CN105779416B

CN105779416B - Novel lipase

Info

Publication number: CN105779416B
Application number: CN201410833775.7A
Authority: CN
Inventors: 曾阿娜; 于钰; 冯奇; 许骏
Original assignee: Wilmar Shanghai Biotechnology Research and Development Center Co Ltd
Current assignee: Wilmar Shanghai Biotechnology Research and Development Center Co Ltd
Priority date: 2014-12-23
Filing date: 2014-12-23
Publication date: 2020-07-03
Anticipated expiration: 2034-12-23
Also published as: CN105779416A

Abstract

The application provides a polypeptide with lipase activity, which comprises an amino acid sequence shown in SEQ ID NO. 1 or a sequence comprising at least one amino acid substitution, determination or addition in the sequence. The application also provides polynucleotides encoding the polypeptides, expression vectors and host cells comprising the polynucleotides, and methods for producing the polypeptides. In addition, the application of the polypeptide with lipase activity is also related.

Description

Novel lipase

Technical Field

The present application is in the field of genetic or enzymatic engineering, and in particular relates to polypeptides having lipase activity, nucleic acids encoding the same, and expression vectors and host cells comprising the encoding nucleic acids. The application also relates to a preparation method and application of the polypeptide.

Background

Lipases are enzymes with various catalytic capacities, can catalyze the hydrolysis of triacylglycerides into glycerol and free fatty acids, and can catalyze the hydrolysis and transesterification of other esters and the synthesis reaction of esters. In addition, lipases also exhibit enantioselectivity towards substrates. The characteristics endow the Lipase with wide application in industries such as food and fat processing, detergent, biodiesel, ester bond compound synthesis and chiral drug synthesis (Abhishek Kumar Singh, Mausumi Mukhopadhyay. overview of Fungal Lipase: A review.2012,166(2): 486-.

For example, in the processing of fats and oils, since the hydrolysis of fats and oils can be carried out at normal temperature and pressure due to the introduction of lipase, biological substances such as highly unsaturated fatty acids and tocopherols are not denatured. In the medical field, lipase is used as a diagnostic tool, and diseases can be predicted, for example, lipase in serum can be used for detecting acute pancreatitis and pancreatic injury. The lipase also has application in drug production, weight reduction, etc. In the aspect of biodiesel synthesis, the enzyme method has the advantages of simple extraction and purification process, low equipment investment, low energy consumption, small pollution and the like, and increasingly attracts people to pay general attention, wherein the Novozym 435 and the Candida (Candida sp) 99-125 with fabric membrane immobilized are common enzymes for producing biodiesel. In the aspect of washing industry, in 1988, Novit company firstly puts detergents which contain lipase and can effectively remove oil stains to the market, and the development of lipase for detergents by applying genetic engineering is one of the most successful applications of modern biotechnology in large-scale industrialization. In the pulp and paper industry, lipases are used to remove "consistent lipids" from pulp, and the Nippon paper industry in Japan developed a "consistent lipid" control method, i.e., hydrolysis of triglycerides with Candida rugosa lipase, with a degree of hydrolysis of 90%.

Lipases catalyze the hydrolysis of milk fat to produce free fatty acids. The fatty acids may include short chains (C)₄-C₆Fatty acids, i.e. butyric acid, caproic acid) and medium to long chains (C)₁₂-C₁₈) The lipase used may influence the type of free fatty acids released in the cheese, e.g. the pungent, strong flavour mainly resulting from the release of short chain fatty acids (C)₄-C₆) While medium-long chain fatty acids give a soapy taste. Much research has been devoted to engineering lipases as short-chain preferential types for use in cheese making.

Summary of The Invention

In a first aspect, the present application provides a polypeptide having lipase activity comprising or consisting of a sequence selected from:

(a) 1, and an amino acid sequence as shown in SEQ ID NO, and

(b) a sequence obtained by substituting, deleting or adding at least one amino acid from the sequence of (a), wherein the polypeptide variant obtained from (b) still maintains lipase activity.

In an optional embodiment, the above polypeptide is fused to a heterologous polypeptide.

In one embodiment, the polypeptide of the present application comprises the amino acid sequence shown in SEQ ID NO. 1. In a preferred embodiment, the polypeptide consists of the amino acid sequence shown in SEQ ID NO. 1.

In a second aspect, there is provided a polynucleotide encoding a polypeptide of the first aspect comprising or consisting of a sequence selected from:

(a) a nucleotide sequence encoding the amino acid sequence shown as SEQ ID NO. 1 or a sequence comprising at least one amino acid substitution, deletion or addition in the above sequence; and

(b) a nucleotide sequence that hybridizes under stringent conditions to the nucleotide sequence in a).

In one embodiment, the polynucleotide of the invention comprises the nucleotide sequence set forth in SEQ ID NO. 2. In a preferred embodiment, the polynucleotide consists of the nucleotide sequence shown in SEQ ID NO. 2.

In one embodiment, the polynucleotides of the present application are produced synthetically or recombinantly.

In a third aspect, there is provided an expression vector comprising at least one polynucleotide as described above.

In certain embodiments, the expression vectors of the present application further comprise a control sequence that regulates expression of the polynucleotide, wherein the polynucleotide is operably linked to the control sequence. In a preferred embodiment, the expression vector is pCold-TF.

In a fourth aspect, there is provided a host cell comprising a polynucleotide or expression vector of the present application. In a preferred embodiment, the host cell is E.coli BL21(DE 3).

In a fifth aspect, there is provided a method of making a polypeptide of the present application, comprising:

1) cloning the above-mentioned polynucleotide on an expression vector,

2) the expression vector is transferred into a suitable host cell,

3) culturing said host cell in a suitable medium,

4) isolating and purifying the polypeptide from the host cell or culture medium.

In a preferred embodiment, there is provided a method of preparing a polypeptide consisting of the amino acid sequence shown in SEQ ID NO. 1, comprising: cloning a nucleotide sequence which codes for an amino acid sequence shown as SEQ ID NO. 1 into a plasmid expression vector, transforming the plasmid expression vector with the polynucleotide sequence into escherichia coli for induced expression, and then separating and purifying the BM2 polypeptide from the escherichia coli.

In a sixth aspect, a lipase prepared according to the method of the fifth aspect is provided.

In a seventh aspect, there is provided a use of the above polypeptide, polynucleotide, expression vector or host cell in the preparation of a lipase.

In an eighth aspect, there is provided the use of the polypeptide, lipase, polynucleotide, expression vector or host cell described above in the manufacture of a food product. In a preferred embodiment, the polypeptide, lipase, polynucleotide, expression vector or host cell described above in the present application is used in the manufacture of dairy products or pasta. In a particular embodiment, the dairy product is a cheese.

In a ninth aspect, there is provided a food product made using the polypeptide, lipase, polynucleotide, expression vector or host cell described above. In a preferred embodiment, the food product is a dairy product or pasta.

The polypeptides of the present application have medium-short chain fatty acid specificity and/or one or more of the following properties: has good enzyme activity and stability within the range of pH8.0-9.0; has good surfactant tolerance.

Brief description of the drawings

FIG. 1 shows a gel electrophoresis of BM2 polypeptide. Lane 1 is a molecular weight marker, and lane 2 is a BM2 polypeptide.

FIG. 2 shows the catalytic hydrolytic activity of BM2 as a lipase when 4-nitrophenylbutyrate (pNPB), 4-nitrophenyloctanoate (pNPO), 4-nitrophenyllaurate (pNPD) and 4-nitrophenylpalmitate (pNPP) were used as substrates, respectively.

FIG. 3 shows the enzymatic activity of BM2 at different temperatures.

FIG. 4 shows the enzymatic activity of BM2 at different pH.

Figure 5 shows the stability of lipase activity at different pH of BM 2.

Figure 6 shows the effect of metal ions on the lipase activity of BM 2. The control group is prepared by adding water into the reaction system, and adding ZnSO into the other groups₄、MnCl₂、CoCl₂、CaCl₂、MgSO₄、CuSO₄、KCl、(NH4)₂SO₄、NaCl、NiSO4、FeCl₃Sodium citrate (C)₆H₅Na₃O₇) And a salt stock solution of disodium Ethylenediaminetetraacetate (EDTA).

Figure 7 shows the effect of surfactant on the lipase activity of BM 2. The control group was added with water to the reaction system, and the other groups were added with 0.5% cationic surfactant CTAB, anionic surfactant SDS, nonionic surfactant Tween80, AEO-9 and Triton X-100, respectively.

Brief description of the sequences

1, SEQ ID NO: amino acid sequence of lipase BM2

MKDEIEKLNCGISVYLALVTSAAAKNENPPEETSGKSRHGKKQKRESGTEEAGENLGTEEAGVEPGIAELAGTPSDYSKQENWMRIPEITHEVDTFYIYPTCYLDDSEDAKPICDIDNPAVQARAKVVYENQGTVYEDSTNVFAPYYRQSNIYQVFDMEYEELEEYQRNEQRTDIYAALDYYFEHYNEGRPFIIAGHSQGSIMTKIILGEYMQAHPEYYERMVAAYPIGFSITEDFLKAHPYLKFAEGADDTGVIVSWNTEGKGNKGQKNLVVEPNAISINPINWKRDDTYAGFEENLGSRLWNEETGSYEVLQGIADAQVDTERGVVICTAEDIDYAPAELFGPESLHGHDYDFYYENLKENVKTRVEAYLKQN

2, SEQ ID NO: nucleotide sequence of lipase BM2

ATGAAAGATGAAATTGAGAAACTGAATTGTGGCATTAGTGTCTACCTTGCGCTGGTTACATCAGCTGCGGCAAAAAATGAAAATCCACCGGAAGAAACAAGCGGGAAAAGCAGGCACGGAAAGAAACAGAAGCGGGAATCTGGTACGGAAGAAGCGGGAGAAAACCTTGGCACGGAAGAGGCGGGAGTGGAACCCGGTATTGCAGAATTGGCAGGTACGCCATCTGATTATTCGAAACAGGAGAACTGGATGAGGATACCTGAGATTACACATGAAGTGGATACCTTTTATATTTACCCCACCTGCTATCTTGATGATTCAGAAGATGCCAAGCCAATCTGCGACATTGACAATCCCGCAGTTCAGGCCAGGGCCAAGGTTGTTTACGAAAACCAGGGGACGGTGTATGAAGATTCCACCAATGTATTTGCGCCCTATTATCGTCAGAGCAACATTTATCAGGTTTTCGATATGGAATATGAGGAACTGGAAGAGTACCAGCGAAATGAGCAGCGCACAGATATTTATGCAGCGCTGGATTACTACTTTGAGCATTATAATGAAGGCCGGCCCTTTATTATCGCAGGTCATTCTCAAGGGTCCATTATGACAAAAATCATTCTTGGAGAATATATGCAGGCTCATCCGGAATATTATGAACGGATGGTCGCAGCATATCCAATCGGATTTTCCATTACCGAGGATTTCCTGAAAGCCCATCCTTACCTGAAATTTGCAGAAGGTGCAGATGACACAGGGGTAATTGTATCATGGAATACAGAAGGAAAAGGGAACAAGGGGCAAAAGAATCTGGTTGTGGAACCCAATGCTATCAGCATTAACCCTATAAACTGGAAACGGGATGATACTTATGCCGGTTTCGAGGAGAACTTGGGCAGCCGCCTTTGGAATGAGGAAACAGGCAGCTATGAAGTGCTTCAGGGGATTGCAGACGCACAGGTGGATACAGAACGCGGCGTTGTGATCTGCACGGCAGAAGATATAGATTATGCCCCTGCGGAACTGTTCGGCCCGGAAAGTCTGCACGGCCACGATTATGATTTCTATTATGAGAATCTGAAAGAAAATGTAAAAACCAGAGTGGAGGCTTACTTAAAACAAAAT

Detailed Description

Polypeptides

The present application provides a polypeptide having lipase activity comprising or consisting of a sequence selected from:

(a) 1, and an amino acid sequence as shown in SEQ ID NO, and

In some embodiments, the number of amino acid substitutions, deletions or additions is 1 to 30, preferably 1 to 20, more preferably 1 to 10, wherein the resulting polypeptide variant substantially retains lipase activity. In preferred embodiments, the above polypeptide variants differ from the amino acid sequence shown in SEQ ID NO. 1 by substitutions, deletions and/or additions of about 1, 2,3, 4, 5, 6, 7, 8, 9, or 10 amino acids. In a more preferred embodiment, the above polypeptide variant differs from the amino acid sequence shown in SEQ ID NO. 1 by substitutions, deletions or additions of about 1, 2,3, 4 or 5 amino acids.

In some embodiments, the polypeptide of the present application comprises the amino acid sequence set forth in SEQ ID NO 1. In a preferred embodiment, the polypeptide consists of the amino acid sequence shown in SEQ ID NO. 1.

Thus, the present application provides a lipase comprising or consisting of a polypeptide having lipase activity as disclosed herein or a variant thereof. Herein, the polypeptide consisting of the amino acid sequence shown in SEQ ID NO. 1 is designated as lipase BM 2.

In an optional embodiment, the above polypeptide is fused to a heterologous polypeptide to form a fusion protein.

As used herein, the term "amino acid" refers to naturally occurring and non-naturally occurring amino acids as well as amino acid analogs and mimetics. Naturally occurring amino acids include the 20 (L) -amino acids used in protein biosynthesis, as well as other amino acids, such as 4-hydroxyproline, hydroxylysine, desmosine, isodesmosine, homocysteine, citrulline, and ornithine. Non-naturally occurring amino acids include, for example, (D) -amino acids, norleucine, norvaline, p-fluorophenylalanine, ethylmethionine, and the like, as known to those skilled in the art. Amino acid analogs include modified forms of naturally and non-naturally occurring amino acids. Such modifications may include, for example, substitution of chemical groups and moieties on the amino acids, or derivatization of the amino acids. Amino acid mimetics include, for example, organic structures that exhibit functionally similar properties, such as the charge and charge space characteristics of an amino acid. For example, the organic structure that mimics arginine (Arg or R) has a positively charged moiety that is located in a similar molecular space and has the same degree of mobility as the e-amino group of the side chain of the naturally occurring Arg amino acid. The mimetic also includes a constraining structure to maintain optimal steric and charge interactions of the amino acid or amino acid functional group. One skilled in the art can determine what structures constitute functionally equivalent amino acid analogs and amino acid mimetics.

In some embodiments, variants of the amino acid sequence set forth in SEQ ID NO. 1 have at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology with SEQ ID NO. 1. In a preferred embodiment, the polypeptide variant has more than 99% homology with the sequence shown in SEQ ID NO. 1.

"homology" as used herein is defined as the percentage of residues in an amino acid or nucleotide sequence variant that are identical, if necessary to the maximum percentage, after alignment and introduction of gaps in the sequence. Methods and computer programs for alignment are well known in the art.

The terms "polypeptide" and "protein" are used interchangeably herein to refer to polymers of amino acid residues and variants and synthetic and naturally occurring analogs thereof. Thus, these terms apply to naturally occurring amino acid polymers and naturally occurring chemical derivatives thereof, as well as amino acid polymers in which one or more amino acid residues are synthetic non-naturally occurring amino acids, such as chemical analogs of corresponding naturally occurring amino acids. Such derivatives include, for example, post-translational modifications and degradation products, including phosphorylated, glycosylated, oxidized, isomerized, and deaminated variants of the polypeptide fragment shown in SEQ ID NO: 1.

In a preferred embodiment, the sequence of the BM2 polypeptide variant is a sequence comprising one or several conservative amino acid substitutions in the amino acid sequence shown in SEQ ID No. 1, wherein the substituted sequence still retains lipase catalytic activity.

Certain amino acid substitutions, known as "conservative amino acid substitutions," can occur frequently in proteins without changing the conformation or function of the protein, a well-established rule in protein chemistry.

Conservative amino acid substitutions in the present invention include, but are not limited to, substitution of any one of glycine (G), alanine (a), isoleucine (I), valine (V), and leucine (L) for any one of these aliphatic amino acids; substitution of threonine (T) with serine (S) and vice versa; substitution of glutamic acid (E) with aspartic acid (D), and vice versa; (ii) substitution of asparagine (N) with glutamine (Q), and vice versa; substitution of arginine (R) with lysine (K), and vice versa; substitution of any one of these aromatic amino acids with phenylalanine (F), tyrosine (Y) and tryptophan (W); and substitution of cysteine (C) with methionine (M) and vice versa. Other substitutions may also be envisagedTo be conservative, it depends on the particular amino acid environment and its role in the three-dimensional structure of the protein. For example, glycine (G) and alanine (A) are often interchangeable, as are alanine (A) and valine (V). Methionine (M), which is relatively hydrophobic, can often be exchanged for leucine and isoleucine, and sometimes for valine. Lysine (K) and arginine (R) are often interchanged at the following positions: the important characteristics of the amino acid residues are their charge and the different pKs of the two amino acid residues are not significant. Still other changes may be considered "conservative" under certain circumstances (see, e.g., BIOCHEMISTRY at pp.13-15, 2)^nded.Lubert Stryered.(Stanford University)；Henikoff et al.,Proc.Nat’l Acad.Sci.USA(1992)89:10915-10919；Lei et al.,J.Biol.Chem.(1995)270(20):11882-11886)。

In the following, amino acid residues are exemplified by the group of substitutable residues, but the substitutable amino acid residues are not limited to the residues described below:

group A: leucine, isoleucine, norleucine, valine, norvaline, alanine, 2-aminobutyric acid, methionine, O-methylserine, tert-butylglycine and cyclohexylalanine;

group B: aspartic acid, glutamic acid, isoaspartic acid, isoglutamic acid, 2-aminoadipic acid, and 2-aminosuberic acid;

group C: asparagine and glutamine;

group D: lysine, arginine, ornithine, 2, 4-diaminobutyric acid, i.e., 2, 3-diaminopropionic acid;

group E: proline, 3-hydroxyproline and 4-hydroxyproline;

and F group: serine, threonine, and homoserine;

group G: phenylalanine and tyrosine.

For example, the inventors have found that one or more conservative substitutions in the first amino acid at position 132N-terminal of the BM2 polypeptide do not substantially affect lipase activity.

In other specific embodiments, the C-terminal or N-terminal region of the BM2 polypeptide may also be truncated by about 1, 2,3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids while still having the lipase activity of BM 2.

In further embodiments, 1, 2,3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may also be added to the C-terminal or N-terminal region of the BM2 polypeptide, the resulting BM2 variant still having lipase catalytic activity.

Furthermore, 1, 2,3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may also be added or deleted in regions other than the C-or N-terminus of the BM2 polypeptide, as long as the altered polypeptide substantially retains the lipase activity of BM 2.

In certain embodiments, a polypeptide of the invention, e.g., a BM2 polypeptide or variant thereof, is fused to a heterologous polypeptide. In some embodiments, the BM2 fusion protein substantially retains the lipase activity of BM 2. In certain embodiments, the heterologous polypeptide is linked to the N-terminus of the BM2 polypeptide. In certain embodiments, the heterologous polypeptide is linked to the C-terminus of the BM2 polypeptide. In these embodiments, the heterologous polypeptide can be selected from a purification tag (e.g., can include but is not limited to: GST, MBP), an epitope tag (e.g., can include but is not limited to: Myc, FLAG), a targeting sequence, a signal peptide, and the like.

In a specific embodiment, the fusion protein comprises a BM2 polypeptide and a tag, typically a peptide tag, attached to the C-terminus or N-terminus of the BM2 polypeptide. The tag is typically a peptide or amino acid sequence that can be used to isolate and purify the fusion protein. Thus, the tag is capable of binding to one or more ligands, e.g. one or more ligands of an affinity matrix such as a chromatography support or high affinity magnetic beads. Examples of such tags are those capable of binding nickel (Ni) with high affinity²⁺) Column or cobalt (Co)²⁺) A column-bound histidine tag (His-tag or HT), for example a tag comprising 6 histidine residues (His6 or H6). Other exemplary tags for isolation or purification of the fusion protein include Arg-tag, FLAG-tag, Strep-tag, and the like.

Polynucleotide

The present application provides polynucleotides encoding the above polypeptides comprising or consisting of a sequence selected from:

In certain specific embodiments, the polynucleotides of the invention encode BM2 polypeptides and functionally equivalent variants thereof. In one embodiment, the polynucleotide of the invention has at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% homology to a polynucleotide encoding BM2 and functionally equivalent variants thereof.

In certain embodiments, the polynucleotide of the invention comprises a nucleotide sequence that is at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% homologous to the nucleotide sequence set forth in SEQ ID NO. 2. In a preferred embodiment, the polynucleotide of the invention comprises the nucleotide sequence shown in SEQ ID NO. 2.

In a preferred embodiment, the polynucleotide of the invention consists of a nucleotide sequence which has 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% homology with the nucleotide sequence shown in SEQ ID NO. 2. In a more preferred embodiment, the polynucleotide of the invention consists of the nucleotide sequence shown in SEQ ID NO. 2.

The term "polynucleotide" or "nucleic acid" as used herein refers to mRNA, RNA, cRNA, cDNA, or DNA, including DNA in single-and double-stranded form. The term generally refers to a polymeric form of nucleotides of at least 10 bases in length, which are ribonucleotides or deoxynucleotides or modified forms of either type of nucleotide.

In certain embodiments, the polynucleotides of the invention comprise or consist of a nucleotide sequence that hybridizes specifically to a nucleotide sequence encoding a BM2 polypeptide and functionally equivalent variants thereof under stringent conditions and encodes a polypeptide functionally equivalent to a BM2 polypeptide.

Stringent conditions for DNA hybridization can be routinely selected by those skilled in the art. Generally, longer probes require higher temperatures for proper annealing, while shorter probes require lower temperatures. Hybridization generally depends on the ability of denatured DNA to reanneal when the complementary strand is in an environment below its melting temperature. The higher the degree of homology between the probe and hybridizable sequence, the higher the relative temperature that can be used. Thus, higher relative temperatures tend to make the reaction conditions more stringent, while at lower temperatures the stringency is lower. For a detailed description of the stringent conditions for hybridization reactions, see Ausubel et al, Current protocols in Molecular Biology, Wiley Interscience Publishers (1995).

In certain embodiments, DNA hybridization is performed using stringent conditions including 1) washing with low ionic strength and high temperature, e.g., 0.015M sodium chloride/0.0015M sodium citrate/0.1% sodium dodecyl sulfate at 50 ℃; 2) hybridization with denaturants such as formamide, e.g., 50% (v/v) formamide plus 0.1% bovine serum albumin/0.1% Ficoll/0.1% polydiallylpyrrolidone/50 mM sodium phosphate buffer at pH6.5 and 750mM sodium chloride, 75mM sodium citrate at 42 ℃, or (3) overnight hybridization at 42 ℃ under conditions where the hybridization solution contains 50% formamide, 5 XSSC (0.75M sodium chloride, 0.075M sodium citrate 1), 50mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 XDenhardt's solution, sonicated salmon sperm DNA (50.mu.g/ml), 0.1% SDS and 10% sodium sulfate, and then the hybridization conditions where the hybridization conditions for hybridization include hybridization with a stringent conditions such as stringent conditions of at least one or more preferably a probe (preferably a) with a stringent conditions where the hybridization conditions include a hybridization temperature range of at least about 0.55% cDNA hybridization is between 0.8 mM, 5% cDNA, a stringent conditions where the hybridization conditions for at least about 10% cDNA hybridization is greater than the hybridization conditions for at least about a stringent conditions for hybridization of a stringent DNA (preferably for at least about 10% cDNA, including a stringent conditions for at least about stringent conditions for a stringent conditions for at least about 10% cDNA, such as high stringency (0.5% cDNA, such as high stringency), a hybridization of a stringent conditions for at least about stringent conditions for a stringent conditions for at least about stringent conditions for a stringent DNA (0.8 mM DNA, such as high stringency), a stringent conditions for at least about a stringent conditions for at least about stringent conditions for a stringent conditions for at least about a stringent conditions for at least about a stringent conditions for a stringent conditions.

The polynucleotides of the invention may be combined with other DNA sequences, such as promoters, polyadenylation signals, other restriction sites, multiple cloning sites, other coding segments, and the like, such that their overall lengths may vary significantly. It is therefore contemplated that polynucleotide fragments of almost any length may be utilized; the overall length is preferably limited by the ease of preparation and use in contemplated recombinant DNA protocols.

Polynucleotides and fusions thereof can be prepared, manipulated, and/or expressed using any of a variety of mature techniques known and available in the art. For example, a polynucleotide sequence encoding a polypeptide of the present invention or a variant thereof may be used in a recombinant DNA molecule to direct expression of the polypeptide in an appropriate host cell. Due to the inherent degeneracy of the genetic code, other DNA sequences encoding substantially identical or functionally equivalent amino acid sequences may also be used in the present invention, and these sequences may be used to clone and express a given polypeptide.

In certain embodiments, the polynucleotides of the invention are produced by artificial synthesis, such as direct chemical synthesis or enzymatic synthesis. In alternative embodiments, the polynucleotides described above are produced by recombinant techniques.

In certain embodiments, the sequence of the obtained polynucleotide can be determined by conventional methods, preferably, for example, the dideoxy chain termination method (Sanger et. PNAS,1977,74: 5463-. Such polynucleotide sequencing can also be accomplished using commercially available sequencing kits. Sequencing was repeated to obtain a full-length cDNA sequence. Sometimes, it is necessary to sequence the cDNA of several clones to obtain the full-length cDNA sequence.

Expression vector

The present application provides expression vectors comprising the polynucleotides of the invention.

An "expression vector" as described herein is a nucleic acid construct, produced recombinantly or synthetically, with a series of specific nucleic acid elements that permit transcription of a particular nucleic acid in a host cell. The expression vector of the present invention may be a plasmid vector such as pCold-TF, pET-24a (+), pIRES2-EGFP, pcDNA3.1, pCI-neo, pDC516, pVAC, pcDNA4.0, pGEM-T, pDC315, or a viral vector such as adenovirus, adeno-associated virus, retrovirus, semliki forest virus (sFv) vector, or other vectors well known in the art.

In certain embodiments, the polynucleotide sequence encoding the BM2 polypeptide and variants thereof is cloned into a vector to form a recombinant vector comprising the polynucleotide of the invention.

In a preferred embodiment, the expression vector used to clone the polynucleotide is a plasmid vector. In a more preferred embodiment, the plasmid vector is pCold-TF.

In a specific embodiment, the above-described expression vector further comprises a control sequence that regulates expression of a polynucleotide, wherein the polynucleotide is operably linked to the control sequence.

The term "control sequences" as used herein refers to polynucleotide sequences required to effect expression of a coding sequence to which they are ligated. The nature of such regulatory sequences varies with the host organism. In prokaryotes, such regulatory sequences typically include a promoter, a ribosome binding site, and a terminator; in eukaryotes, such regulatory sequences generally include promoters, terminators, and, in some cases, enhancers. Thus, the term "regulatory sequence" includes all sequences whose presence is minimally necessary for expression of a gene of interest, and may also include other sequences whose presence is advantageous for expression of a gene of interest, such as leader sequences.

The term "operably linked" as used herein refers to the situation wherein: the sequences involved are in a relationship that allows them to function in the desired manner. Thus, for example, a regulatory sequence "operably linked" to a coding sequence is such that expression of the coding sequence is achieved under conditions compatible with the regulatory sequences.

In certain embodiments, expression vectors comprising a nucleotide sequence encoding BM2 polypeptide and variants thereof and suitable transcription/translation regulatory elements are constructed using methods well known to those skilled in the art. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, etc. (Sambrook, et al. molecular Cloning, a laboratory Manual, cold Spring Harbor laboratory. New York, 1989). The nucleotide sequence is operably linked to an appropriate promoter in an expression vector to direct mRNA synthesis. Representative examples of such promoters include: lac or trp promoter of E.coli; the PL promoter of lambda phage; eukaryotic promoters include CMV immediate early promoter, HSV thymidine kinase promoter, early and late SV40 promoter, LTRs of retrovirus, and other known promoters capable of controlling the expression of genes in prokaryotic or eukaryotic cells or viruses. The expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. The insertion of enhancer sequences into vectors will enhance transcription in higher eukaryotic cells. Enhancers are cis-acting elements of DNA, usually about 10 to 300 base pairs, that act on a promoter to increase transcription of a gene. Examples include the SV40 enhancer on the late side of the replication origin at 100 to 270 bp, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers, among others.

In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and Green Fluorescent Protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for E.coli, and the like.

Host cell

The present application provides host cells comprising a polynucleotide or expression vector of the invention.

In certain embodiments, a polynucleotide encoding a BM2 polypeptide or variant thereof, or an expression vector comprising the polynucleotide, is transformed or transduced into a host cell to obtain a genetically engineered host cell comprising the polynucleotide or expression vector.

The host cell used herein may be any host cell known to those skilled in the art, including prokaryotic cells, eukaryotic cells, such as bacterial cells, fungal cells, yeast cells, mammalian cells, insect cells, or plant cells, and the like. Exemplary bacterial cells include any of the genera Escherichia, Bacillus, Streptomyces, Salmonella, Pseudomonas, and Staphylococcus, including, for example, Escherichia coli, lactococcus lactis, Bacillus subtilis, Bacillus cereus, Salmonella typhimurium, Pseudomonas fluorescens. Exemplary fungal cells include any species of Aspergillus. Exemplary yeast cells include any of the genera Pichia, Saccharomyces, Schizosaccharomyces, or Saccharomyces, including Pichia, Saccharomyces, or Schizosaccharomyces. Exemplary insect cells include spodoptera litura or any of the drosophila species, including drosophila S2 and spodoptera Sf 9. Exemplary animal cells include CHO, COS or melanoma or any mouse or human cell line. The selection of a suitable host is within the ability of those skilled in the art.

The expression vector may be introduced into the host cell using any technique known in the art, including transformation, transduction, transfection, viral infection, gene gun, or Ti-mediated gene transfer. Specific Methods include calcium phosphate transfection, DEAE-dextran mediated transfection, lipofection, or electroporation, among others (Davis, L., Dibner, M., Battey, I., Basic Methods in molecular Biology, (1986)). As an example, when the host is the originIn the case of nuclear organisms such as E.coli, competent cells can be harvested after exponential growth phase, using CaCl as is well known in the art₂The method is used for transformation.

In a particular embodiment, the host cell used in the present invention is E.coli. In a preferred embodiment, the expression vector carrying the polynucleotide sequence of the invention is transformed into E.coli BL21(DE3) for inducible expression.

Methods of producing the polypeptides or lipases of the present application

The polypeptides of the present application may be prepared by any suitable method known to those skilled in the art, for example by recombinant techniques, or by chemical synthesis. Chemical synthesis methods for peptides are also well known to those skilled in the art, e.g., the polypeptides of the invention and variants thereof can be produced by directed peptide synthesis using solid phase techniques (Merrifield, J.Am.chem.Soc.85:2149- "2154 (1963)). Protein synthesis can be performed manually or by automation. Automated synthesis can be achieved, for example, using a 431A peptide synthesizer from applied biosystems (Perkin Elmer). Alternatively, the different degrees of fragmentation can be separately chemically synthesized and chemically combined to produce the desired molecule.

In a specific embodiment, there is provided a method of making a polypeptide or lipase of the present application comprising:

1) cloning the polynucleotide encoding the polypeptide on an expression vector,

2) introducing the expression vector into a suitable host cell,

3) culturing the host cell in a suitable medium, and

Suitable host cells refer to host cells suitable for expression of the expression vector or polynucleotide of interest. Suitable medium means a medium suitable for growth of the host cell or for inducible expression thereof.

In certain embodiments, various conventional media may be selected depending on the host cell used. The culturing is performed under conditions suitable for growth of the host cell. Preferably, the engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating the promoter to screen for transformants or to amplify the polynucleotides of the present application. After transformation of a suitable host cell and growth of the host cell to an appropriate cell density, the selected promoter is induced by suitable means (e.g., temperature shift or chemical induction), and the cell is cultured for an additional period of time to allow production of the polypeptide of interest or a fragment thereof.

In certain embodiments, the host cells are harvested by centrifugation, the cells are disrupted by physical or chemical means, and the resulting crude extract is retained for further purification. Microbial cells for protein expression may be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents. These methods are well known to those skilled in the art.

In certain embodiments, the recombinant polypeptide produced by the host cell may be encapsulated within the cell, or expressed on the cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. For example, the expressed polypeptide or fragment thereof can be recovered and purified from recombinant cell culture by the following methods well known in the art: conventional renaturation treatment, protein precipitant treatment (salting-out method), centrifugation, cell lysis by osmosis, sonication, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, High Performance Liquid Chromatography (HPLC), and other various liquid chromatography techniques and combinations thereof. By way of illustration, affinity chromatography purification of proteins comprising a peptide tag (e.g., His-tag, etc.) at the C-terminus or N-terminus is a routine method for obtaining high purity polypeptide preparations.

In a preferred embodiment, there is provided a method of preparing a polypeptide consisting of the amino acid sequence shown in SEQ ID NO. 1, comprising: cloning a polynucleotide consisting of a nucleotide sequence shown as SEQ ID NO. 2 into an expression vector pCold-TF, transforming the pCold-TF with the polynucleotide sequence into Escherichia coli BL21(DE3) for induced expression, and then separating and purifying BM2 polypeptide from Escherichia coli BL21(DE 3).

Use of polypeptides having lipase activity

The polypeptide of the present application is a polypeptide having lipase activity, and is capable of catalyzing hydrolysis of oil and fat, particularly milk fat. More specifically, the polypeptides of the invention are capable of hydrolyzing the ester bond between a fatty acid and a glycerol hydroxyl group.

The application provides the use of the polypeptide, polynucleotide, expression vector or host cell in preparing lipase.

The application also provides the use of the above polypeptide or lipase, polynucleotide, expression vector or host cell in the manufacture of a food product. For example, in the aspect of dairy processing, the lipase is used for carrying out milk fat hydrolysis in dairy, so that the flavors of cheese, milk powder and cream can be enhanced, the maturity of cheese is promoted, and the quality of dairy products is improved. In the aspect of processing the wheaten food, lipase is added to improve the elasticity of the wheaten food, improve the taste and improve the fresh-keeping capacity of bread and the like.

In some preferred embodiments, the polypeptides of the present application are lipases with short chain specificity, which can be used to generate and/or enhance the flavour of dairy products, and thus can be applied in cheese making.

The present application also provides food products, such as dairy products and pasta, made using the above polypeptides or lipases, polynucleotides, expression vectors or host cells.

In the context of the present application, "dairy product" refers to any kind of milk-based product, including but not limited to cheese, butter, cream, dairy analogues and the like. The term "pasta" means a food product made mainly of flour.

In this specification and claims, the words "comprise", "comprising" and "contain" mean "including but not limited to", and are not intended to exclude other moieties, additives, components, or steps.

It should be understood that features, characteristics, components or steps described in a specific aspect, embodiment or example of the present application may be applied to any other aspect, embodiment or example described herein and may be arbitrarily combined and deleted as desired unless incompatible therewith.

The foregoing disclosure generally describes embodiments of the present application, which are further illustrated by the following examples. These examples are described merely to illustrate embodiments of the present application and do not limit the scope of embodiments of the present application. Although specific terms and values are employed herein, they are to be understood as exemplary and not limiting the scope of the disclosure.

Examples

Example 1: expression and purification of BM2 polypeptide

The nucleotide sequence shown in SEQ ID No.:2 (the polypeptide of which the coding sequence is shown in SEQ ID No.: 1) was synthesized by Biotechnology engineering (Shanghai) Co., Ltd and cloned on expression vector pCold-TF by the same company.

pCold-TF having the nucleotide sequence described above was transformed into E.coli BL21(DE3) for induction expression (see, specifically, third edition of molecular cloning protocols, science publishers 2002[ American ] J. sambrook, D.W Lassel, Huang Petang et al) under conditions of heat shock at 42 ℃ for 50 seconds, ice bath for 2 minutes, LB plate application, selection of transformants inoculated into LB medium (peptone 10g/L, yeast extract 5g/L, and sodium chloride 10g/L), overnight seed culture at 37 ℃, inoculation of 1% seed culture into expression medium, and cultivation at 37 ℃ and 220rpm until OD600 is 0.6-0.8.

After cooling to 16 ℃, 1mM of isopropyl- β -D-thiogalactopyranoside (IPTG) was added for induction and expression was performed overnight at 16 ℃ at 190rpm after induction expression was completed, the cells were collected by centrifugation and resuspended in lysis buffer (50mM sodium dihydrogen phosphate, 300mM sodium chloride, 10mM imidazole, pH8) with 5ml of lysis buffer per gram of cells.

The resuspended cells were sonicated at low temperature (50% voltage output, 2 sec sonication, 9 sec intervals for 20 min total) and samples were ice-cooled to preserve proteins during the procedure. After cell disruption, centrifugation was carried out at 14000rpm for 20 minutes and the supernatant was collected.

Every 100 ml of supernatant was added with 100 ml of Ni-NTA resin and shaken in ice bath for 60 minutes. Transferring the cell disruption supernatant and the Ni resin to a Ni-NTA Agarose chromatography column (Qiagen, Cat. No.30210), after the cell disruption supernatant was completely passed through the Ni resin, washing with 10 column volumes of elution buffer 1(50mM sodium dihydrogen phosphate, 300mM sodium chloride, 20mM imidazole, pH8), then with 10 column volumes of elution buffer 2(50mM sodium dihydrogen phosphate, 300mM sodium chloride, 50mM imidazole, pH8), finally with 4 column volumes of elution buffer 3(50mM sodium dihydrogen phosphate, 300mM sodium chloride, 250mM imidazole, pH8), collecting the eluate, dialyzing the eluate at 4 ℃ overnight, wherein the formulation of the dialysate used was: 150mM sodium chloride, 20mM Tris-HCl, 10mM zinc sulfate, 1mM dithiothreitol, pH8. The results of detection by gel electrophoresis (10% SDS-PAGE,100V,2 hours) are shown in FIG. 1. According to the results of fig. 1, the resulting solution was a purified BM2 protein solution.

Example 2: enzymatic Properties of Lipase BM2

Method for measuring lipase activity

The lipase activity was determined by colorimetric method. The enzyme activity was calculated from the amount of p-nitrophenol (pNP) produced by enzymatic hydrolysis of a unit volume of enzyme solution per unit time using p-nitrobenzoate (pNPB) as a substrate. The specific method comprises the following steps: preparing a substrate and a buffer solution in advance, wherein the substrate: 6mg/mL pNPB (isopropanol dissolved), buffer: 0.05M Tris (pH8.0, 0.1% gum arabic). A reaction mixture was prepared with the substrate and the buffer at 1:9 (v/v). Two 2mL centrifuge tubes were taken as a control tube and a sample tube, respectively. 400uL of each reaction mixture was added to each centrifuge tube and pre-warmed at the appropriate reaction temperature (e.g., 35 ℃) for 5 min. Adding a certain amount of diluted enzyme solution into the sample tube, mixing uniformly, and continuing to perform warm bath for 15 min. Add 1.5mL of ethanol to both tubes to stop the reaction and add the same amount of diluted enzyme solution to the control tube. Centrifuging at 12000rpm for 2min, collecting supernatant, and measuring absorbance at 405 nm.

The enzyme activity unit is defined as 1 unit, namely the enzyme quantity required for catalyzing and releasing 1 mu mol of pNP per minute under the standard experimental conditions, the calculation formula of the enzyme activity obtained according to the standard curve is that A is- ([ A1-A0] × 0.7885-0.0118) × V1 × n/(V2 × t), A is sample enzyme activity (U/mL), A1 is OD405 of sample enzyme liquid, A0 is OD405 of control enzyme liquid, V1 is volume (mL) of total reaction liquid, n is dilution multiple of the enzyme liquid, V2 is volume (mL) of the enzyme liquid, and t is reaction time (min).

Example 2-1Substrate specificity

Preparing 6mg/mL 4-nitrophenyl butyrate (PNPB), 4-nitrophenyl caprylate (pNPO), 4-nitrophenyl laurate (pNPD) and 4-nitrophenyl palmitate (pNPP), dissolving the two by using isopropanol, detecting the activity of lipase according to the standard pNPB method (replacing the pNPB method with a corresponding substrate), and calculating the relative enzyme activity for hydrolyzing other substrates by using the enzyme activity (1.1032U/mL) measured by the highest substrate measured by the enzyme activity as 100%. As can be seen from FIG. 2, BM2 can hydrolyze pNPB and pNPO, and the hydrolase activities are 0.704479U/ml and 0.090237U/ml respectively; but had no effect on pNPD and pNPP. This indicates that the esterolytic activity of BM2 is specific for medium-short chain fatty acids with substrate specificity.

Examples 2 to 2Optimum temperature of action

The lipase activity is measured according to a pNPB method at different temperatures (15-60 ℃), the enzyme activity (1.5472U/ml) when the highest enzyme activity is measured is 100%, and the relative enzyme activity (expressed in percentage) at other temperatures is calculated. As can be seen from FIG. 3, the enzymatic activity of BM2 shows a trend of increasing first and then decreasing with the increase of temperature, wherein the highest enzymatic activity at about 30 ℃ is 0.1739U/ml, which indicates that the optimum action temperature of BM2 lipase is about 30 ℃.

Examples 2 to 3Optimum pH for action

The lipase activity was measured by the pNPB method at 30 ℃ in buffers of different pH values (5.5-10.0) respectively (50mM MES buffer, 50mM Tris HCl buffer, pH6.5-9.0, 50mM NaCO3 solution, pH 10) to determine the enzyme activity (0.299143U/ml) at the highest activity as 100%, and the relative activities (expressed as percentages) of the enzymes at other pH values were calculated. As can be seen from FIG. 4, the enzyme activity of BM2 shows a trend of increasing first and then decreasing with the increase of pH value, wherein the enzyme activity is highest at pH7, and therefore, the optimum pH value of BM2 is around 7. From this, it was found that the lipase BM2 was a neutral lipase.

Examples 2 to 4Stability of pH

Respectively mixing BM2 enzyme solution in buffer systems with different pH values (4.0-10.0) (wherein, Tris-HCl buffer solution is used at pH4-9, and Gly-NaOH buffer solution is used at pH 9.5-10) at a ratio of 1:1, keeping the temperature at 4 ℃ for 24 hours, and determining the activity of lipase by a pNPB method at 30 ℃ and pH 7.0. The enzyme activity (1.3426U/ml) measured in the buffer with the highest enzyme activity was taken as 100%, and the relative enzyme activities at other pHs were calculated. As can be seen from FIG. 5, BM2 lipase is stable at pH8.0-9.0, and has lipase activity decreasing rapidly at pH less than 8.0 or greater than 9.0 and less than 20% at pH less than 5.5.

Examples 2 to 5Effect of Metal ions on Lipase Activity

Preparation of ZnSO₄、MnCl₂、CoCl₂、CaCl₂、MgSO₄、CuSO₄、KCl、(NH4)₂SO₄、NaCl、NiSO4、FeCl₃Sodium citrate (C)₆H₅Na₃O₇) And a salt stock solution such as disodium Ethylenediaminetetraacetate (EDTA). According to the pNPB method, reaction mixtures were prepared first, 400uL of the mixture was packed into each reaction tube, and the above-mentioned salt stock solution was added to a final concentration of 5mmol/L, and the activity was measured according to a standard method. In the control group, water was added instead of the salt stock solution, and the enzyme activity (0.099519U/ml) was taken as 100%, and the relative enzyme activities of the remaining groups to the control group were calculated. As shown in FIG. 6, lipase enzyme activity was well maintained in CaCl2, MgSO4, and MnCl2 stock solutions, and lipase enzyme activity was completely lost in KCl and EDTA stock solutions.

Examples 2 to 6Effect of surfactants on Lipase Activity

Stock solutions of 10% of cationic surfactant CTAB, anionic surfactant SDS, nonionic surfactant Tween80, AEO-9, Triton X-100 and the like are prepared. And (3) according to a pNPB standard method, simultaneously adding 0.5% of the surfactant into a reaction system, and measuring the activity of the lipase. In the control group, water was added instead of the surfactant, and the enzyme activity (0.395769U/ml) was taken as 100%, and the relative enzyme activities of the remaining groups to the control group were calculated. As shown in fig. 7, the addition of various surfactants had little effect on the lipase hydrolysis activity, except that the addition of SDS and tween80 reduced the enzyme activity to 50%.

From the above results, it can be seen that the polypeptides of the present application have lipase activity, and/or have at least one of the following beneficial properties:

1) medium short chain fatty acid specificity, BM2 was able to act on medium short chain fatty acids, whereas no enzymatic activity was detected with other long chain fatty acids as substrates. This indicates that the polypeptides having lipase activity of the present application are suitable for use in the production of dairy products such as cheese.

2) Has better enzyme activity and stability in a neutral pH range, for example, BM2 polypeptide is kept stable in the neutral pH range (8.0-9.0), and the enzyme activity is above about 80% (FIG. 5).

3) Has good surfactant tolerance, as shown in figure 7, the enzyme activity of BM2 polypeptide is not affected by the addition of various surfactants.

4) The BM2 lipase enzyme activity is kept better in CaCl2, MgSO4 and MnCl2 storage solution.

It is to be understood that while the application is illustrated in certain forms, it is not limited to what has been shown and described herein. It will be apparent to those skilled in the art that various changes can be made without departing from the scope of the application. Such variations are within the scope of the claims of this application.

Claims

1. A polypeptide having lipase activity, consisting of a sequence selected from the group consisting of:

(a) 1, and an amino acid sequence as shown in SEQ ID NO, and

(b) a sequence obtained by deleting an amino acid from the N-terminus of the sequence of (a),

wherein the polypeptide variant obtained in (b) retains lipase activity.

2. The polypeptide of claim 1, which consists of the amino acid sequence shown in SEQ ID NO 1.

3. A polynucleotide encoding the polypeptide of claim 1 or 2, comprising or consisting of a sequence selected from:

(a) a nucleotide sequence encoding the amino acid sequence of claim 1(a) or 1 (b); and

(b) a nucleotide sequence that hybridizes under stringent conditions to the nucleotide sequence in 3 (a).

4. The polynucleotide of claim 3, comprising the nucleotide sequence set forth in SEQ ID NO 2.

5. The polynucleotide of claim 4, consisting of the nucleotide sequence set forth in SEQ ID NO. 2.

6. An expression vector comprising at least one polynucleotide of any one of claims 3-5.

7. The expression vector of claim 6, further comprising a control sequence that regulates expression of the polynucleotide, wherein the polynucleotide is operably linked to the control sequence.

8. A host cell comprising the polypeptide of claim 1 or 2, the polynucleotide of any one of claims 3-5, or the expression vector of claim 6 or 7.

9. Use of the polypeptide of claim 1 or 2, the polynucleotide of any one of claims 3-5, the expression vector of claim 6 or 7, or the host cell of claim 8 in the preparation of a lipase.

10. Use of the polypeptide of claim 1 or 2, the polynucleotide of any one of claims 3-5, the expression vector of claim 6 or 7, the host cell of claim 8 in the manufacture of a food product.

11. Use according to claim 10, wherein the use is in the manufacture of a dairy product.