CN105779416A - Novel lipase - Google Patents

Abstract

The invention provides a polypeptide having a lipase activity. The polypeptide includes an amino acid sequence as shown in SEQ ID NO:1 or a sequence which is obtained by substituting, deleting or adding at least one amino acid in the sequence. The invention also provides a polynucleotide for coding the polypeptide, an expression vector and a host cell containing the polynucleotide, and a method for producing the polypeptide. In addition, the invention also relates to application of the polypeptide having the lipase activity.

Description

A kind of novel lipase

Invention field

The application belongs to genetic engineering or enzyme engineering field, in particular it relates to have the polypeptide of lipase active, its code nucleic acid, and comprises expression vector and the host cell of described code nucleic acid.The application further relates to the preparation method and its usage of aforementioned polypeptides.

Background of invention

Lipase is the enzyme that a class has multiple catalytic capability, it is possible to catalysis triglyceride is hydrolyzed to glycerol and free fatty, it is also possible to the hydrolysis of other esters of catalysis and transesterification and esters synthetic reaction.Additionally, lipase also shows the enantioselectivity to substrate.Above characteristic imparts the lipase extensive use (AbhishekKumarSingh in industry such as food fats and oils processing, detergent, biodiesel, the synthesis of ester bond compound and chiral drug synthesis, MausumiMukhopadhyay.OverviewofFungalLipase:AReview.2012,166 (2): 486-520).

Such as, in fats and oils processing, due to the introducing of lipase, grease hydrolysis can carry out at normal temperatures and pressures, thus without making the biological substance degeneration such as highly unsaturated fatty acid and tocopherol.In medical treatment, lipase is as diagnostic tool, and measurable disease, in serum, lipase can be used for detecting acute pancreatitis and injury of pancreas.Lipase drug manufacture, lose weight etc. in also have application.In biodiesel synthesis, enzyme process has that extraction and purification process is simple, equipment investment is few, it is low to consume energy, pollute the advantages such as little, day by day causing the common concern of people, wherein the immobilized Novozym435 of fabric membrane and candida mycoderma (Candidasp.) 99-125 is the conventional enzyme producing biodiesel.In detergent industry, 1988, Novozymes Company was first by fatty enzyme and can effectively remove the detergent of greasy dirt and introduce to the market, and application genetic engineering develops modern biotechnology heavy industrialization the most successfully one of the application especially of detergent use lipase.At pulp and paper industry, lipase is used to remove " be in harmony fat " in paper pulp, and Japan's Nippon paper industry have developed one " be in harmony fat " control method, and namely with sweet three esters of Candidarugasa lipase hydrolysis, degree of hydrolysis reaches 90%.

The hydrolysis of lipase-catalyzed butter oil, produces free fatty.Fatty acid can include short chain (C₄-C₆Fatty acid, namely butanoic acid, caproic acid) and in long-chain (C₁₂-C₁₈) fatty acid.Free fatty may participate in chemical reaction subsequently, for instance perfume compound, such as the formation of ethyl acetate, beta-keto acid, methyl ketone, ester and lactone.The lipase used can affect the type of the free fatty of release in cheese, for instance, pungent, strong fragrance occurs mainly with release short-chain fatty acid (C₄-C₆) lipase, middle long-chain fatty acid then can produce saponiform taste.Many researchs are devoted to lipase transform as short chain preference type, to be applied to cheese manufacture.

Summary of the invention

First aspect, this application provides the polypeptide with lipase active, and it comprises selected from following sequence or is formed by selected from following sequence:

(a) aminoacid sequence as shown in SEQIDNO:1, and

B sequence that () sequence described in (a) obtains after replacing, lacking or add at least one aminoacid, the polypeptide variants wherein obtained by (b) still keeps lipase active.

In optional embodiment, aforementioned polypeptides and heterologous polypeptide.

In one embodiment, the polypeptide of the application comprises the aminoacid sequence shown in SEQIDNO:1.In preferred embodiments, aforementioned polypeptides aminoacid sequence shown in SEQIDNO:1 forms.

Second aspect, it is provided that the polynucleotide of the polypeptide of coding first aspect, it comprises selected from following sequence or is formed by selected from following sequence:

A () nucleotide sequence, it encodes the aminoacid sequence shown in SEQIDNO:1 or comprises the sequence of at least one aminoacid replacement, disappearance or interpolation in above-mentioned sequence；And

(b) under strict conditions with a) in the nucleotide sequence of nucleotide sequence hybridization.

In one embodiment, the polynucleotide of the present invention comprise the nucleotide sequence shown in SEQIDNO:2.In preferred embodiments, above-mentioned polynucleotide nucleotide sequence shown in SEQIDNO:2 forms.

In one embodiment, the polynucleotide of the application are produced by synthetic or produce by recombinating.

The third aspect, it is provided that expression vector, it comprises at least one above-mentioned polynucleotide.

In certain embodiments, the expression vector of the application also comprises the regulating and controlling sequence regulating polynucleotide expression, and wherein polynucleotide are operably connected with regulating and controlling sequence.In preferred embodiments, described expression vector is pCold-TF.

Fourth aspect, it is provided that comprise the polynucleotide of the application or the host cell of expression vector.In preferred embodiments, host cell is e. coli bl21 (DE3).

5th aspect, it is provided that the method for the polypeptide of preparation the application, comprising:

1) above-mentioned polynucleotide are cloned on expression vector,

2) expression vector is proceeded in suitable host cell,

3) in suitable culture medium, described host cell is cultivated,

4) polypeptide described in separation also purification from described host cell or culture medium.

In preferred embodiments, the method providing the polypeptide that preparation aminoacid sequence shown in SEQIDNO:1 forms, comprising: the nucleotide sequence by the aminoacid sequence shown in coding SEQIDNO:1 is cloned in plasmid expression vector, and the plasmid expression vector conversion with this polynucleotide sequence is carried out abduction delivering to escherichia coli, then separate and purification BM2 polypeptide from escherichia coli.

6th aspect, it is provided that lipase prepared by method according to the fifth aspect.

7th aspect, it is provided that aforementioned polypeptides, polynucleotide, expression vector or the host cell purposes in preparing lipase.

Eighth aspect, it is provided that aforementioned polypeptides, lipase, polynucleotide, expression vector or the host cell application in manufacturing food.In preferred embodiments, the application aforementioned polypeptides, lipase, polynucleotide, expression vector or host cell are applied in the manufacture of milk product or wheaten food.In one embodiment, above-mentioned milk product is cheese.

9th aspect, it is provided that utilize the food that aforementioned polypeptides, lipase, polynucleotide, expression vector or host cell manufacture.In preferred embodiments, described food is milk product or wheaten food.

The polypeptide of the application has Short-Chain Fatty Acids specificity and/or one or more following characteristics: have good enzymatic activity and stability within the scope of pH8.0-9.0；There is good surfactant toleration.

Brief Description Of Drawings

Fig. 1 shows the gel electrophoresis figure of BM2 polypeptide.1st swimming lane is molecular weight marker, and the 2nd swimming lane is BM2 polypeptide.

When Fig. 2 shows respectively using 4-Nitrophenyl butyrate (pNPB), 4-nitrobenzophenone caprylate (pNPO), 4-nitrobenzophenone laurate (pNPD) and 4-nitrobenzophenone cetylate (pNPP) as substrate, BM2 is as the Hydrolytic catalyzing of lipase.

Fig. 3 shows BM2 enzyme activity at different temperatures.

Fig. 4 shows BM2 enzyme activity under different pH.

Fig. 5 shows the stability of BM2 lipase active under different pH.

Fig. 6 shows the metal ion impact on BM2 lipase activity.Matched group is interpolation water in reaction system, and all the other groups add ZnSO respectively in reaction system₄、MnCl₂、CoCl₂、CaCl₂、MgSO₄、CuSO₄、KCl、(NH4)₂SO₄、NaCl、NiSO4、FeCl₃, sodium citrate (C₆H₅Na₃O₇) and the salt stock solution of disodiumedetate (EDTA).

Fig. 7 shows the surfactant impact for BM2 lipase activity.Matched group adds water in reaction system, all the other groups add respectively in reaction system 0.5% cation surface activating CTAB, anion surfactant SDS, nonionic surfactant Tween80, AEO-9 and TritonX-100.

Sequence brief description

SEQIDNO:1: the aminoacid sequence of lipase B M2

MKDEIEKLNCGISVYLALVTSAAAKNENPPEETSGKSRHGKKQKRESGTEEAGENLGTEEAGVEPGIAELAGTPSDYSKQENWMRIPEITHEVDTFYIYPTCYLDDSEDAKPICDIDNPAVQARAKVVYENQGTVYEDSTNVFAPYYRQSNIYQVFDMEYEELEEYQRNEQRTDIYAALDYYFEHYNEGRPFIIAGHSQGSIMTKIILGEYMQAHPEYYERMVAAYPIGFSITEDFLKAHPYLKFAEGADDTGVIVSWNTEGKGNKGQKNLVVEPNAISINPINWKRDDTYAGFEENLGSRLWNEETGSYEVLQGIADAQVDTERGVVICTAEDIDYAPAELFGPESLHGHDYDFYYENLKENVKTRVEAYLKQN

SEQIDNO:2: the nucleotide sequence of lipase B M2

ATGAAAGATGAAATTGAGAAACTGAATTGTGGCATTAGTGTCTACCTTGCGCTGGTTACATCAGCTGCGGCAAAAAATGAAAATCCACCGGAAGAAACAAGCGGGAAAAGCAGGCACGGAAAGAAACAGAAGCGGGAATCTGGTACGGAAGAAGCGGGAGAAAACCTTGGCACGGAAGAGGCGGGAGTGGAACCCGGTATTGCAGAATTGGCAGGTACGCCATCTGATTATTCGAAACAGGAGAACTGGATGAGGATACCTGAGATTACACATGAAGTGGATACCTTTTATATTTACCCCACCTGCTATCTTGATGATTCAGAAGATGCCAAGCCAATCTGCGACATTGACAATCCCGCAGTTCAGGCCAGGGCCAAGGTTGTTTACGAAAACCAGGGGACGGTGTATGAAGATTCCACCAATGTATTTGCGCCCTATTATCGTCAGAGCAACATTTATCAGGTTTTCGATATGGAATATGAGGAACTGGAAGAGTACCAGCGAAATGAGC AGCGCACAGATATTTATGCAGCGCTGGATTACTACTTTGAGCATTATAATGAAGGCCGGCCCTTTATTATCGCAGGTCATTCTCAAGGGTCCATTATGACAAAAATCATTCTTGGAGAATATATGCAGGCTCATCCGGAATATTATGAACGGATGGTCGCAGCATATCCAATCGGATTTTCCATTACCGAGGATTTCCTGAAAGCCCATCCTTACCTGAAATTTGCAGAAGGTGCAGATGACACAGGGGTAATTGTATCATGGAATACAGAAGGAAAAGGGAACAAGGGGCAAAAGAATCTGGTTGTGGAACCCAATGCTATCAGCATTAACCCTATAAACTGGAAACGGGATGATACTTATGCCGGTTTCGAGGAGAACTTGGGCAGCCGCCTTTGGAATGAGGAAACAGGCAGCTATGAAGTGCTTCAGGGGATTGCAGACGCACAGGTGGATACAGAACGCGGCGTTGTGATCTGCACGGCAGAAGATATAGATTATGCCCCTGCGGAACTGTTCGGCCCGGAAAGTCTGCACGGCCACGATTATGATTTCTATTATGAGAATCTGAAAGAAAATGTAAAAACCAGAGTGGAGGCTTACTTAAAACAAAAT

Detailed description of the invention

Polypeptide

This application provides the polypeptide with lipase active, it comprises selected from following sequence or is formed by selected from following sequence:

(a) aminoacid sequence as shown in SEQIDNO:1, and

B sequence that () sequence described in (a) obtains after replacing, lacking or add at least one aminoacid, the polypeptide variants wherein obtained by (b) still keeps lipase active.

In some embodiments, the number of above-mentioned aminoacid replacement, disappearance or interpolation is 1-30, it is preferred to 1-20, more preferably 1-10, the polypeptide variants wherein obtained substantially can keep lipase active.In preferred embodiments, aforementioned polypeptides variant differs about 1,2,3,4,5,6,7,8,9 or 10 amino acid whose replacements, disappearance and/or interpolation with the aminoacid sequence shown in SEQIDNO:1.In a more preferred embodiment, aforementioned polypeptides variant differs about 1,2,3,4 or 5 amino acid whose replacements, disappearance or interpolation with the aminoacid sequence shown in SEQIDNO:1.

In some embodiments, the polypeptide of the application comprises the aminoacid sequence shown in SEQIDNO:1.In preferred embodiments, aforementioned polypeptides aminoacid sequence shown in SEQIDNO:1 forms.

Thus, this application provides a kind of lipase, it comprises the polypeptide with lipase active disclosed herein or its variant, or is made up of described polypeptide or its variant.In this article, the polypeptide that the aminoacid sequence shown in SEQIDNO:1 forms is named as lipase B M2.

In optional embodiment, aforementioned polypeptides and heterologous polypeptide, form fusion protein.

As used herein, term " aminoacid " represents the naturally occurring aminoacid with non-naturally-occurring and amino acid analogue and analogies.Naturally occurring aminoacid includes 20 kinds of (the L)-aminoacid and other aminoacid that use in protein biology synthesis, for instance 4-Hydroxyproline, hydroxylysine, desmosine, isodensmosine, homocysteine, citrulline and ornithine.The aminoacid of non-naturally-occurring includes such as (D)-aminoacid, nor-leucine, norvaline, p-fluorophenylalanine, ethionine etc., and these are well known by persons skilled in the art.Amino acid analogue includes natural and non-naturally-occurring amino acid whose modified forms.This modification can include the chemical group on such as substituted amino acid and part or amino acid whose derivatization.Amino acid analog thing includes the organic structure such as showing functionally similarity, described character such as amino acid whose electric charge and charge space characteristic.Such as, the organic structure of simulation arginine (Arg or R) has and is positioned at similar molecule space and has the ambulant positive charge part of e-amino same degree with the amino acid whose side chain of naturally occurring Arg.Analogies also include restraining structure to maintain optimal spatial and the charge interaction of aminoacid or amino acid functional group.Those skilled in the art may determine that what structure constitutes functionally equivalent amino acid analogue and amino acid analog thing.

In some embodiments, the variant of the aminoacid sequence shown in SEQIDNO:1 and SEQIDNO:1 have the homology of at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, more than 99%.In preferred embodiments, polypeptide variants and sequence shown in SEQIDNO:1 have the homology of more than 99%.

" homology " as herein described is defined as after sequence alignment and introducing room, the percentage ratio of aminoacid or residue identical in nucleotide sequence variants, if it is desired, reach the homology of largest percentage.It is known in the art for the method and computer program of comparison.

Term " polypeptide " and " albumen " used interchangeably herein, refer to the polymer of amino acid residue and variant thereof and synthesis and naturally occurring analog.Therefore, these terms are applicable to naturally occurring amino acid polymer and naturally occurring chemical derivative thereof, and wherein one or more amino acid residues are the amino acid polymers of aminoacid (such as corresponding naturally occurring amino acid whose chemical analog) of non-naturally-occurring of synthesis.This analog derivative includes such as post translational modification and catabolite, including the polypeptide fragment shown in SEQIDNO:1 phosphorylation, variant glycosylated, oxidation, isomerized and deaminated.

In preferred embodiments, the sequence of BM2 polypeptide variants is to comprise the sequence that one or several conservative amino acid replaces in the aminoacid sequence shown in SEQIDNO:1, and the sequence after being wherein substituted still keeps catalytic activity of lipase.

Some aminoacid replacement being referred to as " conserved amino acid replacement " can frequently occur in protein, but does not change conformation or the function of this protein, and this is the rule set up in protein chemistry.

Conserved amino acid replacement in the present invention includes but not limited to replace any another one of these aliphatic amino acids by any one in glycine (G), alanine (A), isoleucine (I), valine (V) and leucine (L)；Replacing threonine (T) with serine (S), vice versa；Replacing glutamic acid (E) with aspartic acid (D), vice versa；Replacing agedoite (N) with glutamine (Q), vice versa；Replacing arginine (R) with lysine (K), vice versa；Any another one in these aromatic amino acids is replaced with phenylalanine (F), tyrosine (Y) and tryptophan (W)；And replace cysteine (C) with methionine (M), vice versa.Other replacement can also be considered to be conservative, and this depends on specific amino acid environment and its effect in protein three-dimensional structure.Such as, glycine (G) and alanine (A) often can exchange, and can exchange such as alanine (A) and valine (V).The methionine (M) of relative hydrophobic can often exchange with leucine and isoleucine, and sometimes exchanges with valine.Lysine (K) and arginine (R) are through following location swap of being everlasting: wherein the key character of amino acid residue is its electric charge, and the different pK of both amino acid residues inconspicuous.Under particular circumstances, still have some other change can be considered as " conservative " (referring to, for instance, BIOCHEMISTRYatpp.13-15,2^nded.LubertStryered.(StanfordUniversity)；Henikoffetal.,Proc.Nat’lAcad.Sci.USA(1992)89:10915-10919；Leietal.,J.Biol.Chem.(1995)270(20):11882-11886).

Hereinafter, by amino acid residue by the classification citing of commutable residue, but commutable amino acid residue is not limited to residue set forth below:

A group: leucine, isoleucine, nor-leucine, valine, norvaline, alanine, 2-amino-butyric acid, methionine, O-methyl serine, t-butylglycine, t-butylglycine and Cyclohexylalanine；

B group: aspartic acid, glutamic acid, different aspartic acid, isoglutamic acid, AAA and 2-amino suberic acid；

C group: agedoite and glutamine；

D group: lysine, arginine, ornithine, 2,4-DAB and 2,3-diaminopropionic acid；

E group: proline, 3-hydroxyproline and 4-hydroxyproline；

F group: serine, threonine and homoserine；

G group: phenylalanine and tyrosine.

Such as, present inventor finds, before being arranged in BM2 polypeptide N end, one or more generation conservatives replacement of 132 amino acids has no substantial effect on lipase active.

In other specific embodiments, the C end of BM2 polypeptide or N end regions can also be truncated about 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,20,25 or more aminoacid, and still have the lipase active of BM2.

In further embodiment, it is also possible to C end or N end regions at BM2 polypeptide add 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,20,25 or more aminoacid, and the BM2 variant obtained still has catalytic activity of lipase.

In addition, can also add or lack 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,20,25 or more aminoacid in region beyond the C end of BM2 polypeptide or N end, as long as the polypeptide after changing is kept substantially the lipase active of BM2.

In certain embodiments, the polypeptide of the present invention, for instance BM2 polypeptide or its variant and heterologous polypeptide.In some embodiments, BM2 fusion protein is kept substantially the lipase active of BM2.In certain embodiments, heterologous polypeptide is connected with the N end of BM2 polypeptide.In certain embodiments, heterologous polypeptide is connected with the C end of BM2 polypeptide.In these embodiments, heterologous polypeptide can be selected from purification tag (such as can include but not limited to: GST, MBP), epitope tag (such as can include but not limited to: Myc, FLAG), targeting sequence, signal peptide etc..

In a particular embodiment, fusion protein comprises BM2 polypeptide and label, and described label is combined with C-end or the N-end of BM2 polypeptide, is generally peptide tag.Described label usually can be used in separating the peptide with fusion protein described in purification or aminoacid sequence.Therefore, described label can be combined with one or more parts, for instance, one or more parts of the such as affinity substrate of chromatographic supports or high-affinity magnetic bead.The example of described label is able to high-affinity and nickel (Ni²⁺) post or cobalt (Co²⁺) post combine histidine-tagged (His-label or HT), for instance comprise the label of 6 histidine residues (His6 or H6).Other include Arg-label, FLAG-label, Strep-label etc. for the example tag of isolated or purified fusion protein.

Polynucleotide

This application provides the polynucleotide of encoding such polypeptides, it comprises selected from following sequence or is formed by selected from following sequence:

A () nucleotide sequence, it encodes the aminoacid sequence shown in SEQIDNO:1 or comprises the sequence of at least one aminoacid replacement, disappearance or interpolation in above-mentioned sequence；And

(b) under strict conditions with a) in the nucleotide sequence of nucleotide sequence hybridization.

In some specific embodiment, the polynucleotide encoding BM2 polypeptide of the present invention and functional equivalent variant thereof.In one embodiment, the polynucleotide of the present invention have at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% homology with the polynucleotide of coding BM2 and functional equivalent variant thereof.

In certain embodiments, the polynucleotide of the present invention comprise and have the nucleotide sequence of at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% homology with the nucleotide sequence shown in SEQIDNO:2.In preferred embodiments, the polynucleotide of the present invention comprise the nucleotide sequence shown in SEQIDNO:2.

In preferred embodiments, the polynucleotide of the present invention are made up of the nucleotide sequence with the nucleotide sequence shown in SEQIDNO:2 with 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% homology.In a more preferred embodiment, the polynucleotide of present invention nucleotide sequence shown in SEQIDNO:2 forms.

Terms used herein " polynucleotide " or " nucleic acid " refer to mRNA, RNA, cRNA, cDNA or DNA, including the DNA of strand and double chain form.This term is often referred to the nucleotide Multimeric forms of at least 10 bases longs, and described nucleotide is ribonucleotide or the modified forms of Deoxydization nucleotide or any type of nucleotide.

In certain embodiments, the polynucleotide of the present invention comprise the nucleotide sequence that the nucleotide sequence with coding BM2 polypeptide and functional equivalent variant thereof is hybridized under strict conditions, or are made up of the nucleotide sequence of the polypeptide being functionally equal to BM2 polypeptide with the nucleotide sequence specific hybrid and coding of coding BM2 polypeptide and functional equivalent variant thereof.

Those skilled in the art can the conventional stringent condition selecting DNA hybridization.Generally longer probe needs higher temperature, in order to carry out suitable annealing, and shorter probe needs relatively low temperature.Hybridization generally depends on when complementary strand is in the reannealing ability of the environment time variation DNA lower than its melting temperature.Probe and can between hybridization sequences degree of homology more high, the relative temperature that can adopt is more high.Then, higher relative temperature often makes reaction condition tightened up, and at a lower temperature, then stringency is relatively low.About the detailed description of hybridization stringent condition, see Ausubel etc., CurrentProtocolsinMolecularBiology, WileyIntersciencePublishers, (1995).

In certain embodiments, the stringent condition that DNA hybridization adopts includes: 1) adopt low ionic strength and high temperature during washing, for instance the 0.015M sodium chloride at 50 DEG C/0.0015M sodium citrate/0.1% sodium lauryl sulphate；2) denaturants such as Methanamide are adopted during hybridization, for instance at 42 DEG C, 50% (v/v) Methanamide adds 50mM sodium phosphate buffer and 750mM sodium chloride, the 75mM sodium citrate of 0.1% bovine serum albumin/0.1%Ficoll/0.1% polydiene ketopyrrolidine/pH6.5；Or (3) Overnight hybridization at 42 DEG C, hybridization solution is containing 50% Methanamide, 5xSSC (0.75M sodium chloride, the rotten 1 lemon acid sodium of 0.075M), 50mM sodium phosphate (pH6.8), 0.1% sodium pyrophosphate, 5xDenhardt ' s solution, the salmon sperm dna (50.mu.g/ml) of ultrasonic Treatment, 0.1%SDS and 10% dextran sulfate, then wash 10 minutes in 42 DEG C in 0.2xSSC (sodium chloride/sodium citrate), then carry out high stringency washing with the 0.1xSSC containing EDTA in 55 DEG C.Medium stringency condition can be determined by the description in Sambrook etc., MolecularCloning:ALaboratoryManual, NewYork:ColdSpringHarborPress, 1989.Medium stringency condition includes adopting stringency lower than wash solution described above and hybridization conditions (such as temperature, ionic strength and SDS percentage ratio).Such as, medium stringency condition includes the salt of the Methanamide with at least about 16%v/v at least about 30%v/v and at least about 0.5M at least about 0.9M 42 DEG C of hybridization, and with at least about 0.1M at least about 0.2M salt 55 DEG C of washings.Medium stringency condition can also include with 1% bovine serum albumin (BSA), 1mMEDTA, 0.5MNaHPO4 (pH7.2), 7%SDS 65 DEG C of hybridization, and with (i) 2 × SSC, 0.1%SDS；Or (ii) 0.5%BSA, 1mMEDTA, 40mMNaHPO4 (pH47.2), 5%SDS are 60-65 DEG C of washing.Professional will regulate temperature, ionic strength etc. according to factors such as probe length.Stringency during hybrid nucleic acid depends on length of nucleic acid molecule and complementarity and other variable well known in the art.Similarity or homology between two nucleotide sequences are more big, then the Tm of the nucleic acid hybrid containing these sequences is more big.The relative stability (Tm corresponding to higher) of nucleic acid hybridization is successively decreased in the following order: RNA:RNA, DNA:RNA, DNA:DNA.Preferably, the minimum length of hybrid nucleic acid 12 nucleotide can be at least about, it is preferable that be at least about 16, be more preferably at least about 24, be most preferably at least about 36 nucleotide.

The polynucleotide of the present invention can combine with other DNA sequence, described other DNA sequence such as promoter, poly-adenylation signal, other restriction enzyme sites, multiple clone site, other encoding segments etc. so that their total length can be dramatically different.Therefore the polynucleotide passage that can utilize almost random length is considered；Total length is preferably by the restriction of the convenience of preparation and use in expection recombinant DNA scheme.

What can utilize in known in the art and obtainable multiple mature technology any prepares, manipulates and/or expresses polynucleotide and fusions thereof.Such as, the polypeptide of code book invention or the polynucleotide sequence of its variant may be used in recombinant DNA molecules to instruct polypeptide to express in suitable host cell.Due to the degeneracy that genetic codon is intrinsic, other DNA sequence encoding substantially the same or functionally equivalent aminoacid sequence can be used in the present invention, and these sequences may be used for clone and express given polypeptide.

In certain embodiments, the polynucleotide of the present invention are produced by synthetic, for instance directly chemosynthesis or enzymatic synthesis.In alternative embodiments, above-mentioned polynucleotide are produced by recombinant technique.

In certain embodiments, it is possible to by conventional method preferably as dideoxy chain termination (Sangeretal.PNAS, 1977,74:5463-5467) measures the sequence of the polynucleotide obtained.This kind of polynucleotide sequence measures and also can complete with the sequencing kit bought.In order to obtain the cDNA sequence of total length, order-checking need to be repeatedly performed.Sometimes for the cDNA sequence measuring multiple clones, the cDNA sequence of total length just can be spliced into.

Expression vector

This application provides the expression vector of the polynucleotide comprising the present invention.

" expression vector " of the present invention is the nucleic acid construct recombinantly or synthetically produced, and it has a series of permission specific nucleic acid specified nucleic acid elements at host cell transcription.The expression vector of the present invention can be such as pCold-TF, pET-24a (+), the plasmid vector of pIRES2-EGFP, pcDNA3.1, pCI-neo, pDC516, pVAC, pcDNA4.0, pGEM-T, pDC315, or such as adenovirus, adeno-associated virus, retrovirus, semliki forest virus (sFv) carrier viral vector, or other carrier well known in the art.

In certain embodiments, the polynucleotide sequence of coding BM2 polypeptide and variant thereof is cloned in carrier, to constitute the recombinant vector containing polynucleotide of the present invention.

In preferred embodiments, the expression vector being used for cloning polynucleotide is plasmid vector.In a more preferred embodiment, described plasmid vector is pCold-TF.

In particular embodiments, above-mentioned expression vector also comprises the regulating and controlling sequence regulating polynucleotide expression, and wherein said polynucleotide are operably connected with described regulating and controlling sequence.

Term used herein " regulating and controlling sequence " refers to that realizing connected coded sequence expresses required polynucleotide sequence.The character of this kind of regulating and controlling sequence changes with host living beings.In prokaryote, this kind of regulating and controlling sequence generally comprises promoter, ribosome binding site and terminator；In eukaryote, this kind of regulating and controlling sequence generally comprises promoter, terminator and enhancer in some cases.Therefore, term " regulating and controlling sequence " includes that it exists the expression of genes of interest is required MIN all sequences, it is also possible to includes it and exists destination gene expression is advantageous for other sequence, for instance targeting sequencing.

Term used herein " is operably connected " and refers to following situation: involved sequence is among the relation allowing them to work in the way you want.It is thus possible, for instance " being operably connected " makes to realize the expression of this coded sequence compatible with described regulating and controlling sequence when to the regulating and controlling sequence of a coded sequence.

In certain embodiments, method well-known to those having ordinary skill in the art is utilized to build the expression vector of the nucleotide sequence comprising coding BM2 polypeptide and variant thereof and suitable transcribe/translational control element.These methods include (Sambroook, etal.MolecularCloning, aLaboratoryManual, coldSpringHarborLaboratory.NewYork, 1989) such as recombinant DNA technology in vi, DNA synthetic technology, In vivo recombination technology.Nucleotide sequence is operably connected in the suitable promoter in expression vector, to instruct mRNA to synthesize.The representative example of these promoteres includes: colibacillary lac or trp promoter；The PL promoter of bacteriophage lambda；Eukaryotic promoter includes the promoter that CMV immediate early promoter, HSV thymidine kinase promoter, early and late SV40 promoter, the LTRs of retrovirus retrovirus and some other known controlled gene are expressed in prokaryotic cell or eukaryotic cell or its virus.Expression vector also includes ribosome binding site and the transcription terminator etc. of translation initiation.Inserting enhancer sequence in the carrier will make its transcribing in higher eucaryotic cells be strengthened.Enhancer is the DNA cis-acting factors expressed, and generally about have 10 to 300 base pairs, acts on promoter transcribing with enhancing gene.Example includes the SV40 enhancer of 100 to 270 base pairs in replication origin side in late period, the polyoma enhancer in replication origin side in late period and adenovirus cancers etc..

In addition, expression vector preferably comprises one or more selected marker, to provide the phenotypic character of the host cell for selecting conversion, the dihydrofolate reductase cultivated such as eukaryotic cell, neomycin resistance and green fluorescent protein (GFP), or for colibacillary tetracycline or amicillin resistance etc..

Host cell

This application provides the host cell of polynucleotide or the expression vector comprising the present invention.

In certain embodiments, the polynucleotide of coding BM2 polypeptide and variant thereof or the expression vector containing these polynucleotide are transformed or transduced into host cell, it is thus achieved that containing the genetically engineered host cell of these polynucleotide or expression vector.

Host cell used herein can be any one host cell well known to those skilled in the art, including prokaryotic cell, eukaryotic cell, for instance bacterial cell, fungal cell, yeast cells, mammalian cell, insect cell or plant cell etc..Exemplary bacterial cell includes any kind in Escherichia, Bacillus, streptomyces, Salmonella, Rhodopseudomonas and staphylococcus, including such as escherichia coli, Lactococcus, bacillus subtilis, wax printing fabric, Salmonella typhimurium, pseudomonas fluorescens.Exemplary fungal cell includes any kind of aspergillus.Exemplary yeast cells includes any kind in pichia, beer yeast Pseudomonas, Schizosaccharomyces or Saccharomycodes, including Pichia sp., beer yeast or fission yeast.Exemplary insect cell includes any kind in Prodenia litura or fruit bat, including fruit bat S2 and Prodenia litura Sf9.Exemplary zooblast includes CHO, COS or melanoma or any mice or human cell line.Select suitable host in the limit of power of those skilled in the art.

Any technology known in the art can be utilized to import in host cell by expression vector, including the gene transfer of conversion, transduction, transfection, viral infection, particle gun or Ti-mediation.Concrete method includes (Davis, L., Dibner, M., Battey, I., BasicMethodsinMolecularBiology, (1986)) such as calcium phosphate transfection, the transfection of DEAE-glucosan mediation, fat transfection or electroporations.Exemplarily, when host is prokaryote such as escherichia coli, competent cell can be gathered in the crops at exponential growth after date, use CaCl well known in the art₂Method converts.

In particular embodiments, the host cell used by the present invention is escherichia coli.In preferred embodiments, the expression vector conversion carrying polynucleotide sequence of the present invention is carried out abduction delivering to e. coli bl21 (DE3).

The polypeptide of the application or the preparation method of lipase

The polypeptide of the application can be prepared by any suitable method that those skilled in the art are known, for instance is produced by recombinant technique, or chemosynthesis.The chemical synthesis process of peptide is also well known to those skilled in the art, such as, can by using the directed peptide symthesis of solid phase technique to produce polypeptide and the variant (Merrifield, J.Am.Chem.Soc.85:2149-2154 (1963)) thereof of the present invention.Albumen synthesis can be carried out with either manually or by automatization.For example, it is possible to realize Fully automated synthesis with the 431A peptide synthesizer (PerkinElmer) of AppliedBiosystems.Selectively, different sheet degree can synthesize respectively through chemical mode and utilize chemical method to be combined preparing required molecule.

In particular embodiments, it is provided that the method for the preparation polypeptide of the application or lipase, comprising:

1) polynucleotide of encoding such polypeptides are cloned on expression vector,

2) expression vector is directed in suitable host cell,

3) in suitable culture medium, host cell is cultivated, and

4) polypeptide described in separation also purification from described host cell or culture medium.

Suitable host cell refers to the host cell being suitable to expression vector or polynucleotide of interest expression.Suitable culture medium refers to be suitable to host cell growth or it is carried out the culture medium of abduction delivering.

In certain embodiments, according to host cell used, it is possible to select various conventional medium.Cultivate when being suitable to host cell growth.Preferably, the host cell of through engineering approaches can be cultivated in being modified the conventional nutrient culture being suitable to activate promoter, to screen transformant or the polynucleotide of amplification the application.Convert suitable host cell and when after host cell growth to suitable cell density, the promoter selected with suitable method (such as temperature transition or chemical induction) induction, cell is further cultured for a period of time, to allow it to produce desired polypeptides or its fragment.

In certain embodiments, by harvested by centrifugation host cell, by either physically or chemically smudge cells, and it is preserved for being further purified by the crude extract obtained.Microbial cell for protein expression can be crushed by any method easily, including freeze-thaw cycle, ultrasonic, Mechanical Crushing or use lysis agent.These methods are well known to those skilled in the art.

In certain embodiments, the recombinant polypeptide that host cell produces can be coated in cell or expresses on cell membrane or be secreted into extracellular.If it is required, its physics, chemistry separation by various separation methods with other characteristic and the albumen of purification of Recombinant can be utilized.Such as, the polypeptide of expression or its fragment can be reclaimed and purification by following methods well known in the art from recombinant cell culture thing: conventional renaturation processes, protein precipitant processes the combination of (salting-out method), centrifugal, the broken bacterium of infiltration, ultrasonic Treatment, ultracentrifugation, sieve chromatography (gel filtration), adsorption chromatography, ion-exchange chromatography, high performance liquid chroma-tography (HPLC) and other various liquid chromatography (LC) technology and these methods.Exemplarily property illustrates, the affinity chromatography purification of the albumen comprising peptide tag (such as His-label etc.) at C-end or N-end is the conventional method for obtaining high-purity polypeptide formulations.

In preferred embodiments, the method providing the polypeptide that preparation aminoacid sequence shown in SEQIDNO:1 forms, comprising: the polynucleotide that the nucleotide sequence shown in SEQIDNO:2 forms are cloned in expression vector pCold-TF, and the pCold-TF conversion with this polynucleotide sequence is carried out abduction delivering to e. coli bl21 (DE3), then separate and purification BM2 polypeptide from e. coli bl21 (DE3).

There is the application of the polypeptide of lipase active

The polypeptide of the application is the polypeptide with lipase active, it is possible to the hydrolysis of catalysis oils and fats, particularly the hydrolysis of catalysis butter oil.More specifically, the polypeptide of the present invention can hydrolyzed fat acid and glycerol hydroxy groups between ester bond.

This application provides aforementioned polypeptides, polynucleotide, expression vector or the host cell purposes in preparing lipase.

Present invention also provides aforementioned polypeptides or lipase, polynucleotide, expression vector or the host cell purposes in manufacturing food.Such as, in Dairy Processing, application lipase carries out butterfat hydrolysis in milk, can strengthen the local flavor of cheese, milk powder, butter, promotes the maturation of cheese, improves the quality of milk product.In wheaten food processing, add lipase, make wheaten food elasticity improve, improve sense of food, improve the preservativity of bread etc..

In some preferred embodiments, the polypeptide of the application is for having the narrow spectrum lipase of short chain, it is possible to for producing and/or the fragrance of fortified milk goods, therefore can be applied in during cheese manufactures.

Present invention also provides the food utilizing aforementioned polypeptides or lipase, polynucleotide, expression vector or host cell to manufacture, for instance milk product and wheaten food.

In the context of this application, " milk product " refers to any kind of goods based on breast, includes but not limited to cheese, butter, butter, milk product analog etc.." wheaten food " then refers to the food mainly made by flour.

In the specification and claims, word " includes ", " comprising " and " containing " means " including but not limited to ", and is not intended to get rid of other parts, additive, component or step.

Should be appreciated that, in the feature described in the particular aspects of the application, embodiment or embodiment, characteristic, component or step, be applicable to described herein any other aspect, embodiment or embodiment, it is possible at random combine as required and delete, unless contradiction with it.

Above disclosure generally describes the embodiment of the application, by the embodiment of the further example the application of the following examples.Describe these embodiments and be only the embodiment that the application is described rather than the scope of the embodiment of restriction the application.Although being used herein special term and value, these terms and value are understood to exemplary equally, do not limit scope disclosed in the present application.

Embodiment

The expression of embodiment 1:BM2 polypeptide and purification

Nucleotide sequence (its coded sequence is the polypeptide shown in SEQIDNo.:1 such as) shown in SEQIDNO.:2 is synthesized by Sangon Biotech (Shanghai) Co., Ltd., and is cloned on expression vector pCold-TF by the said firm.

PCold-TF with above-mentioned nucleotide sequence is converted to e. coli bl21 (DE3) carries out abduction delivering (referring specifically to, the Molecular Cloning: A Laboratory guide third edition, Science Press 2002 [U.S.] J. Pehanorm Brooker, D.W Russell work, Huang Peitang etc. translate), conversion condition is as follows: heat shock 50 seconds at 42 DEG C, ice bath 2 minutes, it is coated with LB flat board, picking transformant is seeded in LB culture medium (peptone 10g/L, yeast extract 5g/L and sodium chloride 10g/L) in, overnight seed culture is carried out in 37 DEG C, by the inoculum concentration of 1%, seed culture fluid is inoculated in expression culture medium, in 37 DEG C, 220rpm is cultured to OD600=0.6-0.8.

After being cooled to 16 DEG C, add isopropyl-beta D-thio galactopyranoside (IPTG) 1mM and induce, in 16 DEG C, 190rpm overnight expresses.After abduction delivering terminates, centrifugal collection thalline.With lysis buffer (50mM sodium dihydrogen phosphate, 300mM sodium chloride, 10mM imidazoles, pH8) resuspended thalline, wherein every gram of cell adds 5 milliliters of lysis buffers.

Resuspended thalline is carried out low temperature ultrasonic smudge cells (50% voltage output, ultrasonication in 2 seconds, 9 seconds intervals, be total to ultrasonic 20 minutes), during operation, sample ice bath is cooled down with protected protein.After cell breakage, it is centrifuged 20 minutes with 14000rpm and collects supernatant.

Every 100 milliliters of supernatants add 100 milliliters of Ni-NTA resin ice baths vibrate 60 minutes.nullNi resin cleer and peaceful on cell breakage is transferred to Ni-NTAAgarose chromatographic column (Qiagen，Cat.No.30210) in，After cell breakage supernatant is all through Ni resin，First with elution buffer 1 (the 50mM sodium dihydrogen phosphate of 10 column volumes、300mM sodium chloride、20mM imidazoles，PH8) clean，Again with elution buffer 2 (the 50mM sodium dihydrogen phosphate of 10 column volumes、300mM sodium chloride、50mM imidazoles，PH8) clean，Finally with elution buffer 3 (the 50mM sodium dihydrogen phosphate of 4 column volumes、300mM sodium chloride、250mM imidazoles，PH8) clean，And collect eluent，By eluent in 4 DEG C of dialysed overnight，Wherein the formula of dialysis solution used is: 150mM sodium chloride、20mMTris-HCl、10mM zinc sulfate、1mM dithiothreitol, DTT，pH8.By the testing result of gel electrophoresis (10%SDS-PAGE, 100V, 2 hour) as shown in Figure 1.According to Fig. 1 result, gained solution is the BM2 protein solution of purification.

Embodiment 2: the zymologic property of lipase B M2

The assay method of lipase activity

Adopt colorimetric method for determining lipase activity.With p-nitrophenyl butyrate (pNPB) for substrate, carry out the calculating of enzyme activity with the enzyme liquid of unit volume growing amount of enzymolysis generation paranitrophenol (pNP) within the unit interval.Concrete grammar is as follows: be pre-configured with substrate and buffer, substrate: 6mg/mLpNPB (isopropanol dissolving), buffer: 0.05MTris (pH8.0,0.1% arabic gum).Substrate and buffer are made into reaction mixture with 1:9 (v/v).Take two 2mL centrifuge tubes, respectively control tube and sample cell.Add 400uL reaction mixture respectively to two centrifuge tubes, at the pre-temperature bath 5min of suitable reaction temperature (such as 35 DEG C).In sample cell, add a certain amount of dilution enzyme liquid, after mix homogeneously, continue temperature bath 15min.Add 1.5mL ethanol to above-mentioned two centrifuge tubes and terminate reaction, and add the dilution enzyme liquid of same amount to control tube.12000rpm is centrifuged 2min, takes supernatant, surveys the light absorption value at 405nm place.

Enzyme activity unit is defined as: namely 1 unit refers to that catalysis per minute discharges the enzyme amount needed for the pNP of 1 μm of ol under standard laboratory conditions.According to standard curve gained enzyme computing formula alive it is: A=-([A1-A0] × 0.7885-0.0118) × V1 × n/ (V2 × t).A: sample enzyme is lived (U/mL), A1: OD405, the A0 of sample enzyme liquid: the OD405 of comparison enzyme liquid, V1: the volume (mL) of overall reaction liquid, n: the extension rate of enzyme liquid, V2: the volume (mL) of enzyme liquid, t: response time (min).

Embodiment 2-1Substratspezifitaet

Preparation 6mg/mL4-Nitrophenyl butyrate (PNPB), 4-nitrobenzophenone caprylate (pNPO), 4-nitrobenzophenone laurate (pNPD) and 4-nitrobenzophenone cetylate (pNPP), it is used that isopropanol dissolves, the vigor of lipase is detected according to above-mentioned standard pNPB method (being replaced by corresponding substrate), with the enzyme activity (1.1032U/ml) measured by the substrate that enzyme activity determination is the highest for 100%, calculate the enzyme activity being hydrolyzed other substrates.From Figure 2 it can be seen that BM2 can be hydrolyzed pNPB, pNPO, hydrolyzing activity is 0.704479U/ml respectively, 0.090237U/ml；And pNPD and pNPP is not acted on.Short-Chain Fatty Acids is specific by the ester hydrolysing activity of this explanation BM2, has Substratspezifitaet.

Embodiment 2-2Optimum temperature

At different temperature (15-60 DEG C), measure lipase activity according to pNPB method, to measure enzyme activity (1.5472U/ml) when enzyme is lived the highest for 100%, calculate relative enzyme at other temperature and live (as a percentage).As seen from Figure 3, the zymetology vigor of BM2 along with the raising of temperature present first rise after downward trend, wherein the enzyme activity of about 30 DEG C is the highest, and for 0.1739U/ml, this shows that the optimum temperature of BM2 lipase is at about 30 DEG C.

Embodiment 2-3The suitableeest action pH

By enzyme liquid, at the buffer of different pH (5.5-10.0), (wherein PH5.5-6.0 is 50mMMES buffer respectively, PH6.5-9.0 is 50mMTrisHCl buffer, PH10,50mMNaCO3 solution) in press at 30 DEG C pNPB method measure lipase activity, with measure vigor the highest time enzyme activity (0.299143U/ml) for 100%, calculate the relative activity (as a percentage) of enzyme under other pH.From fig. 4, it can be seen that the enzyme activity of BM2 along with the rising of pH value present first rise after downward trend, wherein during pH7 enzyme live the highest, therefore, the optimum pH of BM2 is about 7.It follows that lipase B M2 is neutral lipase.

Embodiment 2-4PH stability

By BM2 enzyme liquid respectively in the buffer system of different pH (4.0-10.0) (wherein, pH4-9 uses Tris-HCl buffer, pH9.5-10 uses Gly-NaOH buffer) in mix with the ratio of 1:1, be incubated 24 hours in 4 DEG C, then at 30 DEG C, press the vigor of pNPB method mensuration lipase under pH7.0.Using enzyme activity (1.3426U/ml) measured in the buffer the highest at enzyme activity as 100%, calculate the enzyme activity under other pH.As seen from Figure 5, BM2 lipase remains stable in the interval that pH is 8.0-9.0, and when pH is less than 8.0 or more than 9.0, lipase activity declines very fast, and when pH is less than 5.5, enzyme activity is less than 20%.

Embodiment 2-5The metal ion impact on lipase activity

Preparation ZnSO₄、MnCl₂、CoCl₂、CaCl₂、MgSO₄、CuSO₄、KCl、(NH4)₂SO₄、NaCl、NiSO4、FeCl₃, sodium citrate (C₆H₅Na₃O₇) and the salt stock solution such as disodiumedetate (EDTA).According to pNPB method, first prepare reaction mixture, subpackage 400uL mixed liquor in each reaction tube, and add the above-mentioned salt stock solution of final concentration of 5mmol/L, measure activity according still further to standard method.Matched group adds water and replaces salt stock solution, and its enzyme activity (0.099519U/ml), as 100%, calculates all the other groups enzyme activity relative to matched group.As shown in Figure 6, storing in liquid at CaCl2, MgSO4, MnCl2, lipase activity keeps better, storing in liquid at KCl and EDTA, and lipase activity loses completely.

Embodiment 2-6Surfactant is for the impact of lipase activity

The stock solution such as the cation surface activating CTAB of configuration 10%, anion surfactant SDS, nonionic surfactant Tween80, AEO-9 and TritonX-100.According to pNPB standard method, in reaction system, add the above-mentioned surfactant of 0.5% simultaneously, measure lipase activity.Matched group adds water and replaces surfactant, and its enzyme activity (0.395769U/ml), as 100%, calculates all the other groups enzyme activity relative to matched group.As it is shown in fig. 7, except interpolation SDS and tween80 reduction enzyme work to 50%, the interpolation of other kinds surfactant is little to lipase hydrolysis effect of vigor.

As can be known from the above results, the polypeptide of the application has lipase active, and/or has following at least one beneficial characteristics:

1) Short-Chain Fatty Acids specificity, BM2 can act on Short-Chain Fatty Acids, and during with other long-chain fatty acid for substrate, it does not have enzymatic activity detected.This shows, the application has the polypeptide of lipase active and is suitable for the production of milk product such as cheese.

2) having good enzymatic activity and stability in neutral pH range, for instance BM2 polypeptide (8.0-9.0) in neutral pH range remains stable for, enzyme activity is all at about more than 80% (Fig. 5).

3) there is good surfactant toleration, as it is shown in fig. 7, add kinds of surface activating agent not affect the enzyme activity of BM2 polypeptide.

4) storing in liquid at CaCl2, MgSO4, MnCl2, BM2 lipase activity keeps better.

Although being appreciated that the application is illustrated with some form, but the application is not limited in this specification content that is shown and that describe.It should be apparent to those skilled in the art that under the premise not necessarily departing from scope of the present application, it may also be made that various change.These changes are all in the scope that this application claims protection.

Claims (10)

1. having the polypeptide of lipase active, it comprises selected from following sequence or selected from following sequence composition:

(a) aminoacid sequence as shown in SEQIDNO:1, and

B sequence that () sequence described in (a) obtains after replacing, lacking or add at least one aminoacid,

The polypeptide variants wherein obtained by (b) still keeps lipase active.

2. polypeptide as claimed in claim 1, it comprises the aminoacid sequence shown in SEQIDNO:1, it is preferable that described polypeptide aminoacid sequence shown in SEQIDNO:1 forms.

3. the polynucleotide of coding polypeptide described in claim 1 or 2, it comprises selected from following sequence or is formed by selected from following sequence:

(a) nucleotide sequence, its coding aminoacid sequence as described in claim 1 (a) or 1 (b)；And

(b) under strict conditions with the nucleotide sequence of the nucleotide sequence hybridization in 3 (a).

4. polynucleotide as claimed in claim 3, it comprises the nucleotide sequence shown in SEQIDNO:2, it is preferable that described polynucleotide nucleotide sequence shown in SEQIDNO:2 forms.

5. expression vector, it comprises the polynucleotide according to any one of at least one claim 3 or 4.

6. carrier as claimed in claim 5, it also comprises the regulating and controlling sequence regulating the expression of described polynucleotide, and wherein said polynucleotide are operably connected with regulating and controlling sequence.

7. host cell, it comprises the expression vector described in the polypeptide described in claim 1 or 2, the polynucleotide according to any one of claim 3 or 4 or claim 5 or 6.

8. the polypeptide described in claim 1 or 2, the polynucleotide according to any one of claim 3 or 4, the expression vector described in claim 5 or 6 or the host cell described in claim 7 purposes in preparing lipase.

9. the polypeptide described in claim 1 or 2, the polynucleotide according to any one of claim 3 or 4, the expression vector described in claim 5 or 6, the purposes in food manufacturing of the host cell described in claim 7, it is preferred to the purposes in milk product manufactures.

10. utilize the food that the expression vector described in the polypeptide described in claim 1 or 2, the polynucleotide according to any one of claim 3 or 4, claim 5 or 6, host cell described in claim 7 manufacture, it is preferred to milk product.