.037%SDS (electrophoresis level), 20% methyl alcohol.Preparation 1000mL transfering buffering liquid need take by weighing the 2.9g glycine, 5.8g Tris alkali, and 0.37g SDS adds 200mL methyl alcohol, adds ddH ₂O to total amount be 1000mL.

TBS(pH8.0)：10mmol/L?Tris-HCl，150mmol/L?NaCl。

TBST: adding final concentration in TBS is that 0.05%Tween-20 gets final product.

Confining liquid: the 5g skimming milk is dissolved among the 100mLTBS.

2. recombinant bacterial strain asd ^-The growth characteristics of C500/pYA-saoA

With recombinant bacterial strain asd ^-C500/pYA-saoA streak inoculation LB flat board, the picking mono-clonal is inoculated in respectively in the LB liquid nutrient medium, behind 37 ℃ of shaking culture 10h, adjust bacterium liquid OD595 value, get 50 μ L and be inoculated in the 5mL LB liquid nutrient medium 37 ℃ of shaking culture, measure OD595 value, result such as table 3 every 1h.Reorganization bacterium asd ^-C500/pYA-saoA then is slightly slower than C500 and asd in logarithmic growth later stage (after the 10h) speed of growth ^-C500/pYA3493.

Table 3 recombinant bacterial strain is cultivated different time sections OD ₅₉₅Value

3. bacterium asd recombinates ^-The genetic stability of C500/pYA-saoA

Bacterium asd will recombinate ^-C500/pYA-saoA continuous passage in the LB liquid nutrient medium, get respectively the 0th generation, 10 generations, 20 generations, 30 generations, 40 generations, 50 generation bacterium liquid carry out PCR and identify.The result shows: the different generations of each strain reorganization bacterium all can amplify Salmonellas specific band (580bp) and exogenous genetic fragment band.Go down to posterity the mono-clonal sequencing result of picking after 50 generations with just all consistent for the external source fragment sequence, show that each recombinant plasmid all can be at asd ^-Genetic stability among the C500/pYA-saoA.Genetic stability PCR the results are shown in Figure 13.

4. bacterium asd recombinates ^-The virulence of C500/pYA-saoA

The virulence of reorganization bacterium is assessed by the abdominal cavity infection kunming mouse.Reorganization bacterium asd with gradient dosage ^-The C500/pYA-saoA intraperitoneal injection of mice was observed 21 days and is write down death condition.Calculate mouse mld (LD according to the Reed-Muench method ₅₀), estimate that recombinant bacterial strain compares with parent strain c500 whether virulence weakens and to mouse safety whether.

High dosage whole 5 mouse that all can in 3 days, cause death; Median dose does not cause mouse all dead, but can make most of mouse morbidity, show as One's spirits are drooping, be slow in action, food refusal, not dead mouse all can recover normal after 10 days; The deadly mouse of low dosage is not caused mouse invasion yet.Calculate mouse mld LD according to the Reed-Muench method ₅₀, asd ^-C500/pYA-saoALD ₅₀Be about 4.7 * 10 ⁸CFU, parent plant C5002.9 * 10 of comparing ⁸LD ₅₀, reorganization bacterium power obviously descends.Show reorganization bacterium asd ^-The virulence that C500/pYA-saoA compares parent plant C500 is low, and security is better.Mouse peritoneal infectable infection reorganization bacterium asd ^-The safety experiment of C500/pYA-saoA and parent bacterium C500 the results are shown in Table 4.

Table 4 recombinant bacterial strain is to the mensuration of mouse mld LD50

Embodiment 5: recombinant bacterial strain asd ^-The preparation of C500/pYA-saoA vaccine

Embodiment 6: recombinant bacterial strain vaccine asd ^-C500/pYA-saoA is to the immuning effect test of mouse

1. the immune programme for children of mouse

Use the kunming mouse in 5-7 age in week to do the immune efficacy evaluation, be divided into 3 groups, be respectively the asd of the present invention's preparation according to test requirements document ^-C500/pYA-saoA recombinant bacterial strain vaccine group, asd ^-C500/pYA3493 control group and PBS control group.Immunization route is that subcutaneous injection 0.2mL in back (contains 1.0 * 10 ⁹CFU viable bacteria amount) bacterial suspension, booster immunization is 1 time after 14 days.Exempt from back 14 days and 28 days respectively at head and detect recombinant protein rSaoA specific antibody (ELISA method with reference to Liu Zhonghui etc., immunology common experimental technology, Beijing: Science Press, 2002).

2. the immune serum antibody horizontal detects

Each is organized mouse and exempted from back 14 days and 28 days blood sampling collection immune serums at head, 5 every group, is used for ELISA and detects.The collection method of immune serum is as follows: blood 200 μ L are got in mouse docking, be collected in the 1mL centrifuge tube, 37 ℃ leave standstill 1h after, 4 ℃ of placement of spending the night, the centrifugal 15min of 3000r/min, the collection upper serum ,-20 ℃ of preservations are standby.Mice serum antibody ELISA detected result is seen Figure 14, shows reorganization bacterium asd ^-C500/pYA-saoA immune group mouse has produced the rSaoA specific antibody of higher level.

3. immune mouse is attacked malicious protectiveness experiment

With 40 of the negative kunming mouses of 5-7 Salmonellas in age in week, be equally divided into three groups, i.e. the asd of the present invention preparation ^-C500/pYA-saoA reorganization bacteria vaccine group, asd ^-C500/pYA3493 control group, PBS control group.Head exempts to use streptococcus suis 2-type virulent strain CVCC606 to carry out abdominal injection to immune mouse in back 28 days and attacks poison, and attacking the toxic agent amount is 1.1 * 10 ⁹CFU.The result attacks reorganization bacterium asd under the toxic agent amount at this ^-15 mouse of C500/pYA-saoA vaccine group are all protected does not have dead example, asd ^-C500/pYA3493 control group and PBS control group are all dead.Attack the poison protection and the results are shown in Table 5.

Table 5 immune mouse CVCC606 attacks poison protection result

Embodiment 7: recombinant bacterial strain vaccine asd ^-C500/pYA-saoA is to the immuning effect test of piglet

1. the immune programme for children of piglet

12 of the piglets of selection 25-30 age in days, Salmonellas and swine streptococcus feminine gender, test divides 3 groups, and the 1st group is the PBS control group, and the 2nd group is asd ^-C500/pYA3493 vaccine control group, the 3rd group is asd of the present invention ^-C500/pYA-saoA reorganization bacteria vaccine group.

Every pig injection of PBS control group 1mL PBS, asd ^-C500/pYA3493 vaccine control group and reorganization bacteria vaccine asd of the present invention ^-Every pig musculi colli injection of C500/pYA-saoA group 1mL culture bacteria suspension (3 * 10 ⁹CFU), single immunization.After the immunity weekly blood sampling once detect rSaoA specific antibody (ELISA method with reference to Liu Zhonghui etc., immunology common experimental technology, Beijing: Science Press, 2002) with the ELISA method respectively.

2. immune piglet serum antibody level detection

Weekly swinery is carried out precaval vein blood sampling and separation of serum after the immunity, serum adopts the ELISA method to detect the specific antibody level of the rSaoA that respectively organizes swinery after diluent dilution in 1: 40.The result sees table 6 for details, shows asd of the present invention ^-C500/pYA-saoA reorganization bacteria vaccine can stimulate piglet to produce the specific antibody of the rSaoA of higher level.

The specific antibody level of the immune piglet rSaoA of table 6

Illustrate: ELISA criterion: OD630＜0.4 is negative; OD630＞0.4 is positive.

3. immune piglet is attacked malicious protectiveness experiment

Back 21 days of immunity is carried out streptococcus suis 2-type virulent strain CVCC606 ear vein to 3 groups of immunity swinerys and is attacked poison.Attacking the poison back observed 14 days.Result such as table 6, contrast asd ^-C500/pYA3493 group and PBS group piglet are attacked poison and begin to occur clinical symptom after 24 hours, show as body temperature and continue suddenly to raise, walk lamely, lie prone for sleeping in, tremble, do not take food, four limbs are struck and all dead in attacking back 5 days of poison.Asd of the present invention ^-Only dead 1 of C500/pYA-saoA reorganization bacteria vaccine immune group, 3 head protections there is no obvious clinical symptom.See Table 7.

The immune piglet CVCC606 of table 7 attacks poison protection result

Claims

1. recombinant salmonella choleraesuis strain (Salmonella choleraesuis) asd who expresses streptococcus suis 2-type surface antigen gene sao ^-C500/Pya-saoA is deposited in Chinese typical culture collection center, and its preserving number is CCTCCNO:M2010156, it is characterized in that:

1) this strain gene group has lacked the essential asd gene of Salmonella choleraesuls growth;

2) include the recombinant plasmid pYA-saoA that expresses streptococcus suis 2-type surface antigen gene sao, the nucleotide sequence of the exogenous genetic fragment of its insertion is shown in sequence table SEQ ID NO:1.

2. the recombinant plasmid pYA-saoA of a non-resistant mark is characterized in that, the part fragment that contains streptococcus suis 2-type surface antigen gene sao also can be expressed in the host bacterium, and its nucleotide sequence is shown in SEQ ID NO:1.

3. preparation method who expresses the recombinant salmonella choleraesuis of streptococcus suis 2-type surface antigen gene sao, its step is as follows:

1) the asd gene-deleted strain asd of structure salmonella choleraesuis strain C500 ^-C500;

2) be template with the streptococcus suis 2-type genome, increasing by PCR method obtains the part fragment saoA of streptococcus suis 2-type surface antigen gene sao, and the nucleotide sequence of this amplified fragments is shown in SEQ ID NO:1;

3) with step 2) in the gene fragment saoA of amplification insert between the BamH I and Pst I site of prokaryotic expression carrier pYA3493, make up and obtain expression plasmid pYA-saoA;

4) plasmid and the carrier bacterial strain asd that step 3) is obtained ^-The segmental recombinant salmonella choleraesuis strain of C500 construction expression streptococcus suis 2-type surface antigen gene sao (Salmonella choleraesuis) asd ^-C500/Pya-saoA,, its preserving number is CCTCC NO:M2010156.

4. the application of the described recombinant salmonella choleraesuis of claim 1 in preparation Salmonella choleraesuls-streptococcus suis 2-type bigeminy recombinant vaccine.

5. the application of the described recombinant plasmid of claim 2 in preparation Salmonella choleraesuls-streptococcus suis 2-type bigeminy recombinant vaccine.