KR20110000854A - Composition of food additives of piglets containing igy from egg yolk for preventing of porcine epidemic diarrhea or transmissible gastroenteritis - Google Patents

Abstract

PURPOSE: An additive composition for a piglet feed containing egg yolks is provided to prevent the side effect or the resistance for antibiotics, and to reduce the resistance of consumers by using natural ingredients. CONSTITUTION: An additive composition for a piglet feed containing egg yolks contains the following: 0.05~9.5wt% of egg yolk containing more than one IgY selected from the group consisting of Salmonella Tiphimurium IgY, Transmissible gastroenteritis virus IgY, Porcine epidemic diarrhea IgY, and E.coli IgY; 47.6~71.6wt% of fructo-oligosaccharide; 0.01~0.11wt% of vitamin B6; 0.02~0.22wt% of inositol; 0.05~1.9wt% of microorganism; and 24.2~44.2wt% of purified water.

Description

Composition of food additives of Piglets containing IgY from egg yolk for preventing of porcine epidemic diarrhea or transmissible gastroenteritis}

The present invention relates to an additive composition for piglet feed, and more particularly, to an piglet feed additive composition comprising a yolk containing a specific antibody against swine pancreatic diarrhea (PEDV) or swine infectious gastroenteritis virus (TGEV). It is about.

Swine infectious gastroenteritis virus (TGEV) and porcine epidemic diarrhea virus (PEDV) belong to the family of coronaviruses, but are susceptible to all ages of pigs, but the incidence and mortality rate is higher among younger pigs

Swine diarrhea (PED) causes mortality of more than 50% in piglets and has clinical symptoms such as acute severe watery diarrhea, vomiting, anorexia and hypogonadism.

Porcine infectious gastroenteritis (TGE) causes malabsorption of diarrhea and vomiting, leading to dehydration, resulting in nearly 100% mortality in piglets less than two weeks of age, causing enormous economic losses to the pig industry. It is very similar to the PED except for that.

On the other hand, TGEV is estimated to have spread domestically from imported sows in Gyeonggi-do in 1954. Since then, TGEV has shown steady occurrence in winter, and PEDV was first reported in Korea in 1993. In recent years, PED has shown much more occurrences than TGE, causing economic damage to pig farms. According to data released by the National Veterinary Research and Quarantine Service during December 2003, TGE occurred in 300 cases per case. On the other hand, in the PED cases, 40,297 heads occurred in 90 cases and 9,195 heads in 45 cases in 2004.

On the other hand, in pig farming countries in Asia where PED is frequently occurring, a method of inoculating live piglets to pregnant pigs to inoculate live pigs with pregnant vaccines to prevent PEDs, and artificially infecting sows with enteric fluid of infected piglets Various methods, such as the method of stimulating immunity, have been sought.

  In the case of TGE, vaccination of oral, nasal, intramuscular, subcutaneous or breast vaccines of attenuated vaccines, attenuated vaccines, inactivated vaccines, and subunit vaccines has been widely used.

However, the above method has difficulty in preventing PED and TGE because it is not easily used in the field due to poor domestic environment or lack of recognition of hog farmers.

Therefore, the present invention is easy to use in farms and is composed of natural ingredients, there is no objection to people, antibiotic resistance and side effects do not occur to provide an additive composition for piglet feed.

The present invention to achieve the above object is Salmonella typhimurium (Salmonella TiphimuriumIgY for Salmonella Cholera suis (Salmonella Choleraesuis), IgY for TGEV (Transmissible gastroenteritis virus), IgY for PEDV (Porcine epidemic diarrhea) or E. coli (Escherichia coliEgg yolk containing any one or more of IgY selected from IgY); Fructooligosaccharides; Vitamin B6; Inositol; Bacillus subtilis (Bacillus subtilis), Bifidobacterium rhomb (Bifidobacterium longum), Lactobacillus permanent (Lactobacillus fermentum), Lactobacillus vulgaris (Lactobacillus bulgaricus), Lactobacillus casei (Lactobacillus casei), Lactobacillus ashdophilus (Lactobacillus acidophilus), Lactobacillus sakei (Lactobacillus sakei), Lactobacillus plantarumLactobacillus plantarum), Lactobacillus lutery (Lactobacillus reuteri), Lactobacillus lactis (Lactobacillus lactis), Leukonostock mesenteroid (Leuconostoc mesenteroides), Ryukonostock Kimchi I (Leuconostoc kimchii), Leukonostock Citrium (Leuconostoc citreum), Ryukonostock Kashikomitatum (Leuconostoc gasicomitatum), Leukonostock lactis (Leuconostoc lactis) Or Streptococcus thermophilus (Streptococcus thermophilusAt least one microorganism selected from; And purified water; provides a piglet feed additive composition comprising a mixture of the mixture.

Hereinafter will be described in detail with respect to the problem solving means of the present invention.

  Porcine epidemic diarrhea (PED) is a gastrointestinal disease with vomiting and watery diarrhea as the main symptom. It is thin in the intestinal wall and filled with yellow aqueous fluid. It causes more than 50% mortality in piglets and has clinical symptoms such as vomiting, loss of appetite and depression.

Transmissible gastroenteritis (TGE) is a highly infectious, acute infectious disease that occurs frequently between winter and spring, and excretes into the stool rather than the virus in the urine. It causes dehydration due to malabsorption of diarrhea and vomiting, which leads to almost 100% mortality in piglets less than 1 week old, and has rapid propagation and high mortality in piglets.

The present invention IgY for children ages the more you can IgY, salmonella cholera for sure Salmonella typhimurium (Salmonella Tiphimurium) in order to prevent the onset of incidence and gastroenteritis or the flu diarrhea, high pig infectious mortality database (Salmonella Choleraesuis) described above , IgY for TGEV (Transmissible gastroenteritis virus), IgY for Porcine epidemic diarrhea (PEDV) or Escherichia coli ) and yolk containing any one or more of IgY selected from IgY.

Egg yolk antibodies are a form of passive immunization using the bird's immune system. In the case of sub-avian oval animals, the immune antibodies obtained by active chickens from the mother chicken are transferred to egg yolk and the immune function is transmitted to the offspring. The largest proportion of antibodies in egg yolk is IgY, similar to IgG in the blood. Its molecular weight is about 200-220kDa, which is larger than mammalian IgG and has advantages over mammalian antibodies.

Meanwhile, the present invention provides Salmonella typhimurium ( Salmonella) to produce egg yolk containing the antibody IgY against viruses causing swine pandemic diarrhea or infectious gastroenteritis. Tiphimurium , Salmonella Choleraesuis ), TGEV (Transmissible gastroenteritis virus), Porcine epidemic diarrhea (PEDV), and Escherichia coli ) was cultured to prepare a vaccine, and the vaccine was then administered to the laying hens at a time interval up to the third inoculation. After inoculation, the antibody titer was the highest titer from 4 weeks after the 3rd inoculation, and after the inoculation at 10 weeks when the antibody titer began to decrease, the eggs with high antibody titers up to 5-14 weeks Only egg yolk was collected and obtained.

On the other hand, piglet feed additive composition of the present invention includes fructooligosaccharide, fructooligosaccharide has a proliferative effect of Bifidobacteria or lactic acid bacteria, inhibit Salmonella (Salmonella) and Crosstridium perfringens (Clostridium perfringens). In particular, in the present invention can be used as a sweetener to alleviate the rejection of piglets appearing when eating feed.

On the other hand, piglet feed additive composition of the present invention includes vitamin B6, vitamin B6 can prevent dermatitis while promoting the growth of piglets.

On the other hand, the piglet feed additive composition of the present invention includes inositol, since inositol is crystallized and sweet like sugar, it can not only relieve the rejection of piglets ingesting the feed, but also promote the development of piglets and arteries. Prevent hardening.

On the other hand, the piglet feed additive composition of the present invention Bacillus subtilis ( Bacillus subtilis), rongum Bifidobacterium (Bifidobacterium longum ), Lactobacillus fermentum), Lactobacillus Bulgaria carcass (Lactobacillus bulgaricus), Lactobacillus casei (Lactobacillus casei ), Lactobacillus acidophilus ), Lactobacillus sakei), Lactobacillus Planta Room (Lactobacillus plantarum ), Lactobacillus reuteri ), Lactobacillus lactis ), Leuconostoc mesenteroides ), Leuconostoc kimchii , Leuconostoc citreum ), Leuconostoc gasicomitatum ), Leuconostoc lactis ) or Streptococcus thermophilus ) includes any one or more microorganisms selected from the group, the microorganisms have antimicrobial, antiviral, immune enhancing effect on the piglets when ingesting piglets.

On the other hand, in the experimental example of the present invention, Salmonella typhimurium (Salmonella Tiphimurium) IgY, Salmonella choleraesuis could device (Salmonella Choleraesuis) IgY, PEDV (Porcine for IgY, TGEV (Transmissible gastroenteritis virus) for about included in the present invention E. coli IgY and on epidemic diarrhea) (Escherichia coli ) was tested for the prevention of swine pandemic diarrhea (PED) and swine infectious gastroenteritis (TGE) of egg yolk containing IgY. And Escherichia coli ) was maintained high, the number of E. coli isolated from piglets was low, and transmissible gastroenteritis virus (TGEV) and Porcine epidemic diarrhea (PEDV) were detected in small intestine and min.

As a result of preparing the piglet feed additive composition of the present invention containing the specific antibody egg yolk as described above and ingesting it directly in piglets, it was confirmed that the accidental head count was significantly reduced compared to the control group. 4.7% was confirmed that the excellent effect of the present invention.

On the other hand, piglet feed additive composition of the present invention is preferably egg yolk 0.05 ~ 9.5% by weight; Fructooligosaccharide 47.6-71.6 wt%; 0.01 to 0.11 weight percent of vitamin B6; Inositol 0.02-0.22 wt%; Bacillus subtilis subtilis), rongum Bifidobacterium (Bifidobacterium longum ), Lactobacillus fermentum), Lactobacillus Bulgaria carcass (Lactobacillus bulgaricus), Lactobacillus casei (Lactobacillus casei ), Lactobacillus acidophilus ), Lactobacillus sakei), Lactobacillus Planta Room (Lactobacillus plantarum ), Lactobacillus reuteri ), Lactobacillus lactis ), Leuconostoc mesenteroides , Leuconostoc kimchii ), Leuconostoc citreum ), Leuconostoc gasicomitatum ), Leuconostoc lactis ) or Streptococcus thermophilus ) 0.05 to 1.9 wt% of any one or more microorganisms selected from; And 24.2 to 44.2% by weight of purified water.

As described above, the piglet feed additive composition of the present invention will prevent significant economic losses in the swine industry due to swine pandemic diarrhea (PED) causing mortality of 50% or more or swine infectious gastroenteritis (TGE) causing 100% mortality. Can be.

In addition, the use of natural piglet feed additives can reduce consumer's rejection.

Hereinafter, the configuration and operation of the present invention will be described in more detail with reference to the following examples, but the scope of the present invention is not limited to the following examples, and includes modifications of equivalent technical spirit.

Example  1: Salmonella Tippy Museum ( Salmonella Tiphimurium )on  About IgY , Salmo Nella Cholera suis ( Salmonella Choleraesuis )on  About IgY , TGEV ( Transmissible  gastroenteritis virus For) IgY , PEDV ( Porcine epidemic diarrhea For) IgY  And E. coli ( Esherichia coli For) IgY Containing Egg yolk  Produce

Example 1 is IgY for Salmonella Tiphimurium , IgY for Salmonella Choleraesuis , IgY for TGEV (Transmissible gastroenteritis virus), IgY for Escherichia coli (PEDV) and E. coli (E. coli) Esherichia egg yolk containing IgY for coli ) was prepared.

Stage 1: Antigen Production

Salmonella typhimurium (Salmonella Tiphimurium , Salmonella Choleraesuis ), TGEV (Transmissible gastroenteritis virus), Porcine epidemic diarrhea virus (PEDV), and Escherichia coli ) was anaerobicly cultured in blood in a 37 ° C. incubator for 1-2 days. After confirming the colonies (colony), inoculated in the prepared BHI broth and incubated for 1 to 2 days in a 37 ℃ shaking incubator (shaking incubator). The obtained culture was inactivated with 0.3% formalin, then centrifuged at 10000 × g, and then inactivated with 0.1% formalin. The concentration was adjusted to 10 ¹² cell / ml using a Spectrophotometer.

Step 2: Vaccine Preparation

After mixing the strain cultured in step 1 and mineral oil (ISA 70) in a 3: 7 ratio, and then emulsified using a homogenizer (Hmogenizer), the aseptic test and inactivation confirmation test.

Step 3: Salmonella Tippy Museum ( Salmonella Tiphimurium )on  About IgY , Salmonel la Cholera suis ( Salmonella Choleraesuis )on  About IgY , TGEV ( Transmissible  gastroenteritis virus For) IgY , PEDV ( Porcine epidemic diarrhea For) IgY  And E. coli ( Esherichia coli Specific antibody to Egg yolk  production

The vaccine prepared in step 2 was inoculated into the chest at 2 weeks intervals by 1 ml in a 22-week-old Hy-Line Brown laying hen, followed by 'Boosting' after 6 weeks after the third inoculation of antibody titers.

The titer of yolk yolk was measured by 'Indirect ELISA Method', and the measurement samples were measured weekly by collecting yolk from 1 week after inoculation to 2 weeks after booster vaccination. The yolk antibody activity was measured by applying the ELISA method used by Mine (1997).

Antigen was coated at a concentration of 200 ng / ml in 96 well polystyrene plate (well poly styrene plate) and left overnight at 4 ℃. After washing with PBS-T (phosphate buffer saline, 0.05% Tween 20, pH 7.4), 1h / 37 ℃ blocking with PBS buffer containing 2% BSA (Blocking) and washed in the same manner as described above. The negative control group, the positive control group and the sample were diluted by 2 ×, and 100 µl of each well was added and allowed to stand at 37 ° C. for 1 hour. The appropriately diluted secondary antibody was reacted in the same manner as the sample treatment and developed for 10 minutes, and then the absorbance was measured at 492 mm using an ELISA Reader.

Step 4: Egg yolk powder  Produce

Eggs from 5 to 14 weeks with IgY antibody titers greater than 160X of the negative control were concentrated and egg yolks were harvested after freezing and egg yolk powder (hereinafter referred to as 'specific antibody yolk powder'). Produced.

In the following experimental example oral administration of specific antibody yolk (IgY) Between experimental and unadministered controls Statistical analysis was performed on the significance test at the level ( P <0.05) by Duncan's new multiple ttest using SARS (Ver 6.12, USA).

Experimental Example  1: specific antibody From egg yolk The obtained IgY Administration to piglets

Taking into account the maternal parity, 20 piglets were fed that did not consume colostrum of sows in labor. The experimental group (Group I) orally administered the specific antibody egg yolk powder (IgY) 2ml each for 10 days from the colostrum from the colostrum, and the control group (Group II) did not administer the antibody yolk powder under the same conditions. 2 mL of saline solution was administered for 3 days. Mammal pigs of the experimental group and the control group were put into each experimental pig room for 24 hours, and then, blood was collected and weight was measured at each day of challenge at 4 days of age (FIG. 1).

During the experiment, substitute oil (Dondon Milk, Cheil Jedang Food Co., Ltd.) was fed according to the manufacturer's recommendation, and drinking water was freely consumed.

Experimental Example  2: TGEV ( Transmissible gastroenteritis virus ), PEDV ( Porcine epidemic diarrhea ) And E. coli ( Esherichia coli Antibody to Titer  inspection

In the experiment 1, blood was collected from the jugular vein and coagulated for antibody titer test to check the passive immunity of piglets orally administered with the specific antibody yolk powder. After transfer to (eppendorf tube) was inactivated for 30 minutes at 56 ℃ used. Antibody titer was performed by ELISA.

  The results of antibody titer test using ELISA are shown in FIGS. 2 to 4, which are summarized in Table 1 below.

process PED ELISA Titer 0 7 10 Group Ⅰ (Experimental Group) 0.66 ± 0.17 ^a 0.65 ± 0.10 ^a 0.72 ± 0.08 ^a Group Ⅱ (Control) 0.68 ± 0.15 ^a 0.59 ± 0.07 ^a 0.59 ± 0.08 ^b process TGE ELISA Titer 0 7 10 Group Ⅰ (Experimental Group) 0.75 ± 0.34 ^a 0.84 ± 0.05 ^a 0.85 ± 0.07 ^b Group Ⅱ (Control) 0.86 ± 0.13 ^a 0.72 ± 0.33 ^a 0.72 ± 0.11 ^a process E. coli ELISA titer 0 7 10 Group Ⅰ (Experimental Group) 0.66 ± 0.07 ^a 0.79 ± 0.07 ^a 0.79 ± 0.08 ^a Group Ⅱ (Control) 0.68 ± 0.15 ^a 0.74 ± 0.11 ^a 0.72 ± 0.06 ^b

As a result of the antibody titer test (Table 1), the average serum antibody titers of the PEDV test group and the control group 7 days and 10 days before challenge, and 0.66 ± 0.17, 0.68 ± 0.15 before challenge, respectively. After 7 days, it was 0.65 ± 0.10, 0.59 ± 0.07, and on the 10th day after challenge, 0.72 ± 0.08, 0.59 ± 0.08. In the case of TGEV, the mean serum antibody values of the experimental and control groups before and after challenge and on days 7 and 10 were 0.75 ± 0.34, 0.86 ± 0.13 before challenge, and 0.84 ± 0.05 and 0.72 ± 0.33 before challenge, respectively. On the 10th day after challenge, it was 0.85 ± 0.07, 0.72 ± 0.11. In the case of Escherichia coli, the mean serum antibody values of the experimental and control groups before and after challenge and 7 and 10 days of challenge, respectively, were 0.66 ± 0.07, 0.68 ± 0.15 before challenge and 0.79 ± 0.07 and 0.74 ± 0.11 before challenge. On the 10th day after challenge vaccination was 0.79 ± 0.08 and 0.72 ± 0.06.

The PEDV challenged control group showed a slight decrease in antibody value at 7 days after challenge, and remained similar to 7 days after challenge at 10 days after challenge. The experimental group inoculated with PEDV after the administration of specific antibody yolk showed no change until 7 days after challenge and increased slightly at 10 days after challenge.

 The control group treated with TGEV was significantly decreased at 7 days after challenge and compared with the 7 days after challenge at 10 days after challenge. In the experimental group challenged with TGEV after the administration of specific antibody yolk, the increase was significantly increased at 7 days after challenge and only slightly increased at 7 days after challenge.

The control group inoculated with E. coli increased slightly on days 7 and 10 after challenge vaccination, but the experimental group inoculated with E. coli after challenge with specific antibody yolk increased more than the control group on days 7 and 10 after challenge challenge.

Experimental Example  2: Piglets  Determination of E. coli Isolated from Minutes

In Experimental Example 2, the number of E. coli isolated from the piglets orally administered with the specific antibody yolk powder in Experimental Example 1 was measured.

As a result of the measurement (FIG. 5), after the administration of the specific antibody yolk powder than the control group inoculated with E. coli, it was confirmed that the number of E. coli isolated from the experimental group challenged with E. coli.

Experimental Example  3: specific antibody Egg yolk  Administered Piglets  In the small intestine and minutes RT - PCR By PEDV, TGEV  detection

 In Experimental Example 1, feces were taken from the rectum of experimental pigs with a daily sterilized swab to investigate whether PEDV and TGEV were discharged through feces of piglets challenged with PEDV and TGEV. In order to check the PEDV in the small intestine of the dead piglets, the small intestine tissues were crushed into pestles, mixed in sterile 500 µl PBS (pH 7.2), mixed well, and centrifuged at 14,000 rpm for 20 minutes. RT-PCR was carried out by storage at -70 ° C.

In order to specifically detect PEDV, 'forward primer' is designed to amplify a fragment of 412bp size with 5'GGGCGCCTGTATAGAGTTTA3 'and' reverse primer 'with 5'AGACCACCAAGAATGTGTCCCC'.

  TGEV can be detected specifically 'forward primer' is 5'GATGGCGACCAGATAGAAGT3 ',' reverse primer 'is 5'GCAATAGGGTTGCTTGTACC3' is designed to amplify 612bp fragment.

RNA  extraction

RNA extraction from fecal and small intestine tissues was performed using the RNeasy Mini kit (QIAGEN, Germany).

Reverse transcription  reaction( Reverse transcription ; RT )

Reverse transcription reaction was performed by 5 μl RNA template, 0.2 μM pair of 'reverse primer', 31 μl diethylpyrocarbonate (DEPC) treated distilled water, 10 × RT buffer (MBI, Lithuania), After adding 0.2 mM dNTPs (MBI), 40 unit RNasin (Promega, USA), 2.5 mM MgCl ₂ (Promega) and reacting at 65 ° C for 10 minutes, 200 μl MBI (Molony murine leukemia virus reverse transcriptase) was added and 50 μl of CDNA was synthesized by performing one cycle at 42 ° C for 1 hour and 94 ° C for 5 minutes.

Polymerase chain reaction PCR )

To 5 μl cDNA synthesized in reverse transcription reaction, 0.2 μM primer, 10 × PCR buffer, 2.5 unit Taq DNA polymerase, 0.2 mM dNTPs, 2.5 mM MgCl ₂ , and 32 μl of sterilized distilled water 50 μl of the reaction solution was added once under reaction conditions of 94 ° C. 5 minutes, 51.5 ° C. 45 seconds, and 72 ° C. 1 minute, followed by 95 ° C. 45 seconds, 51.5 ° C. 45 seconds, and 72 ° C. one minute. Repeated 30 times at 51.5 ℃ 45 seconds, was performed once at 72 ℃ 5 minutes reaction conditions.

 Confirmation of the amplified PCR product was performed by electrophoresis on a 1% agarose gel using TAE buffer (40 mM Trisacetate, 1 mM EDTA, pH 8.0), followed by 40 mM etidium bromide solution. In the gel (dye), the band generated by 'UV transilluminator (Vilberlourmat, France)' was identified. As a DNA marker, a 100 bp DNA ladder (Promega, USA) was used.

group Piglets
number Feces Intestine accumulate
detection
(%) Days after challenge accumulate
detection(%) -One 0 One 2 3 4 5 6 7 8 9 10 Group Ⅰ
(Experimental group) One - - - T - T - - - - - - TGEV
26/100
(26)


PEDV
3/100
(3) - 0/10
(0) 2 - - T T T T T - - - - - - 3 - - P - PT T PT - - - - - - 4 - - - - T T - - - - - - - 5 - - - - - - - - - - - - - 6 - - T T - - - - - - - - - 7 - - - - T - - - - - - - - 8 - - - T T T T - - - - - - 9 - - - T T T T T T T - - - 10 - - - - - - - - - - - - - Group Ⅱ
(Control group) One - - - P T PT T T T - - -
TGEV
39/91
(42.8)


PEDV
20/91
(21.9)
-

2/10
(20.0)
2 - - T - T T - T T - - - - 3 - - - P P P T T T - - - - 4 - - T TP PT PT T - T - - - - 5 - - - P T T T T T - - - - 6 - - T P T P T - T - - - - 7 - - - P P P P - P P - - - 8 - - T T T T T T - - - - - 9 - - - P P P D + 10 - - - T T T T T - D + a):-; negative, +; positive.
b): D = died.

As a result of detection of PEDV and TGEV by RT-PCR in small and small piglets treated with specific antibody yolk powder (Table 2), PEDV was detected in feces until 5 days after challenge challenge. TGEV was detected in feces until day 8. From 1 to 10 days after challenge vaccination, PEDV was detected in 3 cases and TGEV was detected in 26 cases and 3% and 26%, respectively.

In the control group, PEDV was detected in 20 cases and PGEV in 39 cases and TGEV was detected in 21 cases from 21 days to 10 days after challenge vaccination, and 21.9% and 42.8%, respectively. Detected. The detection rate of TGEV and PEDV was lower in the experimental group than in the control group.

Example  2: Piglets  Preparation of feed additives

In Example 2, an additive for piglets was prepared using the specific antibody yolk powder obtained in Example 1 above.

Specific antibody yolk powder 20g; 240 g of fructooligosaccharides; 0.4 g of vitamin B6; 0.4 g of inositol; Bacillus subtilis subtilis ), Lactobacillus fermentum ), 3.24 g of microorganisms including Leuconostoc mesenteroides ; And 136 ml purified water was added to prepare an additive for piglets feed.

Experimental Example  4: Piglets  Determination of the Effect of Feed Additives

Only from 10 days to 50 days of age, the feed additive prepared in Example 2 was ingested, and when it was 70 days of age, body weight and total head count were measured. The feed rate of the feed additive of Example 2 was added to 0.6% by weight in piglets 10 days to 21 days, 0.4% by weight from 21 days to 35 days, 0.2% by weight from 35 days to 50 days of age. The control group is piglets fed the feed without the feed additive prepared in Example 2 above.

First, in general, the incidence rate, onset age, onset pattern, mortality rate, mortality age, autopsy findings for 1500 weaning heads per month are shown in Table 3 below.

Monthly Nipples 1500 two Incidence 30-40% Onset age 35 days of age Onset Rough hair, reduced feed intake, double breathing, residue acupuncture, diarrhea Mortality 80% mortality Dead age After 40 days of age (40-50 days of age concentrated) Autopsy findings Pericarditis, Fibrous exudate in the lungs and abdominal cavity, Gastric ulcers, Lymphadenopathy and bleeding, Pneumonia

The effect of ingesting the piglet feed additives carried out in Experimental Example 4 in the piglets is shown in Table 4 in comparison with the control group.

Control Experimental group Average weight (kg) 6.29 6.33 Starting head 322 363 End 256 346 End weight (kg) 25.5 27.3 Total accidents 96 17 atrophy 24 4 Our company 56 9 Culling 16 4 Accident Rate (%) 28.0 4.7

FIG. 6 was prepared to compare the end mean body weight and the accident rate of the control group and the experimental group shown in Table 4.

As a result, the experimental group showed significantly lower atrophy and mortality than the control group, and did not cause bacterial and dietary dissociation.

And as a result of applying this to 0-8 weeks piglets in four farms (Fig. 7), the experimental group was confirmed that significantly reduced atrophy and mortality compared to the control group.

1 is an experimental diagram in which the piglets of the experimental group and the control group were put into each experimental pig room for 24 hours, followed by challenge inoculation at 4 days of age, and blood samples were collected at different times.

FIG. 2 is a diagram illustrating antibody titers by collecting blood from each of the experimental group and the control group at 10 days before inoculation of PEDV at 4 days of age and at 7 days after inoculation.

FIG. 3 is a diagram illustrating antibody titers by collecting blood for 10 heads each of the experimental group and the control group at 7 days and 10 days after inoculation with TGEV at 4 days of age.

FIG. 4 is a diagram illustrating antibody titers by collecting blood for each of two groups, each of the experimental group and the control group, at 7 days and 10 days after inoculation with E. coli at 4 days of age.

5 is a diagram showing the number of Escherichia coli separated from the experimental group and the control group daily after inoculation of E. coli.

Figure 6 is a diagram showing the weight and accident rate after ingesting the piglet feed additive composition of the present invention in piglets.

7 is a diagram showing the atrophy and mortality of the control group after applying the piglet feed additive composition of the present invention to the piglets 0 to 8 weeks in four farms.

Claims (2)

IgY for Salmonella Tiphimurium , IgY for Salmonella Choleraesuis , IgY for TGEV (Transmissible gastroenteritis virus), IgY for PEPV (Porcine epidemic diarrhea) or Escherichia egg yolk containing any one or more of IgY selected from IgY for coli ); Fructooligosaccharides; Vitamin B6; Inositol; Bacillus subtilis subtilis), rongum Bifidobacterium (Bifidobacterium longum ), Lactobacillus fermentum), Lactobacillus Bulgaria carcass (Lactobacillus bulgaricus), Lactobacillus casei (Lactobacillus casei ), Lactobacillus acidophilus ), Lactobacillus sakei), Lactobacillus Planta Room (Lactobacillus plantarum ), Lactobacillus reuteri ), Lactobacillus lactis ), Leuconostoc mesenteroides ), Leuconostoc kimchii , Leuconostoc citreum ), Leuconostoc gasicomitatum ), Leuconostoc lactis ) or Streptococcus thermophilus ) any one or more microorganisms selected from; Pigment feed additive composition comprising a mixture of; and purified water; The method of claim 1, Pigment feed additive composition, Egg yolk 0.05 to 9.5% by weight; Fructooligosaccharide 47.6-71.6 wt%; 0.01 to 0.11 weight percent of vitamin B6; Inositol 0.02-0.22 wt%; Bacillus subtilis , Bifidobacterium longum ), Lactobacillus fermentum), Lactobacillus Bulgaria carcass (Lactobacillus bulgaricus), Lactobacillus casei (Lactobacillus casei ), Lactobacillus acidophilus ), Lactobacillus sakei), Lactobacillus Planta Room (Lactobacillus plantarum ), Lactobacillus reuteri ), Lactobacillus lactis ), Leuconostoc mesenteroides ), Leuconostoc kimchii , Leuconostoc citreum ), Leuconostoc gasicomitatum ), Leuconostoc lactis ) or Streptococcus thermophilus ) 0.05 to 1.9 wt% of any one or more microorganisms selected from; And purified water 24.2 ~ 44.2 wt% composition for piglet feed, characterized in that the composition.

Images