CN102851263A

CN102851263A - High-throughout screening method of lipase gene mutation database and lipase mutation gene

Info

Publication number: CN102851263A
Application number: CN2011101833038A
Authority: CN
Inventors: 于洪巍; 毛爱军; 王珏; 王丹; 宣姚吉
Original assignee: Wilmar Shanghai Biotechnology Research and Development Center Co Ltd
Current assignee: Wilmar Shanghai Biotechnology Research and Development Center Co Ltd
Priority date: 2011-07-01
Filing date: 2011-07-01
Publication date: 2013-01-02
Anticipated expiration: 2031-07-01
Also published as: CN102851263B

Abstract

The invention relates to a high-throughout screening method of lipase gene mutation database, and lipase mutation gene and its encoding lipase obtained from the screening method. Comparing to the method in the prior art, the inventive method has higher sensitivity. The invented lipase has higher activity than wild type lipase. The invention also relates to a reaction system for screening lipase.

Description

Lipase gene mutation library high-throughput screening method and lipase mutator gene

Technical field

The invention belongs to bioengineering field.Particularly, the present invention relates to a kind of lipase gene mutation library high-throughput screening method and reach the new lipase mutator gene that thus screening obtains.

Background technology

Lipase (E.C.3.1.1.3) also claim the acylglycerol lytic enzyme; it is the enzyme that a class has multiple catalytic capability; can the catalysis triglyceride and the hydrolysis of some other water-insoluble ester classes, can also be used for the reverse reaction reaction of catalyzed transesterification, alcoholysis reaction, transesterification and ester class, and the fractionation of synthetic, the catalysis optically active isomer of bio-surfactant and chiral drug is synthetic etc.Lipase is used widely in many fields such as Foodgrain and oilseed production, foodstuffs industry, daily chemical industry, oil chemical industry, agrochemical industry, paper industry, detergent industry and medicine are synthetic.Aspect grease production and oil and fat chemical, lipase has the huge applications potentiality.Utilize its specificity catalytic performance, change fatty acid chain in glyceryl ester the position or replace one or more new lipid acid and modify ester, the glyceride stock of cheapness is processed into expensive structured lipid, such as theobroma oil, OPO, single glycosides fat and glycosides two fat etc.

Improving the catalysis of lipase than vigor, is one of effective approach that reduces the lipase production cost.The present invention is to have 1,3 narrow spectrum rhizomucor miehei lipases are research object, at first adopt fallibility PCR method (ep-PCR), in intestinal bacteria, set up the lipase mutation library, by new high-throughput screening method, mutation library is screened, obtained the RML sudden change lipase and the corresponding mutator gene that improve than vigor.

Summary of the invention

The invention provides a kind of isolated polypeptide, described polypeptide is selected from:

(1) aminoacid sequence shown in the SEQ ID NO:4,6,8,10 or 12; With

(2) process replaces, lacks or adds one or several amino acid in (1) described aminoacid sequence, but keep at least take the aminoacid sequence of SEQ ID NO:2 numbering the 57th amino acids residue as Val, and have lipase activity by (1) derivative polypeptide.

In one embodiment, in the aminoacid sequence numbering of SEQ ID NO:2, above-mentioned (2) described polypeptide at least also keeps one or more following locational residues: the 67th Ala, the 111st Thr, the 168th Pro and the 65th Ala.

The invention provides a kind of polynucleotide of separation, the polynucleotide of described separation are selected from:

(1) polynucleotide of coding polypeptide of the present invention; With

(2) with the polynucleotide of (1) described polynucleotide complementation.

In one embodiment, the polypeptide of this polynucleotide encoding shown in SEQ ID NO:4,6,8,10 or 12.

In one embodiment, the nucleotide sequence of these polynucleotide is shown in SEQ ID NO:3,5,7,9 or 11.

The invention provides a kind of carrier, it contains polynucleotide of the present invention.

The invention provides a kind of genetically engineered host cell, described host cell contains carrier of the present invention or polynucleotide.

The invention provides a kind of method of screening lipase, described method comprises with triglyceride level carries out enzymolysis as the substrate of lipase to be screened and filters out the step of the lipase that improves than vigor according to the colour-change that the pH indicator produces.

In one embodiment, said method comprising the steps of:

(1) provides lipase to be screened;

(2) provide the solution that contains pH indicator and low-grade alkyl carboxylic acid's salt;

(3) triglyceride level is added in the solution of step (2), obtains mixed solution;

(4) lipase is added in the mixed solution of step (3) gained; With

(5) variation of observation mixed solution color, the colour-change that produces according to the pH indicator filters out the lipase that improves than vigor.

In one embodiment, described triglyceride level is that the fatty acid carbons chain length is the triglyceride level of 12-22.

In one embodiment, described low-grade alkyl carboxylic acid's salt is the IIA family metal-salt of long 2-6 carbon atom alkyl carboxylic acid.

In one embodiment, described pH indicator is selected from dibromothymolsulfonphthalein, phenolsulfonphthalein, methylenum coeruleum, toluylene red, methyl red, tetrabromo-mcresolsulfonphthalein, tropeolin-D, tetrabromophenol sulfonphthalein, Congo red or its combination.

In one embodiment, described method also comprises uses wild-type lipase in contrast, goes out the lipase that improves than vigor by contrasting the lipase to be screened color that produces and the dithering that contrast produces.

In one embodiment, described method is to use porous plate to screen.

In one embodiment, described method also comprises:

Set up lipase sudden change library;

Express sudden change lipase.

In one embodiment, described method also comprises: adopt alkali titration that the screen lipase that obtains is carried out multiple sieve, filter out the lipase that improves than vigor.

The invention provides a kind of reaction system for screening lipase, described reaction system contains:

(1) triglyceride level; With

(2) pH indicator.

In one embodiment, described reaction system also contains low-grade alkyl carboxylic acid's salt.

In one embodiment, the described reaction system meter of per 200 μ l, described reaction system contains Tris buffered soln and 80～120 μ l triglyceride level solution of 0.1～0.3M low-grade alkyl carboxylic acid salt of pH indicator solution, 50～70 μ l of 15～25 μ l, wherein, to be the pH indicator be dissolved in the Tris damping fluid with the concentration of 0.3～1.5mg/L to described pH indicator solution, and to be triglyceride level be dissolved in the solution that organic solvent obtains with the volume ratio of 1:4～6 to described triglyceride level solution.

In one embodiment, the pH of described reaction system is in 4.0～9.0 scope.In one embodiment, the pH of described reaction system is in 5.0～9.0 scope.In other specific embodiment, the pH of described reaction system is in 4.0～7.0 scope.In other specific embodiment, the pH of described reaction system is in 7.0～9.0 scope.

Description of drawings

Fig. 1 shows screening method susceptibility the result.

Fig. 2 shows the result who adopts the inventive method and currently known methods that catalytic activity of lipase is screened.

Fig. 3 shows the PCR result of lipase gene.No. 1 swimming lane is for being used for being cloned into the PCR fragment of pET30a carrier, and No. 2 swimming lanes are for being used for being cloned into the PCR fragment of pET32a carrier, and No. 3 swimming lanes are for being used for being cloned into the PCR fragment of pET22b carrier.

Fig. 4 shows the positive colony evaluation.Wherein, A figure shows the positive colony evaluation of pET30a-lipase, and B schemes the positive colony of demonstration pET32a-lipase and identifies, the positive colony evaluation of C figure demonstration pET22b-lipase, the arrow indication is the band of lipase gene, and the clone who the target stripe shown in the arrow occurs is positive colony.

Fig. 5 shows that recon carries out the SDS-PAGE electrophoresis result of carrying out behind the abduction delivering.M: protein electrophorese Marker; C: compare after the thalline ultrasonication of not inducing; 1: take pET32a as carrier, the albumen size of expression is approximately 50kD; 2: take pET30a as carrier, the albumen size of expression is about 38kD; 3: take pET22b as carrier, the albumen size of expression is about 38kD.The arrow indication is the recombinant lipase protein band.

Fig. 6 shows fallibility PCR result.

Fig. 7 show lipase transform through orthogenesis and fixed point after than the variation tendency of vigor.

Fig. 8 shows the typical curve of Xylene Brilliant Cyanine G survey protein concn.

Fig. 9 shows the idiographic flow of the acid base titration that the present invention adopts.

Embodiment

As used herein, " separation " refers to that material separates (if natural substance, primal environment namely is natural surroundings) from its primal environment.Do not have separation and purification such as the polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.

As used herein, " isolated polypeptide " or " lipase of separation " refers to that lipase is substantially free of natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein Purification of Lipase of standard.

Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferred recombinant polypeptide.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (for example, bacterium, yeast, filamentous fungus, higher plant, insect and mammalian cell).The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated.

In the present invention, term " lipase " comprises the polypeptide shown in the SEQ ID NO:4,6,8,10 or 12 with lipase activity.This term also comprise have the lipase function, SEQ ID NO:4,6,8,10 or 12 variant form.These variant forms comprise (but being not limited to): one or more (for example 1-10,1-5 best, more preferably, 1-3) amino acid whose disappearance, insertion and/or replacement, and add or lack one or several (being generally in 10, more preferably is in 5) amino acid at C-terminal and/or N-terminal.For example, in the art, when replacing with the close or similar amino acid of performance, usually can not change the function of protein.Preferred described variant form comprises one or more (for example 1-10,1-5 best, more preferably, 1-3 is individual), and conservative property replaces." conservative property replacement " is to utilize a kind of amino-acid residue with similar side chain to substitute another kind of amino-acid residue.Family's existing clearly definition in this area with similar side chain.These families comprise amino acid with basic side chain (Methionin for example, arginine, Histidine), amino acid (aspartic acid for example with acid side-chain, L-glutamic acid), amino acid (glycine for example with uncharged polar side chain, l-asparagine, glutamine, Serine, Threonine, tyrosine, halfcystine), amino acid (L-Ala for example with non-polar sidechain, α-amino-isovaleric acid, leucine, the Isoleucine proline(Pro), phenylalanine, methionine(Met), tryptophane), amino acid (Threonine for example with β-branched building block, α-amino-isovaleric acid, Isoleucine) and have the amino acid (tyrosine for example of aromatic side chain, phenylalanine, tryptophane, Histidine).

Should be understood that preferably they have kept the sudden change on the specifically noted of the present invention mutational site for SEQ ID NO:4 of the present invention, 6,8,10 and 12 variant form." reservation " refers to the sudden change of variant form on having specifically noted of the present invention mutational site of polypeptide of the present invention in this article, also contain other variation, for example on other one or more (preferred 1～5, more preferably 1～3) site, occur to insert as previously described, lack or suddenly change.For example, to keep at least the 57th residue be Val to the variant form of polypeptide of the present invention.In other embodiments, to keep at least the 57th residue be that Val and the 168th are Pro to described variant form.In other embodiments, to keep at least the 57th residue be that Val and the 111st are Thr to described variant form.In other embodiments, to keep at least the 57th residue be that Val and the 67th are Ala to described variant form.In other embodiments, to keep at least the 57th residue be Val, the 67th to described variant form is Thr for Ala and the 111st.In other embodiments, to keep at least the 57th residue be Val, the 67th to described variant form is Pro for Thr and the 168th for Ala, the 111st.In other embodiments, to keep at least the 57th residue be Val, the 65th to described variant form is Pro for Ala, the 111st for Thr and the 168th for Ala, the 67th.

In addition, as well known to those skilled in the art, in the gene clone operation, usually need to design suitable restriction enzyme site, this certainly will introduce one or more incoherent residues at expressed albumen end, and this does not affect the activity of target protein.And for example for the expression of construction of fusion protein, promotion recombinant protein, the purifying that obtains automatically to be secreted into the outer recombinant protein of host cell or be beneficial to recombinant protein, usually need with some aminoacid addition to the N-of recombinant protein is terminal, C-is terminal or this albumen in other appropriate area in, for example, include but not limited to the joint peptide that is fit to, signal peptide, leading peptide, terminal extension etc.The aminoterminal of lipase of the present invention or carboxyl terminal also can contain one or more polypeptide fragments, as the albumen label.Any suitable label may be used to the present invention.For example, described label can be FLAG, HA, HA1, c-Myc, Poly-His, Poly-Arg, Strep-TagII, AU1, EE, T7,4A6, ε, B, gE and Ty1.These labels can be used for albumen is carried out purifying.Following table has been listed some labels and sequence thereof wherein.

Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:3,5,7,9 or 11 or the varient of degeneracy.As used herein, " varient of degeneracy " refer in the present invention to encode SEQ ID NO:4, protein of 6,8,10 or 12, but with shown in the SEQ ID NO:3,5,7,9 or 11 shown in the differentiated nucleotide sequence of coding region sequence.

Term " polynucleotide of coded polypeptide " can be the polynucleotide that comprise this polypeptide of encoding, and also can be the polynucleotide that also comprise additional code and/or non-coding sequence.

The invention still further relates to and above-mentioned sequence hybridization and two sequences between have at least 50%, preferably at least 70%, the polynucleotide of at least 80% homogeny more preferably.The present invention be more particularly directed to and of the present invention polynucleotide interfertile polynucleotide lower at stringent condition (or stringent condition).In the present invention, " stringent condition " refers to: (1) than the hybridization under low ionic strength and the comparatively high temps and wash-out, such as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time is added with denaturing agent, such as 50% (v/v) methane amide, 0.1% bSA/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 90%, be more preferably 95% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in the SEQ ID NO:4,6,8,10 or 12.

The invention still further relates to the nucleic acid fragment with above-mentioned sequence hybridization.As used herein, the length of " nucleic acid fragment " better is between 15～30 Nucleotide at 15～50 Nucleotide.Nucleic acid fragment can be used for the amplification technique (such as PCR) of nucleic acid to determine and/or to separate the polynucleotide of coding lipase.

Polypeptide among the present invention preferably provides with the form of separating with polynucleotide, more preferably is purified to homogeneous.

Lipase Nucleotide full length sequence of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.

In case obtained relevant sequence, just can obtain in large quantity relevant sequence with recombination method.This normally is cloned into carrier with it, changes cell over to again, then separates obtaining relevant sequence from the host cell after the propagation by ordinary method.

In addition, also can synthesize relevant sequence, especially fragment length more in short-term with the method for synthetic.Usually, by first synthetic a plurality of small segments, and then connect and to obtain the very long fragment of sequence.

At present, can be fully obtain the dna sequence dna of code book invention albumen (or its fragment, or derivatives thereof) by chemosynthesis.Then this dna sequence dna can be introduced in various existing dna moleculars as known in the art (or such as carrier) and the cell.In addition, also can will suddenly change by chemosynthesis and introduce in the protein sequence of the present invention.

The method of using round pcr DNA amplification/RNA is optimized for and obtains gene of the present invention.When particularly being difficult to from the library, obtain the cDNA of total length, can preferably use RACE method (the terminal rapid amplifying method of RACE-cDNA), the primer that is used for PCR can suitably be selected according to sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is such as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.

The present invention also relates to comprise the carrier of polynucleotide of the present invention, and the host cell that produces through genetically engineered with carrier of the present invention or lipase encoding sequence, and the method that produces polypeptide of the present invention through recombinant technology.Preferably, carrier of the present invention is expression vector.

By the recombinant DNA technology of routine, can utilize polymerized nucleoside acid sequence of the present invention to can be used to express or the lipase of Restruction.In general following steps are arranged:

(1). with the polynucleotide (or varient) of coding lipase of the present invention, or transform or transduction appropriate host cell with the recombinant expression vector that contains these polynucleotide;

(2). the host cell of in suitable medium, cultivating;

(3). separation, protein purification from substratum or cell.

Among the present invention, the polynucleotide sequence of coding lipase can be inserted in the recombinant expression vector.Term " recombinant expression vector " refers to bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell is viral, mammalian cell is viral such as adenovirus, retrovirus or other carrier.As long as can copy in host and stablize, any plasmid and carrier can be used.A key character of expression vector is usually to contain replication orgin, promotor, marker gene and translation controlling elements.Expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.

Method well-known to those having ordinary skill in the art can be used for making up fatty enzyme DNA sequences encoding and suitable transcribing/the translate expression vector of control signal.These methods comprise extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technology of body etc.Described dna sequence dna can be effectively connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; Lambda particles phage PL promotor; But eukaryotic promoter comprises CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, the LTRs of retrovirus and the promotor that some other known controlling gene is expressed in protokaryon or eukaryotic cell or its virus.

In addition, expression vector preferably comprises one or more selected markers, phenotypic character with the host cell that is provided for selecting transforming, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness such as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance.

Comprise above-mentioned suitable dna sequence dna and the suitable carrier of promotor or control sequence, can be used for transforming suitable host cell, with can marking protein.

Host cell can be prokaryotic cell prokaryocyte, such as bacterial cell; Or the eukaryotic cell such as low, such as yeast cell; Filamentous fungal cells or higher eucaryotic cells are such as mammalian cell.Representative example has: intestinal bacteria, streptomyces; The bacterial cell of Salmonella typhimurium; Fungal cell such as yeast, filamentous fungus, vegetable cell; The insect cell of fruit bat S2 or Sf9; The zooblast of CHO, COS, 293 cells or Bowes melanoma cells etc.

When polynucleotide of the present invention are expressed in higher eucaryotic cells, be enhanced if will make to transcribe when in carrier, inserting enhancer sequence.Enhanser is the cis acting factor of DNA, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.

Persons skilled in the art are all known the suitable carrier of How to choose, promotor, enhanser and host cell.

Can carry out with routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can in exponential growth after date results, be used CaCl ₂Method is processed, and used step is well-known in this area.Another kind method is to use MgCl ₂If necessary, transforming also the method for available electroporation carries out.When the host is eukaryote, can select following DNA transfection method: calcium phosphate precipitation, conventional mechanical method such as microinjection, electroporation, liposome packing etc.

The transformant that obtains can be cultivated with ordinary method, expresses the polypeptide of coded by said gene of the present invention.According to used host cell, substratum used in the cultivation can be selected from various conventional mediums.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (such as temperature transition or chemical induction), cell is cultivated for some time again.

The extracellular be expressed or be secreted into to recombinant polypeptide in the above methods can in cell or at cytolemma.If necessary, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation processes, process the combination of (salt analysis method), centrifugal, the broken bacterium of infiltration, super processing, ultracentrifugation, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods with protein precipitant.

Screening method of the present invention can may further comprise the steps:

(1) provides lipase to be screened;

(4) lipase is added in the mixed solution of step (3) gained; With

Being applicable to triglyceride level of the present invention can be that the fatty acid carbons chain length is the triglyceride level of 12-22, includes but not limited to sweet oil, Zoomeric acid triglyceride level, linoleic acid triglyceride, a-linolenic acid triglyceride level, r-linolenic acid triglyceride level, 8A8, suitable-5,8,11,14,17-timnodonic acid (EPA) triglyceride level, suitable-4,7,10,13,16,19-docosahexenoic acid (DHA) triglyceride level etc.

Triglyceride level can be formulated in the organic solvent, and organic solvent includes but not limited to DMF, DMSO, polyvinyl alcohol, Sudan Gum-arabic etc.

Be applicable to the IIA family metal-salt that low-grade alkyl carboxylic acid's salt of the present invention comprises long 2-6 carbon atom alkyl carboxylic acid, include but not limited to calcium salt and the magnesium salts of acetic acid, propionic acid, butyric acid etc.In a preferred embodiment, described low-grade alkyl carboxylic acid's salt is calcium acetate.

Be applicable to pH indicator of the present invention comprise various at pH 4.0～9.0 (for example, in 4.0～7.0 scope, perhaps in 7.0～9.0 scope, perhaps in 5.0～9.0 scope, perhaps in 5.0～8.0 scope) the lower pH indicator that develops the color, include but not limited to dibromothymolsulfonphthalein, phenolsulfonphthalein, methylenum coeruleum, toluylene red, methyl red, tetrabromo-mcresolsulfonphthalein, tropeolin-D, tetrabromophenol sulfonphthalein, Congo red.These pH indicator can use separately, perhaps can mix use.For example, can use the combination of dibromothymolsulfonphthalein and phenolsulfonphthalein, and the combination of phenolsulfonphthalein and methylenum coeruleum.If be used in combination, the ratio of each indicator can be 1: 5～5: 1, preferred 1: 1 in the combination.For example, can use phenolsulfonphthalein and the methylenum coeruleum of 1: 1 dibromothymolsulfonphthalein and phenolsulfonphthalein or 1: 1.

Be used for pH indicator of the present invention and can show shades of colour, only need in implementing process of the present invention, exist colour-change (for example from depth to shallow or from light to dark) get final product, so that observation.

Usually, can prepare with various damping fluids the damping fluid of low-grade alkyl carboxylic acid's salt and pH indicator, if this damping fluid not with this reactant salt.For example, can prepare with the Tris damping fluid damping fluid of low-grade alkyl carboxylic acid's salt and pH indicator.Those skilled in the art can according to state of the art can determine which damping fluid can with low-grade alkyl carboxylic acid's reactant salt.Should be understood that the damping fluid that can prepare respectively low-grade alkyl carboxylic acid's salt and the damping fluid of pH indicator, and then with its mixing; Also both can be added in the damping fluid together and prepare.Be preferred for preparing the damping fluid of low-grade alkyl carboxylic acid's salt with identical for the damping fluid of preparation pH indicator.

The colour-change that method of the present invention shows by the pH indicator is screened the lipase that improves than vigor.The lipase that improves than vigor is screened in the variation that for example, can add by the lipase that more different lipase cause the color of front and back mixed solution.Also can use wild-type lipase in contrast, go out the lipase that improves than vigor by contrasting the lipase to be screened color that produces and the dithering that contrast produces.Usually, colour-change is more obvious, shows that enzyme is alive higher.

The inventive method can use porous plate to screen, and is high-throughput screening method.For example, method of the present invention can use 96 orifice plates to carry out.

Using screening method that porous plate carries out as example, each Kong Zhongke adds the pH indicator solution of about 15～25 μ l, approximately buffered soln, approximately 80～120 μ l triglyceride level solution and the about enzyme liquid of 5～30 μ l of low-grade alkyl carboxylic acid's salt of 50～70 μ l.Solution amount in the hole should be no more than the cubic capacity in hole, and for example, for 96 orifice plates, total solution amount in every hole should be no more than 200 microlitres.

Therefore, in a preferred embodiment, contain the pH indicator solution of 20 microlitres of having an appointment, the about buffered soln of low-grade alkyl carboxylic acid's salt of 60 microlitres in the reaction soln of per 200 microlitres, approximately the triglyceride level solution of 100 microlitres and approximately the enzyme liquid of 20 microlitres.When using other porous plate, can adjust according to the volume of this porous plate hole the volume of each composition in the solution, too much to avoid solution, outside the overfolw hole, cause crossed contamination.

Should be understood that there is no particular restriction for the amount of screening used triglyceride level, pH indicator, low-grade alkyl carboxylic acid's salt.Usually, triglyceride level and low-grade alkyl carboxylic acid's salt can be excessive, as long as the pH indicator can play discoloration indication, do not have concrete the relationship between quantities with enzyme.And the amount of enzyme also is not particularly limited, the enzyme liquid measure all can detect to 100 microlitres from 5 microlitres.Those skilled in the art can select triglyceride level, pH indicator, low-grade alkyl carboxylic acid's salt and the enzyme of appropriate amount to screen according to actual screening situation.

In one embodiment, when independent preparation, the concentration of pH indicator is 0.3～1.5mg/LTris damping fluid in the described pH indicator solution.When using two or more pH indicator simultaneously, its total concn should be within this scope.

In one embodiment, when independent preparation, in the damping fluid of described low-grade alkyl carboxylic acid's salt, the concentration of low-grade alkyl carboxylic acid's salt is 0.1～0.3M.If should be understood that when being added to simultaneously pH indicator and low-grade alkyl carboxylic acid's salt in the damping fluid, within the pH indicator that their concentration separately should be in the mixed solution of the solution gained that mixes above-mentioned independent preparation and the concentration range of low-grade alkyl carboxylic acid's salt.

In one embodiment, to be triglyceride level be dissolved in the solution that organic solvent obtains with approximately 1: 4～6 volume ratio to triglyceride level solution.

Lipase to be screened can obtain by the following method: adopt conventional gene engineering to set up lipase sudden change library; With expression sudden change lipase.This paper embodiment has partly described the object lesson of setting up lipase sudden change library and expressing sudden change lipase.Should be understood that various libraries establishment method known in the art and protein expression method all can be used for implementing the present invention.

After the lipase that adopts the aforesaid method screening to obtain providing than vigor, can adopt alkali titration that the screen lipase that obtains is carried out multiple sieve, filter out the lipase that improves than vigor.An example of alkali titration can be referring to the 2.1st part of the embodiment of the present application 2.More alkali titration can be referring to Brockman H L.Triglyceride lipase from porcine pancrease, Methods Enzymol, 1981,71:619-627; He Yaoqiang, WangBing Wu, Tan Tianwei, the Study on Fermentation of candiyeast 99-125 lipase, biotechnology journal, 2004,20 (6): 918-921; Jiang Huifang, Wang Yaqin, Liu Chunguo, three kinds of Determination Methods for Lipase Activities relatively reach improvement, chemistry and biotechnology, 2007,24 (8): 72-75.

The present invention also provides a kind of reaction system for screening lipase, and this reaction system contains:

(1) triglyceride level; With

(2) pH indicator.

Being applicable to triglyceride level of the present invention can be that the fatty acid carbons chain length is the triglyceride level of 12-22, includes but not limited to sweet oil, the Zoomeric acid triglyceride level, linoleic acid triglyceride, a-linolenic acid triglyceride level, r-linolenic acid triglyceride level, 8A8, suitable-5,8,11,14,17-timnodonic acid (EPA) triglyceride level, suitable-4,7,10,13,16,19-docosahexenoic acid (DHA) triglyceride level etc.

Be applicable to pH indicator of the present invention comprise various at pH 4.0～9.0 (for example, in 4.0～7.0 scope, perhaps in 7.0～9.0 scope, perhaps in 5.0～9.0 scope, perhaps in 5.0～8.0 scope) the lower pH indicator that develops the color, include but not limited to dibromothymolsulfonphthalein, phenolsulfonphthalein, methylenum coeruleum, toluylene red, methyl red, tetrabromo-mcresolsulfonphthalein, tropeolin-D, tetrabromophenol sulfonphthalein, Congo red.These pH indicator can use separately, perhaps can mix use.For example, can use the combination of dibromothymolsulfonphthalein and phenolsulfonphthalein, and the combination of phenolsulfonphthalein and methylenum coeruleum.If be used in combination, the ratio of each indicator can be 1: 5～5: 1, preferred 1: 1 in the combination.For example, can use phenolsulfonphthalein and the methylenum coeruleum of 1: 1 dibromothymolsulfonphthalein and phenolsulfonphthalein or 1: 1.Therefore, the pH scope of reaction system of the present invention between 4.0～9.0, for example, in 4.0～7.0 scope, perhaps in 7.0～9.0 scope, perhaps in 5.0～9.0 scope, perhaps in 5.0～8.0 scope.Those skilled in the art can select different pH scopes and pH indicator according to the screening conditions of reality.

Usually, also contain the organic solvent that is useful on the preparation triglyceride level and the damping fluid that is used for preparation pH indicator and/or low-grade alkyl carboxylic acid's salt in the reaction system of the present invention.Therefore, in one embodiment, reaction system of the present invention contains: triglyceride level, pH indicator, organic solvent and damping fluid, and optional low-grade alkyl carboxylic acid's salt.Organic solvent includes but not limited to DMF, DMSO, polyvinyl alcohol, Sudan Gum-arabic etc.Can prepare with various damping fluids the damping fluid of low-grade alkyl carboxylic acid's salt and pH indicator, if this damping fluid not with this reactant salt.For example, can prepare with the Tris damping fluid damping fluid of low-grade alkyl carboxylic acid's salt and pH indicator.Those skilled in the art can according to state of the art can determine which damping fluid can with low-grade alkyl carboxylic acid's reactant salt.Be preferred for preparing the damping fluid of low-grade alkyl carboxylic acid's salt with identical for the damping fluid of preparation pH indicator.

There is no particular restriction to should be understood that amount for triglyceride level, pH indicator, low-grade alkyl carboxylic acid's salt in the reaction system of the present invention.Usually, triglyceride level and low-grade alkyl carboxylic acid's salt can be excessive, as long as the pH indicator can play discoloration indication, do not have concrete the relationship between quantities with enzyme.

In a reaction system example of the present invention, the described reaction system of per 200 μ l can contain and approximately 80～120 μ l triglyceride level solution and approximately the pH indicator solution of 15～25 μ l.Preferably, to be triglyceride level be dissolved in organic solvent with 1: 4～6 volume ratio to described triglyceride level solution obtains.In the pH indicator solution, the concentration of pH indicator is 0.3～1.5mg/L Tris damping fluid.When using two or more pH indicator, the total concn of pH indicator should be within above-mentioned scope.Randomly, this reaction system also can contain the buffered soln of low-grade alkyl carboxylic acid's salt of 50～70 μ l that have an appointment.The concentration of low-grade alkyl carboxylic acid's salt is generally 0.1～0.3M in the buffered soln of low-grade alkyl carboxylic acid's salt.

Usually, can prepare respectively triglyceride level solution, pH indicator solution and/or low-grade alkyl carboxylic acid's salts solution, and then they are mixed.Therefore, reaction system of the present invention can contain the damping fluid of self-existent triglyceride level solution, pH indicator solution and/or low-grade alkyl carboxylic acid's salt.Perhaps, can simultaneously triglyceride level, pH indicator and/or low-grade alkyl carboxylic acid's salt be added in the mixed solution of for example organic solvent and damping fluid, form the reaction system that exists with the mixed solution form.But should be understood that under the latter event, triglyceride level, pH indicator and/or low-grade alkyl carboxylic acid's salt concentration separately should be in mixing the mixed solution of the independent solution gained of preparation within separately the concentration range in the gained solution after mixing.

Reaction system of the present invention also can test kit form provide.For example, can comprise the container that above-mentioned each solution is housed respectively in the test kit; The container that perhaps, can comprise the mixed solution that mentioned solution is housed in the test kit.Also can comprise such as porous plate that be used for to implement high flux screening in the test kit etc.The working instructions that also can comprise conduct screening method of the present invention in the test kit.

In a preferred embodiment, reaction system of the present invention contains: 20 microlitre indicator (hundred li Finland of bromine and phenolsulfonphthalein, each 0.5mg/mL is dissolved in the Tris damping fluid), 60 microlitre 0.1M calcium acetates and 100ul sweet oil (being dissolved among the DMF by 1: 6).

Should be understood that reaction system of the present invention can be used for high flux screening, so its cumulative volume is generally the volume that is less than each hole of high flux screening usefulness porous plate.Therefore, can select suitable reaction system volume with pore volume according to enzyme liquid to be added is long-pending.Usually, the enzyme liquid measure from 5 microlitres to 100 microlitres all available reaction system of the present invention detect.In addition, when screening without high-throughput, those skilled in the art also can prepare reaction system of the present invention according to practical situation, and not necessarily its volume are limited within the scope mentioned above.

The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition such as Sambrook etc., " molecular cloning: lab guide " (New York, United States: press of cold spring harbor laboratory (Cold Spring Harbor Laboratory Press), 1989) described condition, or carry out according to the condition that manufacturer advises.For usage and the consumption of reagent, except as otherwise noted, otherwise use according to usage and the consumption of routine.

Embodiment 1: the cloning and expression of lipase

1.1 materials and methods

1.1.1 material

1.1.1.1 goal gene, bacterial strain and plasmid

It is synthetic that the lipase gene that derives from eukaryote Rhizomucor miehei dodges brilliant molecular biosciences Science and Technology Ltd. by Shanghai; Expression plasmid pET30a (+), pET22b, pET32a and Host Strains E.coliBL21 are purchased from Novagen (WI) company (Wisconsin, USA).Bacterial strain uses therefor all adds corresponding microbiotic and carries out 37 ℃ of shaking tables cultivations in corresponding substratum.

1.1.1.2 toolenzyme

Taq DNA polymerase is purchased from Promega company, PrimeSTAR ^TMHS DNA Polymerase is purchased from Takara company, and restriction enzyme EcoR I, Not I, HindIII, NcoI and the quick ligase enzyme of T4DNA are purchased from Sangon Biotech (Shanghai) Co., Ltd..

1.1.1.3 reagent

The Mg that regular-PCR is used ²⁺, Buffer, dNTP are purchased from Promega company, and the used Buffer of High fidelity PCR (contains Mg ²⁺) being purchased from Takara company, PCR Cleanup test kit, plasmid extraction kit, gel-purified test kit and genome extract test kit and all are purchased from axygen company, and the PCR primer is synthetic by the handsome biotech firm in Shanghai, and other reagent are domestic analytical pure.

The LB substratum:

1% peptone, 0.5% yeast powder, 1%NaCl.Transfer pH7.2 with NaOH, 121 ℃ of sterilizations are for subsequent use.(solid medium adds 1.5-2% agar in the LB substratum).

1.1.2 experimental technique

1.1.2.1 agarose gel electrophoresis

Reagent is joined by institute:

10 * TBE:108g Tri s alkali, 55g boric acid, 40ml 0.5mol/LEDTA (pH8.0), constant volume 1L

6 * sample-loading buffer: 50% glycerine, 0.25% tetrabromophenol sulfonphthalein, 0.25% xylene cyanol blue FF, 1mmol/L EDTA (pH8.0).

Experimental technique:

(1) weighing 0.2g agarose is poured in the Erlenmeyer flask, adds 0.5 * tbe buffer liquid 40ml;

(2) after heated and boiled to agarose dissolved fully in the microwave oven, room temperature was placed into about 50 ℃, added 2 μ l DNAGreen staining agents, poured two ends after shaking up into and had sealed and placed in the electrophoresis chamber of comb;

(3) after the band agarose solidifies, take comb away, gel slab is put into electrophoresis chamber, put well according to positive and negative electrode, will add in the glue hole behind 5 μ l DNA samples and the 1 μ l sample-loading buffer mixing, plugged carries out the electrophoretic analysis of DNA with the voltage of 10V/cm.

1.1.2.2 the extraction and purification of plasmid

Reagent is joined by institute: all have plasmid extraction kit to carry

Experimental technique: the Host Strains that will contain target plasmid by millesimal inoculum size is linked in the 5mlLB nutrient solution and (contains corresponding microbiotic, ratio is thousandth), 37 ℃, 200r/min cultivated 12-16 hour, then process bacterium liquid with reference to Plasmid extraction kit specification sheets, carry out extraction and the purifying of plasmid.

1.1.2.3 the selection of cloning vector and design of primers and synthetic

According to different gene expression characteristics; selection contains the carrier pET32a of coding Trx sequence; the carrier pET22b and the coli expression carrier pET30a commonly used that contain the coded signal peptide are cloning vector; and according to the different characteristics of each carrier; by Primer software, target gene is carried out design of primers (comprising restriction enzyme site and protection base).

The PCR reaction system:

10 * dna polymerase buffer liquid, 5 μ l

MgCl ₂(25mmol/L)4μl

dNTPs(10mmol/L)1μl

Forward primer (50 μ mol/L) 1 μ l

Reverse primer (50 μ mol/L) 1 μ l

The recombinant vectors pUC template that contains goal gene: about 10pmol

Polysaccharase (5U/ μ l) 0.5 μ l

Add ddH ₂O to cumulative volume be 50 μ l

The PCR response procedures:

The first step: 95 ℃ of denaturation 3min

Second step: (35 circulations)

Sex change, 95 ℃ of 30s; Annealing, 55 ℃, 50S; Extend, 72 ℃, 1min

The 3rd step: 72 ℃ are extended 10min

4 ℃ of insulations

1.1.2.4 the purifying of lipase gene, enzyme are cut and with being connected of carrier

Purifying:

Reagent is joined by institute: carry by Cleanup purification kit and gel recovery test kit

Method: the gene that is obtained by pcr amplification directly carries out purifying by PCR-Cleanup kit or selects DNA extraction kit test kit to tap rubber and reclaim purifying (method steps operates according to the protocol that test kit carries).

Enzyme is cut:

Restriction enzyme site according to designed PCR primer carries out the double digestion reaction, and simultaneously, the plasmid that needs are connected also adopts same restriction endonuclease to carry out the double digestion reaction.

Enzyme is cut system (40 μ l):

PCR product or plasmid DNA: 29 μ l

10 * Tango damping fluid: 8 μ l

Restriction endonuclease 1:1.5 μ l

Restriction endonuclease 2:1.5 μ l

Under 37 ℃ of conditions, enzyme was cut architecture heat preservation 3-4 hour.

Enzyme is cut product purification:

Reagent is joined by institute: carry by the gel-purified test kit

Method: after enzyme cut product and 8 μ l6 * sample-loading buffers mix, carry out gel electrophoresis, by the method that rubber tapping is reclaimed, purifying reclaims the PCR enzyme and cuts product and plasmid enzyme restriction product respectively.Rubber tapping recovery purification process carries explanation according to gel recovery test kit to carry out.

Connect:

After the enzyme that rubber tapping is reclaimed is cut product and is carried out electrophoresis, calculating concentration roughly, take the PCR product: plasmid wherein adds the quick ligase enzyme of T4DNA (5U/ μ l) and the 1 μ l ligase enzyme damping fluid of 0.5 μ l as 1: 5 concentration connects, and adds at last ddH ₂O complements to 10 μ l, and 22 ℃ connect 1 hour down, to be used for next step conversion.

1.1.2.5 the common competent preparation of e. coli bl21 and conversion

Reagent is joined by institute:

CaCl ₂Solution: 60mmol/LCaCl ₂, 15% glycerine (pH7.2), 121 ℃ the sterilization rear 4 ℃ of preservations.

Method:

The preparation of competent cell:

(1) the single colony inoculation of picking bacterium is in 5ml LB substratum, and 37 ℃ of concussions were cultivated 12-16 hour;

(2) get the 2ml culture and be inoculated in 200ml LB substratum/500ml triangular flask, 37 ℃ of concussion substratum are to OD ₆₀₀Be 0.3-0.4;

(3) culture is transferred in the 50ml centrifuge tube, placed 20min on ice;

(4) 4 ℃, the centrifugal 5min of 3000rpm collect thalline, abandoning supernatant;

(5) CaCl of usefulness 10ml precooling ₂The resuspended thalline of solution, 4 ℃, the centrifugal 5min of 3000rpm;

(6) CaCl of usefulness 10ml precooling ₂The resuspended thalline of solution, ice bath 30min;

(7) packing 100 μ l drop in the liquid nitrogen in the eppendorf pipe immediately, and are in-80 ℃ of preservations, for subsequent use again.

The conversion of competent cell:

(1) prepares PCR connection product and plasmid and (in this system, use ddH from the contrast connection product that connects ₂O replaces the PCR product);

(2) get the competent cell of two pipes, 100 μ l, melt on ice;

(3) PCR connection product and the plasmid with 10 μ l joins respectively in the competent cell from connecting product, uses gently the rifle mixing;

(4) ice bath 20-40min;

(5) 42 ℃ of thermal shock 90s put into rapidly ice, ice bath 5min;

(6) add the 1mlLB substratum, 37 ℃, 40-50min is cultivated in the 200rpm concussion;

(7) get 200-300 μ l nutrient solution and coat and contain on the corresponding antibiotic LB culture medium flat plate, after 37 ℃ of incubators are cultivated 30min, be inverted overnight incubation.

1.1.2.6 the evaluation of recon

(1) from transforming dull and stereotyped upper picking list colony inoculation in the 5mlLB substratum, 37 ℃ shaking culture 6-8 hour, carry out plasmid extraction;

(2) according to the design of PCR primer, carry out enzyme with identical restriction endonuclease and cut (reaction system see on) 3 hours, enzyme is cut product carry out gel electrophoresis, the existence of testing goal gene.

(3) preserve positive colony, be used for using from now on.

1.1.2.7 the abduction delivering of target protein

Reagent is joined by institute:

100mmol/L IPTG (being dissolved among the DMSO);

PBS：NaCl?8g/l，KCl?0.2g/l，Na ₂HPO ₄·12H ₂O?3.63g/l，KH ₂PO ₄0.24g/l，pH7.4。

Tris-HCl damping fluid: 50mmol/L Tris-HCl (pH8.0)

Experimental technique:

(1) the positive colony picking is contained to 5ml in the test tube of antibiotic LB substratum, cultivated 12-16 hour, transfer with 2% inoculum size afterwards and in the 250ml shaking flask that contains 50ml and contain antibiotic LB substratum, cultivate in 37 ℃;

(2) treat bacterium liquid OD ₆₀₀When value reached 0.5 left and right sides, the IPTG that adds 0.1mmol/L induced under 16 ℃ of conditions 16-20 hour;

(3) next day, centrifugal collection thalline, and wash with PBS (pH7.4), centrifugal rear collection thalline is dissolved in 50mmol/L Tris-HCl (pH8.0) solution of 4ml, carries out ultrasonication;

(4) carry out centrifugal (4000rpm, 10min) after the fragmentation, target protein then is dissolved in the supernatant liquor, get wherein 10 μ l and 30 μ l 4 * the protein sample-loading buffer carry out mixing after, carry out the SDS-PAGE protein electrophorese.With coomassie brilliant blue R_250 dyeing, carry out gel imaging system and check the result after electrophoresis finishes.

1.1.2.8SDS-PAGE protein electrophoresis

Reagent is joined by institute:

10％APS；10％SDS

4 * protein electrophorese sample-loading buffer: 200mmol/L Tris-HCl (pH6.8), 8%SDS, 0.04% tetrabromophenol sulfonphthalein, 40% glycerine, 400mmol/L DDT, 4 ℃ of preservations;

10 * protein electrophorese electrode buffer: Tris 6g, Glyc i ne 28.8g, SDS10g, pH8.3, constant volume 1L;

30% glue mother liquor: 30%Acrylamide, 0.8%bis;

Separation gel damping fluid (pH8.8): 3.0mmol/L Tris;

Concentrated glue damping fluid (pH6.8): 1.0mol/L Tris;

Coomassie brilliant blue staining liquid: coomassie brilliant blue R_250 1.0g, methyl alcohol 500ml, Glacial acetic acid 100ml, constant volume 1L;

Destainer: methyl alcohol 50ml, acetic acid 75ml, constant volume 1L;

Separation gel and concentrated glue prescription see Table 1:

The prescription of separation gel and concentrated glue in the table 1:SDS-PAGE protein electrophoresis

Experimental technique:

Prepare before the electrophoresis:

(1) dress plate;

(2) join separation gel (adopting 15% gel)

(3) with behind the separation gel solution mixing for preparing, fill with immediately in glue;

(4) cover one deck Virahol (approximately 200 μ l) at separation gel, room temperature was placed approximately about 2 hours, made the complete polymerization of separation gel;

(5) remove Virahol, water cleans, and blots more than behind the moisture the concentrated glue of preparation;

(6) will concentrate the sol solution mixing after, pour in the glue immediately, and plug comb, attention can not produce bubble;

(7) room temperature is placed about half an hour, wait the complete polymerization of concentrated glue after, use distilled water wash, then in upper and lower electrophoresis chamber, add after 1 * SDS electrophoretic buffer cleans well repeatedly, in upper and lower electrophoresis chamber, add 1 * SDS electrophoretic buffer.1 * SDS electrophoretic buffer of upper groove will exceed the gel well.

The electrophoresis operation:

(1) protein solution with 30 μ l mixes with 4 * SDS sample-loading buffer of 10 μ l, processes 5min for 100 ℃, gets supernatant after centrifugal;

(2) sample is added in the well, voltage is transferred to 100V begin electrophoresis, strengthening voltage after sample enters concentrated glue is that 150V is until the electrophoresis end;

(3) carefully take out glue, prescind concentrated glue, soak (not having glue to get final product) with Xylene Brilliant Cyanine G R520 solution, shake gently approximately after 1 hour, remove dye liquor, decolour with destainer again, change several times behind the destainer and decolouring is spent the night;

(4) the SDS-PAGE electrophoresis is put in the gel imaging system, checks the result.

1.1.2.9Bradford method is measured protein concentration

Material: measure protein typical curve test kit Quick Start ^TMBovine Serum Albumin (BSA) Standard Set is purchased from Bio-RAD company.

Reagent is joined by institute:

Xylene Brilliant Cyanine G G-250 dye reagent: claim 100mg Xylene Brilliant Cyanine G G-250, be dissolved in the ethanol of 50ml95% after, add again 120ml 85% phosphoric acid, be diluted with water to 1 liter.

Experimental technique:

(1) glass cuvette is immersed in 95% ethanol in advance cleans, then carefully use the tweezers gripping, dry with blower.Then add therein 1.0ml Xylene Brilliant Cyanine G G-250 reagent, measure light absorption value in the 595nm place, as blank.

(2) choose respectively protein standard substance (0.125mg/ml, 0.25mg/ml, 0.5mg/ml, 0.75mg/ml, 1mg/ml) the 20 μ l of different concns, the careful adding in the cuvette that is added with Xylene Brilliant Cyanine G of mentioning in the previous step, mixing gently, behind the blue whole cuvette that evenly distributes, in 595nm place reading numerical values, it then is corresponding albumen light absorption value under this concentration.

(3) with OD ₅₉₅Numerical value is X-coordinate, for the ordinate zou mapping, namely obtains the typical curve that Xylene Brilliant Cyanine G is surveyed protein concn, as shown in Figure 8 with standard protein quality (mg).

The result:

The amplification of lipase gene

According to the different cloning vectors of selecting, the design primer is as follows:

Carrier: pET30a; Restriction enzyme site: EcoRI+HindIII,

Upper primer: 5 ' GCGGAATTCGGTGCCAATCAAGAGACAATC3 ' (SEQ ID NO:13)

Lower primer: 5 ' GCGAAGCTTTTAATGGTGGTGATGATGGT3 ' (SEQ ID NO:14)

Carrier: pET32a; Restriction enzyme site: EcoRI+NotI,

Upper primer: 5 ' GCGGAATTCGGTGCCAATCAAGAGACAATC3 ' (SEQ ID NO:15)

Lower primer: 5 ' GCGGCGGCCGCTTAATGGTGGTGATGATGGT3 ' (SEQ ID NO:16)

Carrier: pET22b; Restriction enzyme site: EcoRI+NotI,

Upper primer: 5 ' GCGGAATTCAGGTGCCAATCAAGAGACAATC3 ' (SEQ ID NO:17)

Lower primer: 5 ' GCGGCGGCCGCTTAATGGTGGTGATGATGGT3 ' (SEQ ID NO:18)

The PCR product obtains and expectation PCR product of the same size (seeing Fig. 3) after 1.0% agarose gel electrophoresis is identified.Gene order (wild-type) is presented at SEQ ID NO:1, and aminoacid sequence is seen SEQ IDNO:2.

The structure of recombinant expression vector

The selection of expression vector and host cell

In clone's process, select suitable expression vector and host extremely important.Different intestinal bacteria bacterial classifications has the difference that relatively reaches in the ability to express of culture condition and foreign gene.Expression product has three approach in intestinal bacteria: (1) forms native conformation, and is solvable and vigor is arranged, and is not easy to be degraded; (2) protein is solvable, but conformation is not natural, easily by various proteolytic enzyme identifications and degraded in the born of the same parents; (3) form each other insoluble inclusion body between the polypeptide chain, and have protease resistant.Wherein, form native conformation, and be not optimal form by proteasome degradation, and for later orthogenesis, the product of expression is solvable and to have a vigor most important to carrying out smoothly high flux screening.Therefore, before construction of expression vector, will select appropriate expression system.Because target gene derives from eucaryon rice black mould, therefore Expression in Escherichia coli can exist protein disulfide bond to form difficulty, and lack the problems such as posttranslational modification, thereby affected target protein Expression in Escherichia coli effect.The present invention selects pET32a as cloning vector, because of its sequence with the coding Trx, can help the formation of the disulfide linkage of target protein when protein expression, thereby help the target protein solubility expression; Select pET22b as cloning vector, because of its sequence with the coded signal peptide, when protein expression, can enter the colibacillus periplasm space by guiding target albumen, the there is more conducive to the formation of intestinal bacteria disulfide linkage, thereby helps the target protein solubility expression; Select pET30a as cloning vector, because it is the escherichia coli expression common carrier, easy to operate, research is ripe, and on this carrier without any fusion tag, therefore if can carry out desirable solubility expression to target protein with this carrier, all be very easily for purifying, the transformation of late protein.Successfully obtained in the experiment by the recon of above three kinds of plasmids as carrier, positive colony identifies as shown in Figure 4, and the clone who the target stripe shown in the arrow occurs is positive colony.

The abduction delivering of recombinant expression vector

According to aforesaid method, the recon of cloning is carried out abduction delivering.After inducing, cleer and peaceful precipitation in the centrifugal collection.Carry out 15% SDS-PAGE electrophoresis, electrophoresis result shows, target protein has the band of expression in the position of estimating, as shown in Figure 5.

Embodiment 2: the mensuration of lipase activity and the purifying of albumen

2.1 the mensuration of enzyme apparent activity and specific activity:

In this research, the mensuration of lipase activity mainly adopts acid base titration, and concrete operation step is as follows:

(1) experiment reagent and instrument

Sweet oil, 0.02kg/L polyvinyl alcohol (PVA) solution, 0.05mol/L Tris-HCl pH of buffer 8.0,95% ethanol, phenolphthalein, 0.05mol/L NaOH standardized solution.

Ultrasonic Cell Disruptor, vortex oscillation device, constant-temperature table, alkaline drop-burette.

(2) experimental procedure

4ml sweet oil emulsion: 3ml polyvinyl alcohol (2%W/V), the 1ml mixed with olive oil shakes mixing prior to mixing on the concussion instrument, carries out further emulsification in Ultrasonic Cell Disruptor again, until form the oyster white corpus mamillare, oil, no longer layering of water.

Concrete steps as shown in Figure 9.

The lipase activity unit of force is defined as: the enzyme amount that the per minute catalytic substrate discharges 1 μ mol lipid acid is 1 lipase activity unit of force (U).

Formula is calculated in enzyme work:

In the formula: V: the NaOH liquor capacity (ml) that titration sample liquid consumes

V ₀: the NaOH liquor capacity (ml) that the blank sample of titration consumes

T: reaction times (min)

N: enzyme liquid amasss (ml)

M: the concentration (mmol/L) of the NaOH solution that titration is used

The concentration (mg/ml) of the enzyme activity of the specific activity=sample of sample enzyme (U/ml)/sample

2.2 the separation and purification of protein

2.2.1 material

Bacterial strain: pET30a-RML;

Equipment: AKTA protein purification instrument;

Solidify Ni ²⁺Chromatography column (prepacked column): be purchased from GE Healthcare Bio-Science AB (Sweden) company

Reagent; Binding buffer liquid (pH7.8):

The 20mmol/L sodium phosphate; 500mmol/L NaCl; The 20mmol/L imidazoles

Elution buffer (pH6.0):

The 20mmol/L sodium phosphate; 500mmol/L NaCl; The 500mmol/L imidazoles

Attention: when binding buffer liquid and elution buffer preparation are finished, carry out suction filtration, and ultrasonic bubble removing

2.2.2 experimental technique:

(1) processing of target protein sample to be purified

1. according to the method for aforementioned processing thalline, obtain crude enzyme liquid by ultrasonication;

2. crude enzyme liquid is sub-packed in the 2ml eppendorf pipe, in the centrifugal 5-10min of 13000rpm, further separates soluble proteins and inclusion body and cell debris;

3. collect the supernatant liquor after centrifugal, filter purification of samples with water-soluble strainer;

(2) purifying band histidine-tagged protein

1. with Ni ²⁺Be loaded on the protein purification instrument;

2. with the aseptic water washing potting resin of 3 times of scapus volumes;

3. with binding buffer liquid (pH7.8) the balance resin of 3 times of column volumes;

4. the binding buffer liquid drainage on the resin is arrived the column top;

5. the cell pyrolysis liquid supernatant is carried out upper prop, flow velocity is adjusted into per hour 10 column volumes;

6. wash post with the binding buffer liquid (pH7.8) of 6 column volumes;

7. wash post with the elution buffer (pH6.0) of 4 column volumes, until A280＜0.01;

8. with the 10mmol/L imidazoles elution buffer elution of bound albumen of 6 column volumes, every part of 1ml distributes and collects, and detects the value of A280;

9. with greater concn imidazoles elution buffer wash-out, every part of 1ml distributes and collects, and detects the value of A280;

10. will collect the albumen that obtains and carry out 12% SDS-PAGE and carry out electrophoresis, analyze the distribution of polyhistidyl label protein.

The result:

Recombinant protein concentration and apparent activity are measured

Take bovine serum albumin as standard protein, adopt embodiment 1 described Bradford method to measure the concentration of recombinant protein; Adopt acid base titration, measure the apparent activity of recombinant protein.

Shown in the table specific as follows:

The concentration of recombinant protein and apparent activity are measured

Survey and live relatively, the proteolytic activity that adopts pET30a to express is best, and amixis label on the carrier, and principle is simple, therefore finally select pET30a as final cloning vector.

Embodiment 3: improve the lipase stereoselectivity by orthogenesis

3.1 materials and methods:

3.1.1 material

Bacterial strain: the recombinant bacterium that previous experiments has made up, recombinant plasmid are pET30a-RML, and Host Strains is BL21, are used for extracting the template that plasmid DNA is fallibility PCR.

Toolenzyme: restriction enzyme, the quick ligase enzyme of T4DNA are purchased from Sangon Biotech (Shanghai) Co., Ltd.; Taq archaeal dna polymerase and the required reagent of supporting PCR thereof all are purchased from Promega (USA) company.

Reagent is domestic analytical pure.

Cell pyrolysis liquid: configure first Tris-HCl damping fluid (pH8.0-pH8.5) 500ml of 50mmol/L, add again magnesium chloride (its final concentration reaches 5mmol/L), N,O-Diacetylmuramidase 250mg, DNA enzyme 1000U.

Dibromothymolsulfonphthalein and phenolsulfonphthalein indicator: the Dual-indicator concentration that is made into each 0.5mg/ml with 10mM pH 8.5Tris-HCl solution.

Calcium acetate solution: join the 50mM calcium acetate solution with 10mM pH 8.5Tri s-HCl solution.

Inoue transforms damping fluid:

The preparation of PIPES a.0.5mol/L (pH6.7) [piperazine-N.N '-two (2-ethanesulfonic acids)] solution: 15.1gPIPES is dissolved in the 80ml water, transfers pH to 6.7 with 5mol/LKOH.Add at last pure water and be settled to 100ml.(20 ℃ of preservations) is with the in advance strainer filtration sterilization of sterilising treatment.

B. following component is dissolved in the 800ml pure water, then adds the PIPES (pH6.7) of 20ml0.5mol, add pure water and be settled to 1L:MnCl ₂4H ₂O, 55mmol/L; CaCl ₂2H ₂O, 15mmol/L; KCl, 250mmol/L

3.1.2 experimental technique:

3.1.2.1BL21 super competent preparation

(1) prepares Inoue and transform damping fluid (with front precooling on ice)

(2) single bacterium colonies (BL21) on 37 ℃ of cultivation 16-20h flat boards of picking.Being seeded to has in the 250ml Erlenmeyer flask in the 25mlLB substratum, and 37 ℃ of shaking tables (250-300r/min) were cultivated 6-8 hour.

(3) is inoculated in above-mentioned initial incubation thing in the 500ml Erlenmeyer flask that fills the 125mlLB nutrient solution at about 6 o'clock in the evening, and first adds 500 μ l, and second adds 1ml, and the 3rd adds 2ml, and in 18-22 ℃, the 200r/min shaking table spends the night.

(4) morning next day, the OD of three bottles of cultures of measurement ₆₀₀Value, per half an hour surveys once, as one bottle OD wherein ₆₀₀Value reaches at 0.55 o'clock, and culturing bottle is placed 20min on ice, discards in addition two bottles of cultures.

(5) in 4 ℃, the centrifugal 10min of 4000r/min collects thalline.

(6) remove nutrient solution, centrifuge tube is tipped upside down on the thieving paper 2min to blot remaining liq, the Inoue that adds the 40ml precooling transforms the resuspended bacterial precipitation of damping fluid (vibrator is not used in gently rotation piping and druming).

(7) in 4 ℃, the centrifugal 10min of 4000r/min collects thalline.

(8) Inoue with the 10ml precooling transforms the resuspended bacterial precipitation of damping fluid.

(9) add 0.75mlDMSO, the engagement bacterial precipitation is placed 10min on ice gently.

(10) rapidly suspension is divided in the aseptic eppendorf pipe that installs to cooling, seal the tight mouth of pipe, drop into frozen section competent cell in the liquid nitrogen ,-80 ℃ for subsequent use.

3.1.2.2 the foundation in fallibility PCR and sudden change library

The PCR primer:

Forward primer: 5 '-CGCG CCATGGTGCCAATCAAGAGACAATC-3 ', NcoI; (SEQ IDNO:19)

Reverse primer: 5 '-GCCG AAGCTTAAGTACAGAGGCCTGTGT-3 ', Hi ndI I I; (SEQ IDNO:20)

The PCR system: prepare 7 PCR pipe, the PCR system is 50 μ l in every pipe, plasmid DNA template 1 μ l (being about 10pmol) wherein, upstream primer 1 μ l, downstream primer 1 μ l, dNTP 1 μ l, Mg ²⁺4l, Buffer 5 μ l, enzyme 0.5 μ l adds Mn in addition in system ²⁺, make its concentration reach successively 0mmol/L, 0.1mmol/L, 0.2mmol/L, 0.3mmol/L, 0.4mmol/L, 0.5mmol/L, 0.6mmol/L; All the other use ddH ₂O supplies, and selects suitable Mn according to dna gel electrophoresis imaging results ²⁺Concentration.

PCR condition: denaturation, 95 ℃, 3min, sex change, 95 ℃, 30S; Annealing, 55 ℃, 50S; Extend, 72 ℃, 1min, totally 35 circulations, 72 ℃ are extended 10min, 4 ℃ of insulation 30min.

With the agarose gel electrophoresis of PCR product with 1% (W/V), reclaim test kit with the PCR purifying and carry out the purifying recovery.Fallibility PCR product behind the purifying is cut with 37 ℃ the enzyme that restriction enzyme NcoI and hindIII carried out 3-4 hour, is connected with the same pET30a carrier of cutting through enzyme afterwards, and method of attachment and system see above to be stated.Then will connect product and transform in the super competent cell of e. coli bl21, coat LB (containing 50mg/ml Kanamyc in) flat board, cultivate 16-20 hour for 37 ℃.The mutant number requires to reach about 6000-8000.

3.1.2.3RML the abduction delivering of lipase mutant

For the RML lipase mutant, adopt 96 microwell plates to express.Single bacterium colony on the LB solid culture flat board is chosen in 96 orifice plates that contain 200 μ l LB substratum in each hole (this plate is called mother matrix) one by one, in 37 ℃, the 200r/min rotating speed was cultivated 12-16 hour, then with 2% inoculum size, the bacterium liquid in each hole on the motherboard is inoculated into each new hole contains (this plate is daughter board) in the 96 hole micro plates of 500 μ lLB substratum.Simultaneously, each hole adds 10% glycerine in the motherboard, and-80 ℃ of preservations are in order to applicable from now on.Simultaneously, daughter board is cultivated in the 200r/min shaking table in 37 ℃.It is about 0.5 that the concentration for the treatment of bacterium liquid in each hole reaches the OD value, adds IPTG and induces, and makes its final concentration reach 0.1mmol/l.After inducing 4 hours, after centrifugal, washing, collect thalline.The daughter board that contains the abduction delivering thalline put into-80 ℃ spend the night after, add the cell pyrolysis liquid of 250 μ l in each hole, be positioned over 37 ℃ 1-2 hour, make cellular lysate.At this moment, because cold and hot expansion, the somatic cells wall is broken, and contained zymoprotein will be released in the liquid.Then 4000rpm, 4 ℃ centrifugal 20 minutes, target protein namely is dissolved in the supernatant, with it 4 ℃ of preservations, assaying reaction after being used for.

3.1.2.4 mutant is to the primary dcreening operation (high flux screening) of grease catalytic activity

Principle is as implied above.As the pH indicator, it selects this color transition point to be because this meter black mould enzyme liquid is liked weakly alkaline environment in the pH=7.5 variable color with dibromothymolsulfonphthalein and phenolsulfonphthalein.Be made into the Dual-indicator concentration of each 0.5mg/ml with 10mM pH8.5Tris-HCl solution.Join the 50mM calcium acetate solution with 10mM pH 8.5Tris-HCl solution.Sweet oil is dissolved in (approximately 1: 6 of volume ratio) in the dimethyl formamide.

We add expection product oleic acid and substitute the susceptibility that sweet oil is verified this method.Its colour-change wherein, is 0 o'clock at the oleic acid concentration that adds as shown in Figure 1, the Color expression mazarine of reaction system, and along with the increase of oleic acid concentration, it is light blue, green and light blue that the color of reaction system becomes gradually.

Reaction system on 96 orifice plates is as follows:

1. each hole adds 20 μ l indicator and 60 μ l calcium acetate solutions.Can in advance they be mixed into 100 μ l mixed solutions adds this mixed solution in the hand-hole again.

2. add 100 μ l and be dissolved in sweet oil in the dimethyl formamide.

3. add 20 μ l enzyme liquid.React and can be observed colour-change in 15 minutes.

This new high throughput method effectively combines and has therefore obtained good dominant bacteria with meter orthogenesis of black mould lipase.

Compare with the p-NPP method, as follows with the advantage of the inventive method: the first, can not distinguish active large enzyme with the p-NPP method.A-G2 among Fig. 2 and a-G1 have shown the result who uses the p-NPP test, wherein show, even along with the minimizing of enzyme amount, the p-NPP method can not show the graded of color.Figure b-G2 and b-G1 have shown the result of the inventive method, and shown in this result showed, the gradient of color can obviously show.The second, triglyceride level is stable, and p-NPP is easy to hydrolysis, and this hydrolysis rate is affected by the extraneous factors such as temperature and solvent very.The result who draws with the inventive method and the result of acid base titration are consistent, and not having with the p-NPP method.G1 and G2 are respectively the lipase shown in SEQ ID NO:3 and 5 among the figure.

3.1.2.5 mutant is to the multiple sieve of grease catalytic activity

Each is taken turns and chooses about 20 strain activity are compared raising than wild mushroom bacterial strain by high flux screening, adopts alkali titration to measure active, and concrete operation step as previously mentioned.

Reaction system is:

3ml Tri s-HCl damping fluid or phosphoric acid buffer (50mmol/L; PH8.5);

2ml?ddH ₂O，

Add 10 μ l enzyme liquid (the enzyme liquid behind crude enzyme liquid and the purifying have react).

Experimental result

The orthogenesis result

Fallibility PCR the results are shown in Figure 6, wherein, and swimming lane 1-7:No, 0.1mmol/L Mn ²⁺, 0.2mmol/LMn ²⁺, 0.3mmol/L Mn ²⁺, 0.4mmol/L Mn ²⁺, 0.5mmol/L Mn ²⁺, 0.6mmol/L Mn ²⁺

As can be seen from the figure, along with adding Mn in the system ²⁺Concentration become large, the band of PCR is dimmed successively, if select Mn ²⁺The PCR condition that concentration is excessive, then PCR brightness is inadequate, and can not guarantee mutational equilibrium, and too high sudden change is arranged, and causes the active decline of expressing protein; If select Mn ²⁺The PCR condition that concentration is excessively low does not then guarantee certain mutation rate, therefore, to sum up analyzes, and selects Mn ²⁺Concentration is that 0.4mmol/L is desirable sudden change concentration.

By above-mentioned primary dcreening operation and multiple sieve, the present invention screens the lipase of a series of sudden changes, obtains these lipase according to method purifying mentioned above, and it is checked order and determination of activity.

Determination of activity result and transgenation result are as follows:

The nucleotide sequence of wild-type lipase is seen SEQ ID NO:1, and aminoacid sequence is seen SEQ ID NO:2.

Fig. 7 show lipase transform through orthogenesis and fixed point after active variation tendency, wherein, apparent activity is compared than wild-type, has improved 5.5 times; Specific activity is compared than wild-type, has improved 6.7 times.

Claims

1. an isolated polypeptide is characterized in that, described polypeptide is selected from:

(1) aminoacid sequence shown in the SEQ ID NO:4,6,8,10 or 12; With

2. polypeptide as claimed in claim 1, it is characterized in that, in the aminoacid sequence numbering of SEQ ID NO:2, (2) described polypeptide at least also keeps one or more following locational residues: the 67th Ala, the 111st Thr, the 168th Pro and the 65th Ala.

3. the polynucleotide of a separation is characterized in that, the polynucleotide of described separation are selected from:

(1) polynucleotide of each described polypeptide among the coding claim 1-2; With

(2) with the polynucleotide of (1) described polynucleotide complementation.

4. polynucleotide as claimed in claim 3 is characterized in that, the polypeptide of this polynucleotide encoding shown in SEQ IDNO:4,6,8,10 or 12.

5. such as claim 3 or 4 described polynucleotide, it is characterized in that, the nucleotide sequence of these polynucleotide is shown in SEQ ID NO:3,5,7,9 or 11.

6. a carrier is characterized in that, it contains each described polynucleotide among the claim 3-5.

7. a genetically engineered host cell is characterized in that, described host cell contains carrier claimed in claim 6, or contains each described polynucleotide among the claim 3-4.

8. a method of screening lipase is characterized in that, described method comprises with triglyceride level carries out enzymolysis as the substrate of lipase to be screened and filter out the step of the lipase that improves than vigor according to the colour-change that the pH indicator produces.

9. method as claimed in claim 8 is characterized in that, said method comprising the steps of:

(1) provides lipase to be screened;

(4) lipase is added in the mixed solution of step (3) gained; With

10. such as each described method among the claim 8-9, it is characterized in that, described triglyceride level is that the fatty acid carbons chain length is the triglyceride level of 12-22.

11. such as each described method among the claim 8-10, it is characterized in that, described low-grade alkyl carboxylic acid's salt is the IIA family metal-salt of long 2-6 carbon atom alkyl carboxylic acid.

12. such as each described method among the claim 8-11, it is characterized in that, described pH indicator is selected from dibromothymolsulfonphthalein, phenolsulfonphthalein, methylenum coeruleum, toluylene red, methyl red, tetrabromo-mcresolsulfonphthalein, tropeolin-D, tetrabromophenol sulfonphthalein, Congo red or its combination.

13. such as each described method among the claim 8-12, it is characterized in that, described method also comprises uses wild-type lipase in contrast, goes out the lipase that improves than vigor by contrasting the lipase to be screened color that produces and the dithering that contrast produces.

14. such as each described method among the claim 8-13, it is characterized in that, described method is to use porous plate to screen.

15. such as each described method among the claim 8-14, it is characterized in that, described method also comprises:

Set up lipase sudden change library;

Express sudden change lipase.

16. such as each described method among the claim 8-15, it is characterized in that, described method also comprises: adopt alkali titration that the screen lipase that obtains is carried out multiple sieve, filter out the lipase that improves than vigor.

17. a reaction system that is used for screening lipase is characterized in that, described reaction system contains:

(1) triglyceride level; With

(2) pH indicator.

18. reaction system as claimed in claim 17 is characterized in that, described reaction system also contains low-grade alkyl carboxylic acid's salt.

19. such as each described reaction system among the claim 17-18, it is characterized in that, the described reaction system meter of per 200 μ l, described reaction system contains Tris buffered soln and 80～120 μ l triglyceride level solution of 0.1～0.3M low-grade alkyl carboxylic acid salt of pH indicator solution, 50～70 μ l of 15～25 μ l, wherein, to be the pH indicator be dissolved in the Tris damping fluid with the concentration of 0.3～1.5mg/L to described pH indicator solution, and to be triglyceride level be dissolved in the solution that organic solvent obtains with the volume ratio of 1:4～6 to described triglyceride level solution.

20. such as each described reaction system among the claim 17-19, it is characterized in that, the pH of described reaction system is 4.0～9.0.

21. such as each described reaction system among the claim 17-20, it is characterized in that, described triglyceride level is that the fatty acid carbons chain length is the triglyceride level of 12-22.

22. such as each described reaction system among the claim 17-21, it is characterized in that, described low-grade alkyl carboxylic acid's salt is the IIA family metal-salt of long 2-6 carbon atom alkyl carboxylic acid.

23. such as each described reaction system among the claim 17-22, it is characterized in that, described pH indicator is selected from dibromothymolsulfonphthalein, phenolsulfonphthalein, methylenum coeruleum, toluylene red, methyl red, tetrabromo-mcresolsulfonphthalein, tropeolin-D, tetrabromophenol sulfonphthalein, Congo red or its combination.