CN102732473B - The recombinant salmonella choleraesuis of expression mycoplasma hyopneumoniae p46 albumen and preparation method and application - Google Patents
The recombinant salmonella choleraesuis of expression mycoplasma hyopneumoniae p46 albumen and preparation method and application Download PDFInfo
- Publication number
- CN102732473B CN102732473B CN201110087938.8A CN201110087938A CN102732473B CN 102732473 B CN102732473 B CN 102732473B CN 201110087938 A CN201110087938 A CN 201110087938A CN 102732473 B CN102732473 B CN 102732473B
- Authority
- CN
- China
- Prior art keywords
- salmonella
- mycoplasma hyopneumoniae
- pya
- vaccine
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to animal bacteria gene engineering technology field, and in particular to a kind of structure of the recombinant salmonella choleraesuis for expressing mycoplasma hyopneumoniae main immunogenic memebrane protein without resistance marker, vaccine are prepared and applied.The present invention obtains one plant of Salmonella choleraesuls C500 (pYA 46) for expressing mycoplasma hyopneumoniae p46 albumen without resistance marker, and its preserving number is CCTCC NO：M2011106, the recombinant strain have lacked asd genes necessary to Salmonella choleraesuls growth, containing the plasmid that can express asd genes and mycoplasma hyopneumoniae p46 albumen in the recombinant strain.The invention also discloses the recombinant strain prepares method and its application of Salmonella choleraesuls and porcine mycoplasmal pneumonia vaccine.Bivalent vaccine prepared by the present invention can stimulate pig to produce the immune response of opposing Salmonella choleraesuls and mycoplasma hyopneumoniae, effectively prevent the infection of Salmonella choleraesuls and mycoplasma hyopneumoniae.
Description
Technical field
The invention belongs to animal bacteria gene engineering technology field, and in particular to a kind of expression pig lung without resistance marker
The recombinant salmonella choleraesuis live vaccine strain of scorching mycoplasma memebrane protein p46 genes, its preparation method and application.
Background technology
Salmonella can carry the immunogenic gene of various bacteria, virus or parasite as live vaccine vectors, from
And become the polyvalent recombinant genetic engineering live vaccine of salmonellosis and Other diseases.In recent decades, with attenuation salmonella
Research as live vaccine expression vector is widely paid close attention to.Wherein, weak salmonella is caused to make using gene engineering method
Carry out expression alien gene for bacteria carrier living, be widely used to the vaccine of tumour, virosis, bacterial disease and parasitic disease etc.
Research.
Salmonella has been subjected to medical science with veterinary extensive attention as vaccine carrier.Its major advantage is Salmonella
Bacterium can carry out immunity using mucosal routes such as oral or collunariums, and easy to operate, the stimulation to object of inoculation is little, while can be by matter
Grain DNA be specifically transmitted into the antigen presenting cells such as macrophage, BMDC, so as to effectively excite corresponding body fluid with
Cellullar immunologic response[1].Additionally, salmonella is intracellular bacterial parasite, which is lured while anti-salmonella immune response is excited
Specificity humoral and cell immune response of the artificial delivery life for foreign protein, and mucosa immunity-inducing and general immunity simultaneously.Cause
This, attenuation salmonella both can be used as the live vaccine for isogeneic, it is also possible to be directed to the micro- life of other cause of diseases as induction
Thing produces the DNA vaccine vector of aversion response[2].In consideration of it, using attenuation salmonella as the genetic engineering of mucosal immunity
Live vaccine expression vector has unrivaled superiority.In addition, Salmonella carrier itself has the effect of immunologic adjuvant[3],
Its LPS can discharge various cell factors with stimulation of host cell as a kind of inherent adjuvant.
Attenuation salmonella retains invasiveness, may pass through mucosal tissue, invade mucous membrane local correlation lymph node and spleen, liver,
The lymphoid tissue of kidney etc., and exogenous antigen is expressed in infestation position, so as to not only local mucous membrane produces SIgA, also excite whole body
The humoral and cellular immune response of property.Mucosal immunity is carried out as carrier with attenuation salmonella, is a kind of after traditional inactivation and attenuation
New immunization wayses after vaccine, it can present multiple antigens, and in many places, mucous membrane produces immunization, and causes the body fluid of general
And cellular immunity.Compared with other live vaccine vectors, cause weak Salmonella carrier also with culture simplicity, breed rapid, preparation
Strong with easy to use, immunogenicity, economic the advantages of.Restructuring intracellular bacterial parasite can pass through bacterium by oral administration or after injecting immune
DNA is introduced directly into the sole duty presenting cell such as macrophage, BMDC by the mode of infection, is transported to correlation
Mucous membrane and lymphoid tissue, inducing cellular immune and humoral immune reaction[4], while obtaining the immunity to carrier bacterium.Attenuation Salmonella
Bacterium immune mouse by oral route, not only safe efficient, and generation mucosa reaction can be excited, to homologous cause of disease and heterologous disease
Original shows good protection[5].
Salmonella choleraesuls C500 be passed for 500 generations in the culture medium containing thaliium acetate after cause weak with good immunogene
Property bacterial strain, practice also demonstrates that C500 strains have immunogenicity good, can activate whole body, local and distant mucosal is immune exempts from
Epidemic disease is acted on, and has side effect low, the characteristics of security is good[6].Wherein, that effect most stable application is most is salmonella Asd+
Balanced lethal system.State Key Laboratory of Agricultural Microbiology Xu draws the asd bases that younger brother etc. builds C500 strains
Because of gene-deleted strain Δ asdC500, the virulence that Δ asdC500 gene-deleted strains reduce further C500 is verified by experiments, vaccine is enhanced
Security.
Porcine mycoplasmal pneumonia is widely distributed also known as mycoplasma pneumonia of swine or epidemic swine pneumonia, with chronic, contact
Property, with the characteristics of highly infectious, high incidence and low actual etc., be mainly shown as cough and have difficulty in breathing, dissect visible
Lung tissue becomes or marble sample pathology in meat.
Mycoplasma hyopneumoniae is one of important pathogen of PRDC, can scabies secondary infection PRRSV, PCV2
Deng so as to cause the inoculation failure of multiple vaccines.Mycoplasma hyopneumoniae can air-borne transmission, additionally easily with other bacillary diseases
Disease such as swine plague, contagious pleuropneumonia etc. concurrently, cause great economic loss to pig industry, are currently to occur most frequently, most
One of wide important epidemic disease that is popular, being most difficult to purification.This is primarily due to, and mycoplasma hyopneumoniae can penetrate mucous layer and cilium glues
Together, the integrality of cilium is destroyed, and secretes some injurious factors, so as to change the migrans of cilium, cause cilium a large amount of
Come off, be that the invasion of other bacteriums and virus creates condition, cause loss aggravation.
Mycoplasma hyopneumoniae can be detained in pig lung for a long time, and therapeutic effect is not good, although the death rate that the disease causes is not high,
But the economic loss caused by the popularity of prevalence remains huge.It is reported that, mycoplasma hyopneumoniae surface has cilium
Adhesion factor, after the respiratory tract of its infected pigs, can be specifically bound with mucosal epithelial cells fiber, make mycoplasma hyopneumoniae
Attached can grow and cause pathogenic.Raznis (1983) researchs find, the pathogenicity and immunogenicity of mycoplasma hyopneumoniae all with
Memebrane protein on its cell membrane is relevant, and Gear S J etc. (1985) are separated from the cell membrane of mycoplasma hyopneumoniae bacterial strain VPPll
A kind of pathogenic protein factor is obtained, it is found which has obvious immunogenicity, and is confirmed that epicyte protein is to cause pig affected pig
The principal element of Eaton agent pneumonia.Jody L W also confirmed that this point later.University of Iowa Ross researchs find that pig pneumonia is propped up
After pathogen infection, lymphocyte produces the ability decline of antibody, and cellular immunity declines, phagocytosis of the pulmonary alveolar macrophage to cause of disease
Also decline with Scavenging activity, the activity enhancing of suppressor T lymphocyte causes respiratory immunity power to weaken, and premunition declines, so that
Other pathogen are easier to invade.
The antigenic analysis of reference culture and field isolated strains is shown, Eaton agent pneumonia contains several main immunogens：
I.e. intracellular has the albumen (p36) of LDH activity, 3 kinds of memebrane proteins (p46, p65 and p70) and adhesin (p97).These albumen are in urgency
Property or primary infection mycoplasma pneumoniae after, can stimulate generation early stage and specific antibody.
Wise K.S etc. (1987)[8]It was found that p46 albumen is the species specificity surface antigen of mycoplasma hyopneumoniae, in pig lung
The early stage of scorching mycoplasma infection can detect that the antibody of anti-p46, and the duration of the antibody response for causing is most long.Its sequence
In 3 TGA codons encode Trp, and TGA is terminator codon in universal codons, needs for TGA to sport TGG ability
Obtain the albumen of its prokaryotic expression.S Futo etc. (1995)[7]By in p46 gene clonings to carrier, then proceed in Escherichia coli
Prokaryotic expression is carried out, the recombinant protein is harvested and purify, and is applied successfully to detect mycoplasma hyopneumoniae antibody
ELISA test, the experiment can avoid with mycoplasma flocculare, mycoplasma hyorhinis, mycoplasma hyosynoviae cross reaction.
(2003) such as K.Cheikh Saad Bouh[9]By p46 genes and p65 gene clonings on carrier, and to which in Escherichia coli
Prokaryotic expression is carried out, expression product is harvested and immune BALB/c mouse after renaturation is carried out to which, so as to obtain corresponding monoclonal
Antibody, and the research of cross reaction has been carried out to the monoclonal antibody, as a result show that the albumen has very high inter-species conservative
And specificity.
Traditionally, typically controlled it with antibiotic.However, with the general increase of persister, pig subinfection again
The probability of mycoplasma pneumoniae is also increased by.Therefore, except using antibiotic and using good the care of animal program, by vaccine
It is also necessary to prevent and treat porcine mycoplasmal pneumonia.But the difficulty due to early detection and the effective medicine of shortage, porcine mycoplasmal lung
Inflammation is not up to gratifying effect so far in control aspect.
At present, the vaccine of prevention porcine mycoplasmal pneumonia is mainly Attenuate vaccine, inactivated vaccine and recombinant vaccine both at home and abroad.
But the inactivated vaccine of import is relatively costly, although domestic attenuated vaccine immune effect is preferably, need to carry out pleural inoculation, grasp
Make inconvenient, and the vaccine can not be injected to the swinery for having fallen ill, and the recombinant vaccine of rising in recent years greatly all in
In the laboratory research stage, not yet it is widely used in clinic.
Mucosal immune system can produce mucosal immune response and HI after antigenic stimulus, and inactivated vaccine is exempted from
Epidemic disease can only induction body fluid immune response, it is impossible to activates mucosal immune system, even if there is higher serum antibody titer, can not still hinder
Only cause of disease is internal through mucous membrane invasion.Due to mucous membrane surface and external antigen directly contact, it is body opposing pathogenic microorganism invasion
The first line of defence, and the main path of most organism infection is the mucosal systems such as alimentary canal, respiratory tract, thus mucous membrane is exempted from
Epidemic disease has extremely important effect in terms of opposing infection.The easy quilt of vaccine that drinks water in the vaccine of the mucosa-immune for using at present
Alimentary canal is degraded, and the absorption efficiency of antigen is low, and drops in half checkout time only 15min in nasal cavity, causes vaccine effectively can not enter
Enter body and excite effective mucosa-immune, seeking efficient mucosa-immune vaccine has become the focus of current vaccine research.In view of
Attenuation salmonella has transport efficiency high as vaccine carrier, and immunization method is simple, and immune effect preferably, can be excited complete simultaneously
The advantages of body immunity and local mucosal immunity, there is good application prospect.
The man's research of the nineteen ninety stone statue placed in front of a tomb shows, after porcine mycoplasmal pneumonia vaccine is through intestine immunity, by produced by antigenic stimulus
Antibody can move to respiratory tract through the circulatory system, it was demonstrated that the mucosa-immune mechanism between alimentary canal and respiratory tract is communicated.Therefore,
Porcine mycoplasmal pneumonia genetic engineering live vaccine can be moved to by mucous membrane using the antibody that oral way stimulation intestine immunity is produced and be exhaled
Road is inhaled, so as to resist the invasion of breathing problem cause of disease, preventive effect is played.Therefore, develop more safe efficient, cheap
New generation vaccine be world's pig industry in the urgent need to.
Recombinant salmonella live vaccine nature or experimental infection, it is same that the anti-any heterogeneous serotypes salmonella of induction is protected
When, salmonella because invading lymphatic system, exempt from by the body fluid and cell that can more effectively excite host's generation to be directed to heterologous antigen
Epidemic disease is reacted.So, restructuring attenuated live vaccines may is that the one kind for solving current porcine mycoplasmal pneumonia commercialized vaccine weak point
Feasible method.There are a lot of defects in the conventional method for building recombinant salmonella strain；As in the past generally using carrying resistant gene
Expression plasmid, do not received by people because there is bio-safety.Asd plasmid vectors balanced lethal system has expression
Amount is high, exogenous gene expression is stable, the advantages of be not required to purifying and antibiotic-free resistance marker, while in view of Salmonella choleraesuls
The good immunogenicity of C500, is developed and is had for expressing the bivalent vaccine of porcine mycoplasmal pneumonia main immunogenic memebrane protein
Wide application prospect.
Content of the invention
The invention reside in overcoming the defect that prior art is present, its first purpose is to obtain expression porcine mycoplasmal pneumonia master
The salmonella choleraesuis strain for wanting immunogenic membrane peptide p46 to recombinate, three codings in the p46 GFPs in the recombinant bacterial strain
Rite-directed mutagenesis is TGG to the TGA codons of tryptophan, in order to the prokaryotic expression of the albumen.
Second object of the present invention be using above-mentioned restructuring Salmonella choleraesuls obtain a kind of being attenuated hog cholera
Salmonella prepares Salmonella choleraesuls and porcine mycoplasmal pneumonia bivalent gene engineering live vaccine.
Third object of the present invention is that the Salmonella choleraesuls of above-mentioned restructuring are preparing Salmonella choleraesuls and pig
Application in Eaton agent pneumonia bivalent gene engineering live vaccine.
The present invention is achieved through the following technical solutions：
Applicant obtains one plant of expression porcine mycoplasmal pneumonia main immunogenic memebrane protein by engineered method
Salmonella choleraesuls (Salmonella choleraesuis) C500 (pYA-46) of p46 Protein reconstitutions, and in 2011 4
China typical culture collection center (CCTCC) preservation that the moon is delivered in the Wuhan University of Wuhan City, Hubei Province on the 2nd, its deposit number
For CCTCC NO：M2011106.
A kind of preparation method of the Salmonella choleraesuls C500 (pYA-46) of restructuring is applicant provided, it includes following
Step：
1) construction recombination plasmid pGEX-46：The gene segment that mycoplasma hyopneumoniae memebrane protein p46 is expanded with pair of primers,
And be subcloned to prokaryotic expression carrier pGEX-KG, construction recombination plasmid pGEX-46；The primer to nucleotide sequence such as
Shown in lower：
Forward primer：CCCGGATCCATGAAAAAAATGCTTA (5 ' → 3 '),
Reverse primer：CCCAAGCTTTTAGGCATCAGGATTA(5′→3′)；
2) three pairs of primers are utilized by p46 GFPs segment 210bp, 303bp of mycoplasma hyopneumoniae and the alkali at 662bp
Base A rite-directed mutagenesises are bases G, and the nucleotide sequence of the primer is as follows：
Forward primer：AATCCTCGATGGATTAGTGCC (5 ' → 3 '),
Reverse primer：CCATCGAGGATTATCCGGAT(5′→3′)；
Forward primer：CAAAATAACTGGCTCACTCAG (5 ' → 3 '),
Reverse primer：CCAGTTATTTTGTGCATCCTG(5′→3′)；
Forward primer：TCCCAGGATGGAATTATGGAA (5 ' → 3 '),
Reverse primer：CCATCCTGGGACATAAACAGC(5′→3′)；
3) construction recombination plasmid pYA-46：Template is done with the correct recombinant plasmid pGEX-46 of above-mentioned mutation, pair of primers is used
Enter performing PCR amplification, after digestion connect plasmid pYA3493, convert x7213 screening positive clones, gained positive plasmid electricity convert to
Salmonella choleraesuls C500 Δ asd gene-deleted strains, obtain deposit number for CCTCC NO：The Salmonella choleraesuls of M2011106
C500(pYA-46)；The nucleotide sequence of the primer pair is as follows：
Forward primer：AAAGTCGACCATGAAAAAAATG (5 ' → 3 '),
Reverse primer：AATAAGCTTTTAGGCATCAGGAT(5′→3′).
Applicant has cloned a kind of base of energy prokaryotic expression mycoplasma hyopneumoniae main immunogenic memebrane protein-p46 albumen
Because of fragment, its nucleotide sequence such as accompanying drawing 13 and sequence table SEQ ID NO：Shown in 1.The 210bp of sequence shown in accompanying drawing 13,
A210-G210 is respectively present at 303bp and 662bp；A303-G303；The artificial rite-directed mutagenesis of the base of A662-G662, will compile
The codon TGA rite-directed mutagenesises of code tryptophan are TGG.
Applicant utilizes Salmonella choleraesuls C500 (pYA-46) bacterium solutions of the restructuring and gelatin successfully to prepare one
Plant the bivalent genetic engineering vaccine of preventing and treating Salmonella choleraesuls and porcine mycoplasmal pneumonia.
The pig of the above-mentioned expression mycoplasma hyopneumoniae main immunogens memebrane protein p46 Protein reconstitutions without resistance marker is suddenly
Random salmonella has lacked required cell membrane in salmonella strain genome and has formed related gene asd genes (No. GenBank
AE008863) (need the plasmid containing asd genes to be present in or beyond thalline normally to give birth on the culture medium of source interpolation DAP
Long and breeding), while the recombinant bacterial strain contains exogenous plasmid pYA-46 (containing asd genes).Salmonella choleraesuls C500
(pYA-46) retain parent strain C500 as the immunological characteristic of Salmonella choleraesuls attenuated vaccine strain.Plasmid pYA-46 can be
Asd genes, and gene (this containing the mycoplasma hyopneumoniae p46 albumen for being capable of prokaryotic expression is expressed in the recombinant bacterial strain
Bright it is named as p46 genes).Wherein, asd gene expression products provide salmonella necessary to cell membrane formed correlation into
Part, and the gene expression product of p46 albumen provides the good immunogenicity for mycoplasma hyopneumoniae.
The pig of the expression mycoplasma hyopneumoniae main immunogens memebrane protein p46 Protein reconstitutions without resistance marker of the present invention
Cholera salmonella C500 (pYA-46) is derived from the commercialization Salmonella choleraesuls for being used for more than 50 years in China
Attenuated vaccine strain C500.The Salmonella choleraesuls C500 (pYA-46) of the described present invention, has lacked C500 strain gene groups
In asd genes, while add containing can prokaryotic expression mycoplasma hyopneumoniae p46 albumen gene plasmid pYA-46.By
Presence Salmonella choleraesuls C500 (pYA-46) in plasmid pYA-46 could be survived, and also be considerably improved plasmid pYA-46
The stability of (the namely gene of p46 albumen) in the bacterial strain.The gene of p46 albumen is in Salmonella choleraesuls C500
(pYA-46) the stable expression in, is allowed to the immune protective efficiency for mycoplasma hyopneumoniae.
The present invention basic construction method be：The agromicrobiology National Key Laboratory structure being located using the applicant
The Salmonella choleraesuls attenuated vaccine strain C500 Δ crp Δ asd gene-deleted strains of the asd gene delections that builds are (referring to document：Xu Yindi
Deng, the structure of Salmonella choleraesuis C500 strain Δ crp Δ asd gene-deleted strain balanced lethal carrier systems and identification. bioengineering
Journal, 2006,5 (3)：366-371.) plasmid containing the mycoplasma hyopneumoniae p46 GFPs for being capable of prokaryotic expression is built
pYA-46.Plasmid pYA-46 is proceeded in the C500 strains of asd gene delections, plasmid pYA-46 and asd bases is needed due to grown
C500 strains because lacking are complementary and stably coexist, form our inventions can express mycoplasma hyopneumoniae without resistance marker
The Salmonella choleraesuls C500 (pYA-46) of p46 Protein reconstitutions.Present invention system is proved by substantial amounts of biological experiment data
Standby Salmonella choleraesuls C500 (pYA-46) can be used to prepare for Salmonella choleraesuls and porcine mycoplasmal pneumonia divalence
Recombinant vaccine.
Main advantages of the present invention are：
1st, the mycoplasma hyopneumoniae p46 albumen expressed by Salmonella choleraesuls C500 (pYA-46) of the invention, has
Good immune protective.Due to porcine mycoplasmal pneumonia harm increasingly seriously, extensive stock porcine mycoplasmal in the market
There is the difficult operation of pleural inoculation in pneumovax (mainly Attenuate vaccine), the defect such as side reaction is big.Therefore, the engineering strain is used
The vaccine that makes has wide market application foreground.
2nd, Salmonella choleraesuls C500 (pYA-46) of the invention is derived from and is used for more than 50 years in China
The Salmonella choleraesuls attenuated vaccine strain C500 of commercialization, has been fully retained immunity effects of the C500 for Salmonella choleraesuls
Power.Additionally, the recombinant bacterial strain virulence is slightly weaker than C500, with more preferable biological safety.
3rd, Salmonella choleraesuls C500 (pYA-46) of the invention can be provided simultaneously for Salmonella choleraesuls and pig
The protection of two kinds of cause of diseases of Eaton agent pneumonia.
4th, Salmonella choleraesuls C500 (pYA-46) of the invention complies fully with vaccine bio-safety without resistance marker
Property require.
More detailed technical scheme is as described in embodiment.
Description of the drawings
Sequence table SEQ ID NO：1 is the genetic fragment of the mycoplasma hyopneumoniae immunogene memebrane protein p46 of present invention clone,
Sequence is 1260bp, the artificial rite-directed mutagenesis that there is base at 210bp, 303bp and 662bp.
Sequence table SEQ IDNO：2 is the ammonia of the genetic fragment coding of the mycoplasma hyopneumoniae immunogene memebrane protein p46 of clone
Base acid sequence.419 amino acid of coding.
Fig. 1：The present invention prepares the techniqueflow chart of Salmonella choleraesuls C500 (pYA-46).
Fig. 2：It is the flow chart of the p46 genetic fragments for being capable of prokaryotic expression prepared by the present invention.
Fig. 3：It is the PCR qualification figures at p46 gene 210bp, 303bp and 662bp of present invention preparation after A-G mutation.
Fig. 4：It is the digestion qualification figure at p46 gene 210bp, 303bp and 662bp of present invention preparation after A-G mutation.
Fig. 5：It is that the present invention prepares the BLAST figures before and after mycoplasma hyopneumoniae p46 gene mutations.
Fig. 6：It is the electrophoresis picture of the PCR identifications of recombinant plasmid pYA-46 prepared by the present invention.
M in figure：DNA Marker(DL2000)1：pYA-46
Fig. 7：It is the digestion qualification result electrophoretogram of recombinant plasmid pYA-46 prepared by the present invention.
M 1 in figure：DNA Marker(DL15000)M2：DNA marker(DL2000)1：pYA-46(SalI/
HindIII)
Fig. 8：It is the structure flow chart of Salmonella choleraesuls C500 (pYA-46) prepared by the present invention.
Fig. 9：It is the PCR qualification figures of Salmonella choleraesuls C500 (pYA-46) prepared by the present invention.
M in figure：DNA Marker(DL2000)1：C500(pYA-46)
Figure 10：It is the secreting, expressing for detecting Cpro-46 in C500 (pYA-46) with Western-blot.
M in figure：Prestained Protein Ladder 1：Amalgamation and expression PROTEIN C pro-46
Figure 11：It is the growth curve chart of Salmonella choleraesuls C500 (pYA-46) prepared by the present invention.
Figure 12：It is Salmonella choleraesuls C500 (pYA-46) the genetic stability result of present invention preparation.
M in figure：DNA marker(DL 2000)1-10：1-50 for recombinant bacterial strain-：C500 (pYA3493) is compareed；
Figure 13：It is anti-pig pneumonia in Salmonella choleraesuls C500 (pYA-46) immune serum prepared by the present invention
Substance IgG antibody level.
Figure 14：The cell induced after Salmonella choleraesuls C500 (pYA-46) immune mouse for being present invention preparation is exempted from
The analysis result of epidemic disease level.
Figure 15：It is the mycoplasma hyopneumoniae immunogene memebrane protein p46 genetic fragments of present invention clone.It is shown that in bracket
The position of the base of mutation.
Specific embodiment
Below in conjunction with Figure of description, the present invention is further illustrated.The techniqueflow of the present invention is as shown in Figure 1.
The clone of the genetic fragment of 1 mycoplasma hyopneumoniae p46 albumen of embodiment
The cloning process of mycoplasma hyopneumoniae p46 GFP fragments is as shown in Figure 2.
1st, it is as shown in table 1 that the primer be capable of the p46 genetic fragment of prokaryotic expression needed for is prepared.
Table 1 prepares the primer being capable of needed for the p46 genetic fragments of prokaryotic expression
Table 1 is illustrated：Primer underscore part is restriction enzyme site.
2nd, prepared by the p46 genetic fragments of prokaryotic expression
With porcine mycoplasmal pneumonia live vaccine strain Mhp168 strains (purchased from Nanjing Tianbang Bio-industry Co., Ltd.'s porcine mycoplasmal lung
Scorching live vaccine, the live vaccine include mycoplasma hyopneumoniae Mhp168 strains and adjuvant) genomic DNA that extracts (extracting method according to
The bacterial genomes DNA extraction kit specification operation of TIANGEN Biotech (Beijing) Co., Ltd.) it is masterplate, using such as table
Primer p46 (BamH I)/p46 (HindIII) PCR amplification p46 gene segments shown in 1, amplification system are as follows：
After 94 DEG C of denaturations 5min, circulated as follows：94 DEG C of denaturation 45s, 55 DEG C of annealing 45s, 72 DEG C of extension 1min
30s, 30 circulations, last 72 DEG C of 10min.After the completion of amplification, 8 μ L of PCR primer are taken, add 1 μ 10 × Loading of L
Buffer, carries out electrophoresis with 0.8% Ago-Gel, and EB is dyeed, and observes result.With reference to BioFlux companies glue reclaim after electrophoresis
Kit specification carries out the purifying of genes of interest.Cloned prokaryotic expression carrier pGEX-KG ((big purchased from precious bioengineering
Even) Co., Ltd), construction recombination plasmid pGEX-KG-46, and convert bacillus coli DH 5 alpha.With the primer p46 shown in table 1
(a1) ibid system and condition expand recombinant plasmid pGEX-KG-46 to/p46 (a2), (are purchased from using glue reclaim kit after running glue
BioFlux companies of the U.S., operate according to the specification of the kit) carry out after glue reclaim, cut using restriction enzyme Dpn I
Removing template, converts after recovery to bacillus coli DH 5 alpha, picking single bacterium colony, goes out positive colony through PCR and digestion evaluation and screening, repeats
The plasmid of positive colony after carrying out second and the 3rd A-G rite-directed mutagenesis, is extracted, Escherichia coli JM105 is converted, is entered performing PCR
Identify with digestion and be sequenced.The preparation flow of the p46 genetic fragments of prokaryotic expression is as shown in Figure 2.Its PCR and digestion qualification result
As shown in Figure 3 and Figure 4.The result that sequencing result carries out BLAST with p46 original sequences is as shown in Figure 5.As can be seen here, described
Rite-directed mutagenesis is bases G to base A at 210bp, 303bp and 662bp of p46 genetic fragments, and obtaining being capable of prokaryotic expression
The genetic fragment of mycoplasma hyopneumoniae p46 albumen (its nucleotide sequence is shown in SEQ IDNO：1 and sequence shown in Figure 15, Figure 15
It is base mutation site in bracket).
The structure of 2 recombinant plasmid pYA-46 of embodiment and identification
The construction method of recombinant plasmid pYA-46 is as shown in Figure 8.
1st, the primer needed for construction recombination plasmid pYA-46 is shown in Table 2.
Primer needed for 2 recombinant plasmid pYA-46 of table
Table 2 is illustrated：Primer underscore part is restriction enzyme site.
2nd, the structure and authentication method of recombinant plasmid pYA-46
As shown in Figure 8, being capable of the plasmid pGEX-KG-46 of prokaryotic expression mycoplasma hyopneumoniae p46 genes after rite-directed mutagenesis
For template, enter performing PCR with the primer p46 (SalI) shown in table 2/p46 (HindIII) and expand and reclaim, recovery product and will wear
Shuttle plasmid pYA3493 (being given by Washington, DC university Dr.Roy Curtiss professors III) carry out respectively Sal I and
HindIII double digestions, connect after recovery, by the Escherichia coli x7213 of connection product electricity conversion disappearance asd genes (by China of the U.S.
Sheng Dun universities Dr.Roy Curtiss professors III give), positive colony is filtered out, so as to construction recombination plasmid pYA-46；Carry
Take pYA-46 plasmids enter performing PCR and digestion identification (see Fig. 6,7), PCR system and condition are with embodiment 1.
The structure of the Salmonella choleraesuls C500 (pYA-46) of the expression Cpro-46 fusion proteins of embodiment 3 and identification
The construction method of Salmonella choleraesuls C500 (pYA-46) is as shown in Figure 8.Above-mentioned identification is correctly recombinated matter
Grain pYA-46 electricity conversion (parameters：Voltage 2.0KV, time 4ms, electric capacity 25 μ F and 200 Ω of pulse resistance) to asd gene-deleted strains
C500 competent cells (referring to document：Xu Yindi etc., Salmonella choleraesuis C500 strain Δ crp Δ asd gene-deleted strain balance is caused
The structure of dead carrier system and identification. bioengineering journal, 2006,5 (3)：366-371. is attached with regard to providing hog cholera to the public
The promise of salmonella attenuated vaccine strain C500 Δ crp Δ asd gene-deleted strains proves 1 part).Salmonella choleraesuls C500 (pYA-
46) structure flow process is as shown in Figure 8.Picking single bacterium colony cultivated on DAP feminine gender flat boards, with the primer p46 shown in table 2
(SalI)/p46 (HindIII) enters performing PCR evaluation and screening positive colony (see Fig. 9)；PCR system and condition are with embodiment 1.As a result
Show that the recombinant salmonella choleraesuis containing pYA-46 plasmids for being obtained build correct, applicant is named as hog cholera
Salmonella (Salmonella choleraesuis) C500 (pYA-46), and it is military to deliver Hubei Province on April 2nd, 2011
China typical culture collection center (CCTCC) preservation in Wuhan University of Chinese city, its preserving number are CCTCCNO：M2011106.
The biological characteristics of the salmonella choleraesuis strain C500 (pYA-46) of the expression Cpro-46 fusion proteins of embodiment 4
1st, the expression characterization analysis of Salmonella choleraesuls C500 (pYA-46)
The single bacterium colony of picking Salmonella choleraesuls C500 (pYA-46) in TSB culture mediums (purchased from U.S. company BD),
37 DEG C of 200r/min cultivate 12h, 4 DEG C of placement 12h, and 1: 100 ratio switching TSB fluid nutrient mediums are further cultured for 6h by volume,
8000 × g is centrifuged 10min collects thallines, and supernatant is through 0.22 μm of membrane filtration, plus the ice-cold 20% trichloroacetic acid ice bath of equal-volume
20min, 12000r/min are centrifuged 20min, and precipitation 1mL absolute ethanol washings, 12000r/min are centrifuged 5min, repeated washing 1
Secondary.The albumen of gained is made one with anti-mycoplasma hyopneumoniae positive serum (voluntarily the preparing) of pig to resist, HRP marks goat-anti pig IgG
Antibody (purchased from Southern Biotech companies of the U.S.) is anti-as two, carries out Western-blot identifications (see Figure 10), as a result
Show Salmonella choleraesuls C500 (pYA-46) the energy secreting, expressing fusion proteins of the present invention, the fusion protein can be with the pig of pig
There is specific reaction in Eaton agent pneumonia positive serum antibody.
2nd, the phenotypic evaluation of Salmonella choleraesuls C500 (pYA-46)
Respectively by Salmonella choleraesuls C500 (pYA-65), (original number is C500 to parental source bacterial strain C500；Bacterial classification
Deposit number：cvcc79500；Purchased from Beijing China veterinary drug supervision institute) and CpYA (pYA3493) (by shuttle plasmid
PYA3493 (being given by Washington, DC university Dr.Roy Curtiss professors III)) electricity conversion asd gene-deleted strains C500 senses
Receive state cell, preparation process with embodiment 3) streak inoculation in TSA flat boards, be then transferred to respectively arabinose, galactitol,
Mannose, maltose, wood sugar, urea, glucose, lactose, rhamnose, sucrose and hydrogen sulfide, carry out biochemical reaction.Observe these
Can bacterial strain utilize whether these carbon sources and hydrogen sulfide, the phenotype so as to judge recombinant bacterial strain change.As a result show pig of the present invention
The biochemical characteristic of cholera salmonella C500 (pYA-65) and CpYA (pYA3493) is consistent with parent strain C500：Can
It is carbon source using mannose, maltose, glucose, rhamnose, it is impossible to using arabinose, lactose, sucrose, urea and sulfuration
Hydrogen, meets the typical phenotype feature of Salmonella choleraesuls.
4th, the growth characteristics analysis of Salmonella choleraesuls C500 (pYA-46)
Salmonella choleraesuls C46 (pYA-46) is inoculated in TSB culture mediums, 37 DEG C of overnight incubations, with volume ratio as 1
: 100 ratio switching TSB culture mediums, 37 DEG C of 200r/min cultures, OD600 is surveyed every 1h samplings, and draw growth curve.With
Quadrat method draws parent plant C500, asd gene-deleted strain C500 and the growth of empty control plasmid bacterial strain CpYA (pYA3493) is bent
Whether line, growth characteristics and the speed for comparing them are consistent.Pig is can be seen that suddenly from the growth curve (see Figure 11) of recombinant bacterial strain
The growth tendency of random salmonella C500 (pYA-46), CpYA (pYA3493) and parent strain C500 is consistent, but hog cholera sramana
The speed of growth of Salmonella C500 (pYA-46) is slightly slow compared with CpYA and C500, C500-Then because of disappearance asd gene amplification speed
Most slow.
5th, the genetic stability of Salmonella choleraesuls C500 (pYA-46)
By Salmonella choleraesuls C500 (pYA-46) in the flat lining out training of TSA culture mediums (purchased from U.S. company BD)
Support, in TSB culture mediums, 37 DEG C of 200r/min are cultivated picking single bacterium colony, by volume the ratio switching TSB liquid for 1: 100
12h is cultivated in culture medium, and the ratio by volume for 1: 100 is transferred in TSB culture mediums again, is carried out continuously 50 switchings.
The culture for taking the generation of the 1st, 5,10,15,20,25,30,35,40,45 and 50 containing identical CFU respectively is template, with table 2
Shown primer p46 (SalI)/p46 (HindIII) enters performing PCR detection something lost of the recombinant plasmid in asd gene-deleted strain C500
Pass stability.The electrophoresis result (see Figure 12) of PCR shows that can amplify purpose band per 5 generations, its size and brightness do not have
Difference, this explanation Salmonella choleraesuls C500 (pYA-46) can stablize heredity.
Embodiment 5 prepares bivalent genetic engineering vaccine using Salmonella choleraesuls C500 (pYA-46)
After Salmonella choleraesuls C500 (pYA-46) is cultivated on TSA solid mediums, picking single bacterium colony in
Cultivate in TSB fluid nutrient mediums, until viable bacteria concentration reaches 2.5 × 1010CFU/mL.By C500 (pYA-46) bacterium solution of gained from
Bacterial solution is pressed after the heart：Gelatin protective agent (volume: volume) for 2: 1 ratio add gelatin protective agent (the gelatin protective agent is matched somebody with somebody
Method processed is：With sucrose 40g, gelatin 8g in per 100mL deionized waters, after fully melting, in 121 DEG C of high pressure steam sterilizations
Save backup after 30min), the packing of 2.0mL/ bottles is pressed in the lyophilized bottle of sterilizing, put in -50 DEG C of freeze driers and be lyophilized, be lyophilized 36-
40h rear pressing covers, using physiological saline solution and carry out count plate (CFU), and guarantee, without living contaminants, to be placed in -20 DEG C
Save backup, as the vaccine strains for developing bivalent genetic engineering vaccine.
The biological experiment of 6 present invention of embodiment
By Salmonella choleraesuls C500 (pYA-46) with 6 × 108The concentration of CFU/mL, is exempted from by intramuscular injection and oral three kinds
The BALB/c small white mouses (purchased from Disease Prevention Control Center, Hubei Prov) of epidemic disease approach 6 week old female SPFs of immunity.Exempted from every 2 weeks
Epidemic disease 1 time, carries out 2 immunity altogether.Immunizing dose is 200 μ L.Detection immune serum mycoplasma hyopneumoniae antibody and
IFN-γ and IL-4 levels.After Salmonella choleraesuls C500 (pYA-46) immune mouse, anti-p46 eggs can be detected in serum
White specific IgG antibodies, and intramuscular immunity effect is best.After splenocyte using the p46 antigenic stimulus immune mouses of purifying,
Analysis result shows：The IFN-γ of the bivalent vaccine intramuscular immunity group of the present invention is lower than oral immunity group, and IL-4 contents are suitable.
Compared with commercialized vaccine, the IFN-γ of the bivalent vaccine oral immunity of the present invention is high, and IL-4 contents are more relatively low, but
Difference is not significantly (P ＞ 0.05).The specific IgG antibody of anti-mycoplasma hyopneumoniae, and intramuscular immunity effect is can detect that in serum
Fruit is preferably (see Figure 13).The cell that Salmonella choleraesuls C500 (pYA-46) is evaluated by the detection to IFN-γ and IL-4 is exempted from
Epidemic disease level, as a result visible IFN-γ and IL-4 levels are higher, and the IFN-γ of intramuscular immunity group and IL-4 levels are above mouth
Take immune group (see Figure 14).As can be seen here, generate for mycoplasma hyopneumoniae after bivalent vaccine immune mouse of the invention
Specific antibody, illustrates that the recombinant bacterial strain can express external source fusion protein Cpro-46, with immunogenicity, and adopts intramuscular injection side
Formula effect is best.In order to more fully understand that the immunologic mechanism of Salmonella choleraesuls C500 (pYA-46) of the present invention, spy are carried out
The monitoring of two aspects of humoral immunity and cellular immunity.Result of the test shows that the bivalent genetic engineering vaccine of the present invention is swashing
Also cellular immunity is have activated while humoral immunity living, and Study On Cellular Immune is especially pronounced.
Bibliography：
[1] Schoen C, Stritzker J, Goebel W, et al.Bacteria as DNA vaccine
Carriers for genetic immunization.Int J Med Microbiol, 2004,294：319-335
[2] Helen L B, Kate F G, Steven M J, et al.Antibody responses to Yersinia
pestis Flantigen expressed in Salmonella typhimurium aroA from in vivo-
Inducible promoters [J] .Vaccine, 2000,18：2668-2676
[3] Medina E, Guzman C A.Use of live bacterial vaccine vectors for
antigen delivery：Potential and limitations.Vaccine, 2001,19 (13-14)：1572-1580
[4] Dietrich G, Spreng S, Gentschev I et al.Bacterial systems for the
delivery of eukaryotic antigen expression vectors.Antisense Nucleic Acid Drug
Dev, 2000,10 (5)：391-399.
[5] Bumann D, Hueck C, Aebischer T, et al.Recombinant live Salmonellas
pp.for human vaccination against heterologous pathogens[J].FEMS Immuology and
Medical Microbiology, 2000,27：357-364.
[6]Fang X W.The Research of Piglet Paratyphoid Attenuated
Vaccine.Edition of Research.China Institute of Veterinary Drug Control, 1978：
1-11.
[7] Futo S, Seto Y, OkadaM, et al.Recombinant 46-kilodalton surface
antigen(P46)of Mycoplasma hyopneumoniae expressed in Escherichia coli can be
used for early specific diagnosis of mycoplasmal pneumonia of swine by
Enzyme-linked immunosorbent assay [J] .Journal ofClinicalMicrobiology, 1995,33
(3)：680-683.
[8] Wise K.S., Kim M.F., Major membrane surface proteins of Mycoplasma
Hyopneumoniae selectively modified by covalently bound lipid.J Bacteriol,
1987,169 (12)：546-555.
[9] Cheikh Saad Bouh K, Shareck F, Dea S.Monoclonal Antibodies to
Escherichia coli-Expressed P46and P65Membranous Proteins for Specific
Immunodetection of Mycoplasma hyopneumoniae in Lungs of Infected Pigs[J]
.Clinical and Diagnostic Laboratory Immunology, May 2003,10 (3)：459-468.
Claims (2)
1. salmonella choleraesuis strain (Salmonella choleraesuis) C500 (pYA-46) of a plant weight group, its feature
It is, the preserving number of described bacterial strain is CCTCCNO：M2011106, it are prepared via a method which to obtain：
1) with the genetic fragment of primer pair amplifies mycoplasma hyopneumoniae memebrane protein p46 as follows, and it is subcloned to original
In nuclear expression vector pGEX-KG, build and obtain recombinant plasmid pGEX-46, the nucleotide sequence of the primer pair is as follows：
Forward primer：CCCGGATCCATGAAAAAAATGCTTA,
Reverse primer：CCCAAGCTTTTAGGCATCAGGATTA；
The recombinant plasmid includes a kind of main immunogenic memebrane protein-p46 albumen for being capable of prokaryotic expression mycoplasma hyopneumoniae
Genetic fragment, the nucleotide sequence of the genetic fragment is as follows：
ATGAAAAAAA TGCTTAGAAA AAAATTCTTG TATTCATCAG CTATTTATGC AACTTCGCTT
GCATCAATTA TTGCATTTGT TGCAGCAGGT TGTGGACAGA CAGAATCAGG TTCGACTTCA
GATTCTAAAC CACAAGCCGA GACTCTAAAA CATAAAGTAA GTAATGATTC TATTCGAATA
GCACTAACCG ATCCGGATAA TCCTCGATG(A/G)ATTAGTGCCC AAAAAGATAT TATTTCTTAC
GTCGATGAAA CAGAGGCAGC AACTTCAACA ATTACAAAAA ACCAGGATGC ACAAAATAAC
TG(A/G)CTCACTC AGCAAGCTAA TTTAAGTCCA GCGCCAAAAG GATTTATTAT TGCCCCTGAA
AATGGAAGTG GAGTTGGAAC TGCTGTTAAT ACAATTGCTG ATAAAGGAAT TCCGATTGTT
GCCTATGATC GACTAATTAC TGGATCTGAT AAATATGATT GGTATGTTTC TTTTGATAAT
GAAAAAGTTG GCGAATTACA AGGTCTTTCA CTTGCGGCGG GTCTATTAGG AAAAGAAGAT
GGTGCTTTTG ATTCAATTGA TCAAATGAAT GAATATCTAA AATCACATAT GCCCCAAGAG
ACAATTTCTT TTTATACAAT CGCGGGTTCC CAAGATGATA ATAATTCCCA ATATTTTTAT
A(A/G)TGGTGCAA TGAAAGTACT TAAAGAATTA ATGAAAAATT CGCAAAATAA AATAATTGAT
TTATCTCCTG AAGGCGAAAA TGCTGTTTAT GTCCCAGGAT GGAATTATGG AACTGCCGGT
CAAAGAATCC AATCTTTTCT AACAATTAAC AAAGATCCAG CAGGTGGTAA TAAAATCAAA
GCTGTTGGTT CAAAACCAGC TTCTATTTTC AAAGGATTTC TTGCCCCAAA TGATGGAATG
GCCGAACAAG CAATCATCAA ATTAAAACTT GAAGGATTTG ATACCCAAAA AATCTTTGTA
ACTGGTCAAG ATTATAATGA TAAAGCCAAA ACTTTTATCA AAGACGGCGA TCAAAATATG
ACAATTTATA AACCTGATAA AGTTTTAGGA AAAGTTGCAG TTGAAGTTCT TCGGGTTTTA
ATTGCAAAGA AAAATAAAGC ATCTAGATCA GAAGTCGAAA ACGAACTAAA AGCAAAACTA
CCAAATATTT CATTTAAATA TGATAATCAA ACATATAAAG TGCAAGGTAA AAATATTAAT
ACAATTTTAG TAAGTCCAGT AATTGTTACA AAAGCTAATG TTGATAATCC TGATGCCTAA
A210-G210 is respectively present at 210bp, 303bp and 662bp of above-mentioned sequence；A303-G303；A662-G662's
Artificial bases' rite-directed mutagenesis；
2) three pairs of primers are utilized by p46 GFPs fragment 210bp, 303bp of mycoplasma hyopneumoniae and base A at 662bp
Rite-directed mutagenesis is bases G, and the nucleotide sequence of the primer is as follows：
Forward primer：AATCCTCGATGGATTAGTGCC,
Reverse primer：CCATCGAGGATTATCCGGAT；
Forward primer：CAAAATAACTGGCTCACTCAG,
Reverse primer：CCAGTTATTTTGTGCATCCTG；
Forward primer：TCCCAGGATGGAATTATGGAA,
Reverse primer：CCATCCTGGGACATAAACAGC.
2. a kind of Salmonella choleraesuls and porcine mycoplasmal pneumonia bivalent vaccine, it is characterised in that include sequence table SEQ ID
NO：Gene described in 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110087938.8A CN102732473B (en) | 2011-04-08 | 2011-04-08 | The recombinant salmonella choleraesuis of expression mycoplasma hyopneumoniae p46 albumen and preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110087938.8A CN102732473B (en) | 2011-04-08 | 2011-04-08 | The recombinant salmonella choleraesuis of expression mycoplasma hyopneumoniae p46 albumen and preparation method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102732473A CN102732473A (en) | 2012-10-17 |
| CN102732473B true CN102732473B (en) | 2017-03-15 |
Family
ID=46988776
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110087938.8A Expired - Fee Related CN102732473B (en) | 2011-04-08 | 2011-04-08 | The recombinant salmonella choleraesuis of expression mycoplasma hyopneumoniae p46 albumen and preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102732473B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9951109B2 (en) * | 2013-11-21 | 2018-04-24 | Agricultural Technology Research Institute | Composition for preventing Mycoplasma spp. infection |
| CN105012948B (en) * | 2014-04-18 | 2019-07-30 | 普莱柯生物工程股份有限公司 | A kind of vaccine composition and its application |
| CN104248753B (en) * | 2014-05-15 | 2017-07-28 | 普莱柯生物工程股份有限公司 | A kind of vaccine combination and its application |
| CN105154377B (en) * | 2015-07-17 | 2020-02-11 | 河南科技大学 | Recombinant salmonella pullorum, preparation method and application |
| CN107693497B (en) * | 2017-11-03 | 2021-02-09 | 兆丰华生物科技(南京)有限公司 | Quick freeze-drying method for 50-part live vaccine of mycoplasma hyopneumoniae |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101880647B (en) * | 2009-09-11 | 2012-04-25 | 华中农业大学 | Recombinant salmonella choleraesuis, bivalent genetic engineering vaccine and application |
-
2011
- 2011-04-08 CN CN201110087938.8A patent/CN102732473B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101880647B (en) * | 2009-09-11 | 2012-04-25 | 华中农业大学 | Recombinant salmonella choleraesuis, bivalent genetic engineering vaccine and application |
Non-Patent Citations (5)
| Title |
|---|
| GenBank Accession NO.D16682.1;NCBI;《NCBI GenBank》;19990204;全文 * |
| GenBank Accession NO.YP116021.1;NCBI;《NCBI GenBank》;20100401;全文 * |
| Molecular cloning of a 46-kilodalton surface antigen (P46) gene from Mycoplasma hyopneumoniae: direct evidence of CGG codon usage for arginine.;S Futo et al.;《Journal of Bacteriology》;19950430;p.1915–1917 * |
| 猪霍乱沙门氏菌C500ΔcrpΔasd株缺失株平衡致死载体系统的构建及鉴定;徐引弟等;《生物工程学报》;20060531;第366-372页 * |
| 表达猪肺炎支原体免疫原性基因的重组猪霍乱沙门氏菌对小鼠的免疫原性;马丰英等;《微生物学报》;20110904;第1270-1277页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102732473A (en) | 2012-10-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Simionatto et al. | Mycoplasma hyopneumoniae: from disease to vaccine development | |
| CN101905018B (en) | Recombinant fusion protein vaccine and attenuated live vector vaccine for treating and preventing helicobacter pylori (Hp) infection | |
| CN102732473B (en) | The recombinant salmonella choleraesuis of expression mycoplasma hyopneumoniae p46 albumen and preparation method and application | |
| CN103013895B (en) | Genetic engineering live vaccine of recombinant Salmonella choleraesuis and Porcine epidemic diarrhea virus, preparation and application | |
| CN104593397A (en) | Optimized enterotoxigenic escherichia coli-producing polyvalent antigen gene sequence and application thereof in preventing weaned piglet diarrhea | |
| CN101880647B (en) | Recombinant salmonella choleraesuis, bivalent genetic engineering vaccine and application | |
| US9358283B2 (en) | Diatom-based vaccines | |
| CN105087616B (en) | A kind of fusion of mycoplasma hyopneumoniae and preparation method thereof | |
| CN101157907B (en) | Recombinant salmonella choleraesuis strain for expression of pig origin bordetella bronchisepatica fhaB and prn gene segment, bacterin and uses thereof | |
| AU2017202354B2 (en) | Attenuated Mannheimia haemolytica vaccines and methods of making and use | |
| KR101151004B1 (en) | Vaccine composition for protection and treatment against pathogenic Escherichia coli and Salmonella in cattle by administration of attenuated Salmonella expressing adhesin gene of pathogenic Escherichia coli and vaccination method thereof | |
| CN104988107B (en) | A kind of recombinant Lactobacillus of high efficient expression foot-and-mouth disease virus antigen gene and its preparation method and application | |
| CN105154377B (en) | Recombinant salmonella pullorum, preparation method and application | |
| CN103421733B (en) | A kind of haemophilus parasuis-Salmonella choleraesuls bigeminy gene engineering vaccine | |
| CN110229234A (en) | A kind of haemophilus parasuis fusion protein CdtB-OppA with immune protective | |
| CN101991863B (en) | Double-target DNA vaccine and constructing method thereof | |
| Jiao et al. | Immunization effect of recombinant Lactobacillus casei displaying Aeromonas veronii Aha1 with an LTB adjuvant in carp | |
| CN103421732B (en) | Express the Salmonella choleraesuls attenuated vaccine of haemophilus parasuis surface antigen | |
| CN102676570B (en) | Recombinant bacillus subtilis immunoglobulin binding protein functional-domain expression vector and application thereof | |
| CN101962625A (en) | Salmonella choleraesuis gene deletion mutant without resistant marker and vaccine thereof | |
| CN102732472A (en) | Construction and application of attenuated Salmonella choleraesuis for expressing mycoplasma hyopneumoniae p65 protein | |
| CN101037664A (en) | Bacterin for pleuropneumonia actinobacillus serotype 1 double-gene deletion mutant without resistance marker | |
| CN110240657A (en) | A kind of haemophilus parasuis fusion protein AfuA-OppA2 with immune protective | |
| WO2013185337A1 (en) | Edwardsiella tarda mutant strain and application thereof | |
| Kwon | Comparison of the immunogenicity between bacterial ghost and formalin-killed bacteria for Vibrio vulnificus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CP01 | Change in the name or title of a patent holder |
Address after: 430070 1 Lion Rock street, Hongshan District, Wuhan, Hubei Co-patentee after: WUHAN KEQIAN BIOLOGICAL Co.,Ltd. Patentee after: HUAZHONG AGRICULTURAL University Address before: 430070 1 Lion Rock street, Hongshan District, Wuhan, Hubei Co-patentee before: WUHAN KEQIAN ANIMAL BIOLOGICAL PRODUCTS Co.,Ltd. Patentee before: Huazhong Agricultural University |
|
| CP01 | Change in the name or title of a patent holder | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170315 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |