CN104818281A - pig Lgr5 gene and applications thereof - Google Patents
pig Lgr5 gene and applications thereof Download PDFInfo
- Publication number
- CN104818281A CN104818281A CN201510082658.6A CN201510082658A CN104818281A CN 104818281 A CN104818281 A CN 104818281A CN 201510082658 A CN201510082658 A CN 201510082658A CN 104818281 A CN104818281 A CN 104818281A
- Authority
- CN
- China
- Prior art keywords
- lgr5
- leu
- gene
- ser
- ala
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention belongs to the technical field of livestock molecular biology, and particularly discloses a pig Lgr5 gene and applications thereof, wherein the gene sequence is represented by SEQ ID NO:1. According to the present invention, the human Lgr5 gene and the mouse Lgr5 gene are adopted as the reference sequence, the specific primers are designed, and the RACE, the ordinary PCR, and the overlap PCR are used to firstly clone the pig Lgr5 cDNA; the subsequent study results show that the cell proliferation can be promoted and the cell damage repair can be accelerated with the over-expression of the Lgr5 gene; and the Lgr5 provides the important foundation for the subsequent pig Lgr5 function research and the intestinal stem cell research.
Description
Technical field
The present invention relates to domestic animal technical field of molecular biology, more specifically, relate to boar Lgr5 gene and an application thereof.
Background technology
Lgr5, has another name called GPR49, HG38, FEX, is G-protein linked receptor superfamily member, by having 18 high molecular weight proteins being rich in leucic repeating unit and 7 trans-membrane region and forming; The latest study proves, Lgr5 is the target gene in Wnt signal path downstream, and can be used as the stem cell labeling thing at the positions such as intestines, and the product that Lgr5 expresses all plays an important role in the generation, development of the growth of embryo and organ and kinds of tumors.
Lgr5 gene is positioned at people No. 12 karyomit(e) 12q22-q23, mouse No. 10 karyomit(e) D2|10, rat (Rattus norvegicus) No. 7 karyomit(e) 7q22, rhesus macaque (Macaca mulatta) No. 11 karyomit(e)s, ox (Bos taurus) No. 5 karyomit(e)s, family's chicken (Gallus gallus) No. 1 karyomit(e), on family pig (Sus Scrofa) No. 5 karyomit(e)s; The domestic and international research about pig Lgr5 gene is little at present.
The Lgr5 gene of pig is not also cloned in prior art, contriver is on the basis of people Lgr5 gene and mouse Lgr5 gene, Lgr5 gene is cloned by molecular biological means, in the process of clone Lgr5 gene, the fragment normally choosing people Lgr5 gene and mouse Lgr5 DNA homolog carries out RACE, thus clone Lgr5 gene further, but, contriver cannot clone Lgr5 gene by the method for design homologous primer, inventor has devised specific primer and has just cloned Lgr5 gene.
The primer sequence of the Lgr5 gene that can increase of the present invention is as shown in SEQ ID NO:3 ~ 13.
The present invention also provides the coding pig Lgr5 albumen of gene, and its aminoacid sequence is as shown in SEQ ID NO:2.
Present invention also offers a kind of primer for detecting pig Lgr5 gene, described primer sequence is as shown in SEQ ID NO:14 ~ 15.
Carrier containing Lgr5 gene or the recombinant chou containing described carrier also belong to protection scope of the present invention.
The present invention also provides the albumen of Lgr5 gene and/or Lgr5 genes encoding to promote the application in the preparation of cell proliferation in preparation, and particularly, described cell is the intestinal epithelial cell of pig.
The present invention also provides the albumen of Lgr5 gene and/or Lgr5 genes encoding to accelerate the application in the preparation of cell injury reparation in preparation, and particularly, described cell is the intestinal epithelial cell of pig.
Compared with prior art, the present invention has following beneficial effect:
The invention provides a boar Lgr5 gene, the sequence of described gene is as shown in SEQ ID NO:1, the present invention utilizes people Lgr5 gene and mouse Lgr5 gene to be canonical sequence, design Auele Specific Primer, uses the method for RACE, regular-PCR, over-lap PCR to clone pig Lgr5 cDNA first; Follow-up study finds that process LAN Lgr5 gene can promote cell proliferation, and accelerate the cytothesis of damage, Lgr5 of the present invention is that important foundation has been established in the follow-up functional study of pig Lgr5 gene and the research of little intestinal stem cell.
Summary of the invention
Technical problem to be solved by this invention overcomes in prior art the defect not having pig Lgr5 complete genome sequence, provides a kind of Lgr5 gene.
Second object of the present invention is to provide the albumen of above-mentioned Lgr5 genes encoding.
3rd object of the present invention is to provide carrier containing above-mentioned Lgr5 gene or/and recombinant chou.
4th object of the present invention is to provide said gene or/and the application of albumen of genes encoding.
The object of the invention is to be achieved by the following technical programs:
One boar Lgr5 gene, its gene order is as shown in SEQ ID NO:1.
Accompanying drawing explanation
Fig. 1 is the electrophoresis result figure of the 3'RACE amplified production of Lgr5 gene fragment; M:DNA Marker DL2000 in figure, 1:3'RACE product.
Fig. 2 is the electrophoresis result figure of the pcr amplification product of Lgr5 gene fragment; M:DNA Marker DL2000,1:Lgr5 A (1143 bp) in figure.
Fig. 3 is the electrophoresis result figure of the pcr amplification product of Lgr5 gene fragment; M:DNA Marker DL2000,1:Lgr5 B (1727 bp) in figure.
Fig. 4 is the electrophoresis result figure of the over-lap PCR amplified production of Lgr5 gene fragment; M:DNA Marker DL2000,1:Lgr5 ORF (2740 bp) in figure.
Fig. 5 is the electrophoresis result figure of homologous primer pcr amplification product described in comparative example 1; M:DNA Marker DL2000 in figure, 1:Lgr5-a and Lgr5-X primer extension product, 2:Lgr5-b and Lgr5-X primer extension product.
Fig. 6 is Lgr5 albumen relative expression abundance (n=3) before and after transfection; Wherein, 1,2,3:Lgr5 process LAN group, 4,5,6: control group (wild-type IPEC-1 cell).
Fig. 7 is the impact (n=6) of control group and Lgr5 process LAN group on cell proliferation ability.
Fig. 8 is the comparison (100 ×, n=3) of control group and Lgr5 process LAN group on cell migration ability; Control group and Lgr5 process LAN group cell scratch test, wherein, A: cellular control unit, 0 h shooting; B:Lgr5 process LAN group cell, 0 h shooting; C: cellular control unit, 6 h shootings; D:Lgr5 process LAN group cell, 6 h shootings; E: cellular control unit, 12 h shootings; F:Lgr5 process LAN group cell, 12 h shootings; G: cellular control unit, 24 h shootings; H:Lgr5 process LAN group cell, 24 h shootings.
The electrophoresis result figure that Fig. 9 is RT22 primer qualification pig duodenum, whether jejunum, ileum express the pcr amplification product of Lgr5; M:DNA Marker DL2000 in figure, 1: ileum, 2: jejunum, 3: duodenum.
Figure 10 is the electrophoresis result figure whether RT22 primer qualification IPEC-J2 clone expresses the pcr amplification product of Lgr5; M:DNA Marker DL2000 in figure, 1:IPEC-J2 cell.
Figure 11 is the sequencer map of RT22 primer.
Figure 12 is the sequencer map of RT22 primer.
Embodiment
Further illustrate content of the present invention below in conjunction with Figure of description and specific embodiment, but should not be construed as limitation of the present invention.Without departing from the spirit and substance of the case in the present invention, the simple modification do the inventive method, step or condition or replacement, all belong to scope of the present invention; If do not specialize, the conventional means that technique means used in embodiment is well known to those skilled in the art.
embodiment
1 Lgr5 cDNA
the synthesis of sequence
1, design of primers
According to people Lgr5 gene order (number of logging in is NM_003667.3) and mouse Lgr5 gene order (accession number is NM_010195.2) homology, use Primer Premier 5 software design 3'RACE primer as shown in table 1.
Table 1 3'RACE Primer and sequence
| Primer | Sequence (5'-3') |
| 3'RACE CDS Primer A | AAGCAGTGGTATCAACGCAGAGTAC(T) 30 N -1N |
| UPM | CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT |
| NUP | AAGCAGTGGTATCAACGCAGAGT |
| 3'RACE GSP | CCCTTTGCTTCCTGGTGATG |
| 3'RACE NGSP | GGCTTTCTTGTCCTTCTCCTCTT |
2, landrace total serum IgE is extracted
Gather landrace small intestine, adopt TRIZOL test kit (BS409, Canada Bio Basic Inc.) to extract total serum IgE, method is carried out according to test kit specification sheets.
3, the synthesis of RACE cDNA first chain
(1) reaction system is as follows:
Table 2 3'RACE reverse transcription system
| Composition | Add-on |
| Chitterlings RNA(0.5 μ g/ μ L) | 4 μL |
| 3'RACE CDS Primer A（10 μmol/L） | 2 μL |
| DEPC water | 4 μL |
(2) by centrifugal for reaction system mixing described in table 2, in PCR instrument, 70 DEG C of heating 5 min, are placed on cooled on ice 5 min immediately; Following material is added: 5 × Buffer 4 μ L in above-mentioned reaction system, dNTP Mix(10 mM) 2 μ L, Rnasin inhibitor(40 U/ μ L) 0.5 μ L, MMLV(200 U/ μ L) 1 μ L and DEPC water 2.5 μ L, then mixed centrifugal, 42 DEG C of reactions 1.5 h, 70 DEG C of deactivation 7 min in PCR instrument; Add 60 μ L DEPC water dilution reverse transcription sample after reacted, be distributed into 4 pipes (20 μ L/pipe) ,-20 DEG C of preservations.
4、3'RACE
(1) first round PCR
Add each composition by the reaction system of table 3, mix centrifugal after carry out following PCR response procedures: 94 DEG C, 5 min; (94 DEG C of 30 s, 72 DEG C of 30 s, 72 DEG C of 1 min) × 5 cycles; (94 DEG C of 30 s, 70 DEG C of 30 s, 72 DEG C of 1 min) × 5 cycles; (94 DEG C of 30 s, 68 DEG C of 30 s, 72 DEG C of 1 min) × 25 cycles; 72 DEG C of 10 min; Preserve at 4 DEG C.
Table 3 3'RACE first round PCR system
| Composition | Add-on |
| 3'RACE cDNA first chain | 1μL |
| UPM（10μmol/L） | 1μL |
| 3'RACE GSP（10μmol/L） | 1μL |
| Premix Taq ( Ex TaqVersion 2.0 plus dye) | 10μL |
| DEPC water | 7μL |
(2) second take turns PCR
After first round PCR, get centrifuge tube PCR primer 5 μ L, add 45 μ L DEPC water dilutions, as the template of second time PCR.In centrifuge tube, add each composition by the reaction system of table 4, mix centrifugal laggard performing PCR response procedures: 94 DEG C of 5 min; (94 DEG C of 30 s, 70 DEG C of 30 s, 72 DEG C of 45 s) × 5 cycles; (94 DEG C of 30 s, 67 DEG C of 30 s, 72 DEG C of 45 s) × 5 cycles; (94 DEG C of 30 s, 64 DEG C of 30 s, 72 DEG C of 45 s) × 25 cycles; 72 DEG C of 10 min; Preserve at 4 DEG C.
Table 4 3'RACE second takes turns PCR system
| Composition | Add-on |
| First round PCR primer dilutes the template of 10 times | 1μL |
| 3'RACE NGSP（10μmol/L） | 1μL |
| NUP | 1μL |
| Premix Taq ( Ex TaqVersion 2.0 plus dye) | 10μL |
| DEPC water | 7μL |
(3) recovery of 3'RACE product, conversion, order-checking
Prepare 1.5% sepharose, after point sample, 130 V voltages carry out agarose electrophoresis 30 min, and electrophoresis terminates rear gel imaging system and takes pictures.Cut the sepharose with object fragment, reclaim test kit (TIANgel Midi Purification Kit) with sepharose DNA and reclaim object fragment, method is carried out according to test kit specification sheets.
(4) ligation
Add the target DNA fragment after purifying 4 μ L, pMD18-T carrier 1 μ L, Solution I 5 μ L, 16 DEG C of connections are spent the night.
(5) product conversion DH5 α competence intestinal bacteria are connected
Getting connection product 10 μ L joins in 100 μ L competence DH5 α, and ice bath 30 min after mixing gently, 42 DEG C of heat-shocked 90 s, place 5 min on ice, add the LB substratum of the antibiotic-free of 400 μ L, 37 DEG C, 250 r/min jolting 1 h.Get 200 μ L bacterium liquid sterile glass spreaders and coat LB planar surface, 37 DEG C just putting 20 min after be inverted cultivation 12 h.
(6) check order
Select positive bacterium colony and deliver to Shenzhen Huada Genetic Technology Co., Ltd's order-checking.
5, pcr amplification pig Lgr5 gene cDNA sequence
The 3'RACE cDNA obtained with embodiment 1 is for template, according to people Lgr5 gene order (number of logging in is NM_003667.3) and mouse Lgr5 gene order (accession number is NM_010195.2), design Lgr5 A primer (as table 5), adds each composition according to the reaction system of table 6.
Table 5 homology clone primer
Table 6 PCR reaction system
| Composition | Add-on |
| 3'RACE cDNA | 1.0 μL |
| Lgr5A F Primer（10μmol/L） | 1.0 μL |
| Lgr5A R Primer（10μmol/L） | 1.0 μL |
| LA enzyme (5 U/ μ L) | 0.2 μL |
| dNTP | 3.2 μL |
| 10×LA Buffer Ⅱ | 2.0 μL |
| DEPC water | 11.6 μL |
Response procedures: 98 DEG C of 1 min; (98 DEG C of 10 s, 67.5 DEG C of 30 s, 72 DEG C of 3 min) × 35 cycles; 72 DEG C of 10 min.Reacted rear preparation 1.5% sepharose, after point sample, 130 V voltages carry out agarose gel electrophoresis, electrophoresis 30 min, and electrophoresis terminates rear gel imaging system and takes pictures.Then carry out the recovery of object fragment, connection, conversion, order-checking, method is the same.
Order-checking obtains Lgr5A fragment sequence, and size is 1143bp, this fragment sequence basis is designed Lgr5B primer (as table 5), adds each composition according to the reaction system of table 7.
Table 7 PCR reaction system
| Composition | Add-on |
| 3'RACE cDNA | 1.0 μL |
| Lgr5B F Primer（10μmol/L） | 1.0 μL |
| Lgr5B R Primer（10μmol/L） | 1.0 μL |
| LA enzyme (5 U/ μ L) | 0.2 μL |
| dNTP | 3.2 μL |
| 10×LA Buffer Ⅱ | 2.0 μL |
| DEPC water | 11.6 μL |
Response procedures: 98 DEG C of 1 min; (98 DEG C of 10 s, 66.5 DEG C of 30 s, 72 DEG C of 3 min) × 35 cycles; 72 DEG C of 10 min.
Prepare 1.5% sepharose, after point sample, 130 V voltages carry out agarose gel electrophoresis, electrophoresis 30 min, and electrophoresis terminates rear gel imaging system and takes pictures.Then carry out the recovery of object fragment, connection, conversion, order-checking, method is the same.The Lgr5B fragment sequence obtained after order-checking, size is 1727bp.The sequence of all fragments splices a Lgr5 cDNA sequence as SEQ ID NO:1 by DNAMAN8 software.
embodiment
2
overlapping
pCR
method amplification pig
lgr5
gene
oRF
According to the Lgr5 cDNA sequence that embodiment 1 obtains, at Lgr5 ORF two ends design pair of primers (as table 8), upstream primer is with BamH I restriction enzyme site, and downstream primer is with Xba I restriction enzyme site.
Table 8 ORF primer
| Primer | Sequence (5'-3') |
| Lgr5 ORF | F: CGGGATCCATGGACACCTCCTCGG |
| R: GCTCTAGATTAGAGACATGGGACAAATGCCACGGA |
Each composition is added, response procedures: 98 DEG C of 1 min according to the reaction system of table 9; (98 DEG C of 10 s, 63 DEG C of 30 s, 72 DEG C of 3 min) × 35 cycles; 72 DEG C of 10 min.
Table 9 PCR reaction system
| Composition | Add-on |
| Lgr5 A fragment | 1.0μL |
| Lgr5 B fragment | 1.0μL |
| Lgr5 ORF F Primer（10μmol/L） | 1.0μL |
| Lgr5 ORF R Primer（10μmol/L） | 1.0μL |
| LA enzyme (5 U/ μ L) | 0.2μL |
| dNTP | 3.2μL |
| 10×LA Buffer Ⅱ | 2.0μL |
| DEPC water | 11.6μL |
Prepare 1.5% sepharose, after point sample, 130 V voltages carry out agarose gel electrophoresis, electrophoresis 30 min, and electrophoresis terminates rear gel imaging system and takes pictures.Then carry out the recovery of object fragment, connection, conversion, order-checking, method is the same, and final acquisition Lgr5 ORF, the aminoacid sequence of the albumen of ORF coding is as shown in such as SEQ ID NO:2.
comparative example
1
according to the sequence of people Lgr5 gene and mouse Lgr5 gene, design homologous primer, primer sequence is as follows:
Table 10 homology primer
| Primer | Sequence (5'-3') |
| Lgr5-a | GCGGAGATGCTGCTGC |
| Lgr5-b | GAGCGTGCGAGCGGAG |
| Lgr5-X | ACGGGCAAGGACAGGAG |
Table 11 PCR reaction system
| Composition | Add-on |
| Pig cDNA | 1.0 μL |
| Lgr5-a/ Lgr5-b Primer（10 μmol/L） | 1.0 μL |
| Lgr5-X Primer（10 μmol/L） | 1.0 μL |
| RTaq enzyme | 10.0 μL |
| DEPC water | 7.0 μL |
Each composition is added according to the reaction system of table 11; Response procedures: 94 DEG C of 5 min; (94 DEG C of 30 s, 61 DEG C of 30 s, 72 DEG C of 20 s) × 35 cycles; 72 DEG C of 10 min.Reacted rear preparation 1.5% sepharose, after point sample, 130 V voltages carry out agarose gel electrophoresis, electrophoresis 30 min, and electrophoresis terminates rear gel imaging system and takes pictures, and result is as Fig. 5.
embodiment
3 Lgr5
the functional verification of gene
1, the structure of Lgr5 over-express vector
Lgr5-pMD-18T plasmid is extracted with sky root plasmid purification kit.BamH I, Xba I enzyme 37 DEG C of enzymes cut pcDNA3.1
+spend the night with Lgr5-pMD-18T plasmid.Reclaim pcDNA3.1
+with Lgr5 gene fragment, with E.coli DNA ligase by pcDNA3.1
+with the connection of Lgr5 gene fragment, 16 DEG C of connections are spent the night
Above-mentioned connection product Lgr5-pcDNA3.1
+conversion, amplification and plasmid extraction the same, the recombinant plasmid enzyme of extraction cuts the qualification person of being positive, and delivers to Guangzhou Ai Ji biotech firm and checks order.Positive bacteria liquid Tian Gen company extracts plasmid without the large extraction reagent kit of intracellular toxin plasmid, and after surveying concentration ,-20 DEG C save backup.
What 2, obtain process LAN Lgr5 surely turns IPEC-1 cell strain
According to Lipofectamin
the operation steps of 3000 test kit specification sheetss, uses Lipofectamin
3000 by Lgr5-pcDNA3.1
+plasmid transfection enters IPEC-1 clone.Then stable cell strain is obtained with G418 screening.The stable cell strain obtained with the qualification of the method for Western Blotting whether process LAN Lgr5 albumen.Result such as Fig. 6 shows, and what show to obtain process LAN Lgr5 surely turns IPEC-1 cell strain.
3, the function that plays after process LAN in cell of Lgr5
Detect Lgr5 by MTT method and whether have the function promoting cell proliferation.Working method is as follows:
1. the 2 groups of cells (process LAN group, control group) being in growth logarithmic phase are got, with every hole 4 × 10
3the density of individual cell is inoculated in 96 orifice plates.Every hole 200 μ L, inoculates 20 holes, inoculates 5 blocks of plates altogether.Simultaneously every block plate inoculates the not celliferous complete culture solution in 10 holes as blank, insert 37 DEG C, saturated humidity, 5% CO
2incubator in cultivate, change liquid every other day.
2. respectively at 24 h, 48 h, 72 h, 96 h and 120 h after inoculation, get one piece of 96 orifice plate, every hole adds 20 μ L MTT working fluids, puts in incubator and continues to hatch 4 h.
3. stop cultivating, carefully blot the nutrient solution in hole, every hole adds 150 μ L DMSO, after the crystallization of MTT formation is fully dissolved, shaking table shakes 30 min, makes it fully mix.
4. select 490 nm wavelength, microplate reader measures each hole absorbance value, i.e. A
490the OD value at place is finally transverse axis with time, and OD value is longitudinal axis drafting cell growth curve.
Result is as shown in Figure 7: compared with control group, Lgr5 process LAN IPEC-1 cell multiplication capacity after 48 h significantly strengthens (
p<0.05).Illustrate that Lgr5 has the function promoting cell proliferation.
4, detect Lgr5 by cell cut method and whether have the ability promoting cell migration, working method is as follows:
1. first compare ruler with marker pen and evenly draw 5 horizontal lines behind at 6 orifice plates, the spacing of adjacent two horizontal lines is 0.5 ~ 1cm.
2. with every hole 8 × 10
5the density of individual cell is inoculated in 6 orifice plates, within second day, compares ruler with 200 μ L rifle heads, hangs down as horizontal line cut behind as far as possible, and rifle head wants vertical, can not tilt.
3. wash cell 3 times with PBS, wash away the cell under drawing, every hole adds containing 1% serum perfect medium 2 mL.
4. insert 37 DEG C, saturated humidity, 5% CO
2incubator in cultivate.By 0,6,12, within 24 hours, take pictures.
Result is as shown in Figure 8: Lgr5 process LAN group cell is stronger than control group cell migration ability, illustrates when cell injury, and Lgr5 has the function accelerated cell injury and repair.
embodiment
4
for detecting
lgr5
gene
primer
According to the pig Lgr5 gene design pair of primers RT22 cloned, primer is as following table:
Table 12 PCR reaction system
| Composition | Add-on |
| The cDNA of duodenum/jejunum/ileum/IPEC-J2 cell | 1.0 μL |
| RT22 F Primer（10 μmol/L） | 1.0 μL |
| RT22 R Primer（10 μmol/L） | 1.0 μL |
| RTaq enzyme | 10.0 μL |
| DEPC water | 7.0 μL |
Extract the cDNA of duodenum, jejunum, ileum, IPEC-J2 cell respectively, utilize RT22 to increase to it, reaction system is as table 12; Response procedures: 94 DEG C of 5 min; (94 DEG C of 30 s, 63 DEG C of 30 s, 72 DEG C of 20 s) × 35 cycles; 72 DEG C of 10 min.
Prepare 1.5% sepharose, after point sample, 130 V voltages carry out agarose gel electrophoresis, electrophoresis 30 min, and electrophoresis terminates rear gel imaging system and takes pictures.Then the recovery of object fragment, connection, conversion, order-checking is carried out.
With DNAman software sequencing result and the Lgr5 comparison of cloning, find one section of overlapping fragments (as shown in SEQ ID NO:19), illustrate that this primer can be used for identifying and whether contain Lgr5 gene on porcine tissue or in clone.
SEQUENCE LISTING
<110> Agricultural University Of South China
<120> mono-boar Lgr5 gene and application thereof
<130>
<160> 19
<170> PatentIn version 3.3
<210> 1
<211> 2832
<212> DNA
The cDNA sequence of <213> pig Lgr5 gene
<400> 1
atggacacct cctcggttgg cgtgctcctg tccttgcccg tcctgttcca gctggcggcc 60
ggagtcggct cgccaaggcc cagcgcgctg ctgcgggggt gccccgcgca ctgtcagtgc 120
gagccggacg gcaggatgct gctcagggtg gactgctctg acctggggct ttcggagctg 180
ccctccaacc tcagcgtttt cacctcctac ctggacctca gtatgaacaa catcagtcag 240
ctgcccccga accctctgca cagtctccgc ttcctagagg agttacgtct tgccggaaac 300
gctttgacat acattcccaa gggagcattt gccggccttt acagtctcaa agttcttatg 360
ctgcagaata atcacctaag acaggtaccc acagaagcgc tgcagaattt gcgaagcctt 420
cagtcgctgc gcctggatgc caaccacatc agctacgtcc cccccagctg tttcagtggc 480
ctgcattccc tgaggcacct gtggctggat gacaacgctt tgacagaaat ccctgtccag 540
gctttcagaa gtttatcagc gctgcaggcc atgaccttgg ccctgaacaa aatacaccac 600
ataccagact atgcctttgg aaacctgtcc agcttggtag ttctgcatct ccataacaat 660
agaatccact ccctgggaaa gaaatgcttt gatgggctcc acagcctaga gactttagat 720
ttaaattata ataatcttga tgaattcccc actgcaatca ggacactctc caaccttaaa 780
gaactaggat ttcatagcaa caatatcaag tccattcctg agaaagcctt tgtaggcaac 840
ccttctctta ttaccataca tttctatgac aaccccatcc agctggttgg gagatctgct 900
tttcaacatt tacctgaact aagaacactg actttgaatg gtgcctcaca aataactgaa 960
tttcctgatt tgactggaac agcgagcctg gagagtctga ctttaactgg cgcacagatc 1020
tcatctcttc cccaaaccgt ctgtgatcag ttacctaatc tccaagtgct agatttatct 1080
tacaacttgc tagaagattt acccagtttt tcagtctgcc aaaagcttca gaaaatagac 1140
ctacgacata atgaaatctg tgaaattcaa gcggacactt tccagcagtt gctcggcctc 1200
cgatctctga atttagcttg gaacaaaatt gccactattc accccaatgc attttccacc 1260
ttgccatctc taagaaagct ggacctatcg tccaaccgcc tgtcgtcctt tcctgtaact 1320
gggttacatg gtttaactca cttaaaatta acaggaaatc atgccttaca gagcttgata 1380
tcatctgaaa actttccaga actcaaggtt atagaaatgc cttatgcata ccagtgctgt 1440
gtatttggag tgtgtgaaaa tgtctataaa atttctaatc agtggaataa agctgacaac 1500
aacagtgcag atgaccttca taaaaaagat gccggaatgt ttcaagttca agatgagcgt 1560
gatcttgaag atttcttgct tgactttgag gaagacctga aagccctaca ttccgtgcag 1620
tgtacacctt ccccaggccc cttcaaactt tgcgaatacc tgttaggtag ctggctgatc 1680
cgaattggag tgtggaccat agcagttttg gcacttactt gtaacacctt ggtgacctcc 1740
acagtgttca gagcccctct gtacatttcc tccataaaac tgttaatcgg gttgatagcg 1800
gcggccaaca cgctcatggg ggtttccagt gcggtgctgg ctgccgtgga tgcctttact 1860
tttggcagct ttgcgcggca cggagcgtgg tgggagcagg gggtcggttg ccaaatcgtt 1920
gggtttttgt ccatttttgc ctcggaatcc tccgttttcc tgcttactct ggcagccctg 1980
gagcgagggt tctctgtgaa atgctctgcg aaattcgaaa tgaaaactcc ctcctccagc 2040
ctgaaagcag cccttgtcct ctgcgccctg ctggccctga ccatcgcggc ggttcccctg 2100
ctgggcggta gcgagtacag cgcctccccg ctctgcctgc cgctgccctt tggggagccc 2160
agcgccatgg gctacgtggt ggccctcgtc ttgctcaatt ccctttgctt cctggtgatg 2220
accatcgcct acaccaagct ctactgcagt ttggaaaagg gagacctgga gaacatcttg 2280
gactgttcta tggtgaagca cattgctctg ttgctcttca ccaactgtat cctttactgc 2340
ccagtggctt tcttgtcctt ctcctcttta ctgaacctca cattcatcag ccctgaagta 2400
attaagttta tccttctggt gattgtcccg cttcctgcat gtctcaatcc ccttctctac 2460
atcctcttca atcctcactt taaggaggat ctggggagcc tgggaaagca aacccccttc 2520
tggacaagat ccaaacacac aagcctgatg tctattaact cggatgatgt tgagaaacag 2580
tcctgtgact ccacccaagc cttggtaccc ttcaccggtg ccagcatagc ctacgacctg 2640
ccttccaatt ccgggtcacc ggcagcttat ccaatgaccg aaagctgtca tctctcttcc 2700
gtggcatttg tcccatgtct ctaattaaca tgtgagagaa taaggtttcc aaaattgaaa 2760
acccaaaaat gtgagattga gtacatcaga gtagtaacta aaaaaaaaaa aaaaaaaaaa 2820
aaaaaaaaaa aa 2832
<210> 2
<211> 907
<212> PRT
The aminoacid sequence of <213> pig Lgr5 gene
<400> 2
Met Asp Thr Ser Ser Val Gly Val Leu Leu Ser Leu Pro Val Leu Phe
1 5 10 15
Gln Leu Ala Ala Gly Val Gly Ser Pro Arg Pro Ser Ala Leu Leu Arg
20 25 30
Gly Cys Pro Ala His Cys Gln Cys Glu Pro Asp Gly Arg Met Leu Leu
35 40 45
Arg Val Asp Cys Ser Asp Leu Gly Leu Ser Glu Leu Pro Ser Asn Leu
50 55 60
Ser Val Phe Thr Ser Tyr Leu Asp Leu Ser Met Asn Asn Ile Ser Gln
65 70 75 80
Leu Pro Pro Asn Pro Leu His Ser Leu Arg Phe Leu Glu Glu Leu Arg
85 90 95
Leu Ala Gly Asn Ala Leu Thr Tyr Ile Pro Lys Gly Ala Phe Ala Gly
100 105 110
Leu Tyr Ser Leu Lys Val Leu Met Leu Gln Asn Asn His Leu Arg Gln
115 120 125
Val Pro Thr Glu Ala Leu Gln Asn Leu Arg Ser Leu Gln Ser Leu Arg
130 135 140
Leu Asp Ala Asn His Ile Ser Tyr Val Pro Pro Ser Cys Phe Ser Gly
145 150 155 160
Leu His Ser Leu Arg His Leu Trp Leu Asp Asp Asn Ala Leu Thr Glu
165 170 175
Ile Pro Val Gln Ala Phe Arg Ser Leu Ser Ala Leu Gln Ala Met Thr
180 185 190
Leu Ala Leu Asn Lys Ile His His Ile Pro Asp Tyr Ala Phe Gly Asn
195 200 205
Leu Ser Ser Leu Val Val Leu His Leu His Asn Asn Arg Ile His Ser
210 215 220
Leu Gly Lys Lys Cys Phe Asp Gly Leu His Ser Leu Glu Thr Leu Asp
225 230 235 240
Leu Asn Tyr Asn Asn Leu Asp Glu Phe Pro Thr Ala Ile Arg Thr Leu
245 250 255
Ser Asn Leu Lys Glu Leu Gly Phe His Ser Asn Asn Ile Lys Ser Ile
260 265 270
Pro Glu Lys Ala Phe Val Gly Asn Pro Ser Leu Ile Thr Ile His Phe
275 280 285
Tyr Asp Asn Pro Ile Gln Leu Val Gly Arg Ser Ala Phe Gln His Leu
290 295 300
Pro Glu Leu Arg Thr Leu Thr Leu Asn Gly Ala Ser Gln Ile Thr Glu
305 310 315 320
Phe Pro Asp Leu Thr Gly Thr Ala Ser Leu Glu Ser Leu Thr Leu Thr
325 330 335
Gly Ala Gln Ile Ser Ser Leu Pro Gln Thr Val Cys Asp Gln Leu Pro
340 345 350
Asn Leu Gln Val Leu Asp Leu Ser Tyr Asn Leu Leu Glu Asp Leu Pro
355 360 365
Ser Phe Ser Val Cys Gln Lys Leu Gln Lys Ile Asp Leu Arg His Asn
370 375 380
Glu Ile Cys Glu Ile Gln Ala Asp Thr Phe Gln Gln Leu Leu Gly Leu
385 390 395 400
Arg Ser Leu Asn Leu Ala Trp Asn Lys Ile Ala Thr Ile His Pro Asn
405 410 415
Ala Phe Ser Thr Leu Pro Ser Leu Arg Lys Leu Asp Leu Ser Ser Asn
420 425 430
Arg Leu Ser Ser Phe Pro Val Thr Gly Leu His Gly Leu Thr His Leu
435 440 445
Lys Leu Thr Gly Asn His Ala Leu Gln Ser Leu Ile Ser Ser Glu Asn
450 455 460
Phe Pro Glu Leu Lys Val Ile Glu Met Pro Tyr Ala Tyr Gln Cys Cys
465 470 475 480
Val Phe Gly Val Cys Glu Asn Val Tyr Lys Ile Ser Asn Gln Trp Asn
485 490 495
Lys Ala Asp Asn Asn Ser Ala Asp Asp Leu His Lys Lys Asp Ala Gly
500 505 510
Met Phe Gln Val Gln Asp Glu Arg Asp Leu Glu Asp Phe Leu Leu Asp
515 520 525
Phe Glu Glu Asp Leu Lys Ala Leu His Ser Val Gln Cys Thr Pro Ser
530 535 540
Pro Gly Pro Phe Lys Leu Cys Glu Tyr Leu Leu Gly Ser Trp Leu Ile
545 550 555 560
Arg Ile Gly Val Trp Thr Ile Ala Val Leu Ala Leu Thr Cys Asn Thr
565 570 575
Leu Val Thr Ser Thr Val Phe Arg Ala Pro Leu Tyr Ile Ser Ser Ile
580 585 590
Lys Leu Leu Ile Gly Leu Ile Ala Ala Ala Asn Thr Leu Met Gly Val
595 600 605
Ser Ser Ala Val Leu Ala Ala Val Asp Ala Phe Thr Phe Gly Ser Phe
610 615 620
Ala Arg His Gly Ala Trp Trp Glu Gln Gly Val Gly Cys Gln Ile Val
625 630 635 640
Gly Phe Leu Ser Ile Phe Ala Ser Glu Ser Ser Val Phe Leu Leu Thr
645 650 655
Leu Ala Ala Leu Glu Arg Gly Phe Ser Val Lys Cys Ser Ala Lys Phe
660 665 670
Glu Met Lys Thr Pro Ser Ser Ser Leu Lys Ala Ala Leu Val Leu Cys
675 680 685
Ala Leu Leu Ala Leu Thr Ile Ala Ala Val Pro Leu Leu Gly Gly Ser
690 695 700
Glu Tyr Ser Ala Ser Pro Leu Cys Leu Pro Leu Pro Phe Gly Glu Pro
705 710 715 720
Ser Ala Met Gly Tyr Val Val Ala Leu Val Leu Leu Asn Ser Leu Cys
725 730 735
Phe Leu Val Met Thr Ile Ala Tyr Thr Lys Leu Tyr Cys Ser Leu Glu
740 745 750
Lys Gly Asp Leu Glu Asn Ile Leu Asp Cys Ser Met Val Lys His Ile
755 760 765
Ala Leu Leu Leu Phe Thr Asn Cys Ile Leu Tyr Cys Pro Val Ala Phe
770 775 780
Leu Ser Phe Ser Ser Leu Leu Asn Leu Thr Phe Ile Ser Pro Glu Val
785 790 795 800
Ile Lys Phe Ile Leu Leu Val Ile Val Pro Leu Pro Ala Cys Leu Asn
805 810 815
Pro Leu Leu Tyr Ile Leu Phe Asn Pro His Phe Lys Glu Asp Leu Gly
820 825 830
Ser Leu Gly Lys Gln Thr Pro Phe Trp Thr Arg Ser Lys His Thr Ser
835 840 845
Leu Met Ser Ile Asn Ser Asp Asp Val Glu Lys Gln Ser Cys Asp Ser
850 855 860
Thr Gln Ala Leu Val Pro Phe Thr Gly Ala Ser Ile Ala Tyr Asp Leu
865 870 875 880
Pro Ser Asn Ser Gly Ser Pro Ala Ala Tyr Pro Met Thr Glu Ser Cys
885 890 895
His Leu Ser Ser Val Ala Phe Val Pro Cys Leu
900 905
<210> 3
<211> 28
<212> DNA
<213> 3'RACE CDS Primer A
<220>
<221> misc_feature
<222> (27)..(28)
<223> n is a, c, g, or t
<400> 3
aagcagtggt atcaacgcag agtactnn 28
<210> 4
<211> 45
<212> DNA
<213> Long UPM
<400> 4
ctaatacgac tcactatagg gcaagcagtg gtatcaacgc agagt 45
<210> 5
<211> 23
<212> DNA
<213> NUP
<400> 5
aagcagtggt atcaacgcag agt 23
<210> 6
<211> 20
<212> DNA
<213> 3'RACE GSP
<400> 6
ccctttgctt cctggtgatg 20
<210> 7
<211> 23
<212> DNA
<213> 3'RACE NGSP
<400> 7
ggctttcttg tccttctcct ctt 23
<210> 8
<211> 30
<212> DNA
<213> Lgr5A-F
<400> 8
tgacgacgag gaagacctga aagccctaca 30
<210> 9
<211> 33
<212> DNA
<213> Lgr5A-R
<400> 9
ttagagacat gggacaaatg ccacggaaga gag 33
<210> 10
<211> 27
<212> DNA
<213> Lgr5B-F
<400> 10
atggacacct cctcggttgg cgtgctc 27
<210> 11
<211> 30
<212> DNA
<213> Lgr5B-R
<400> 11
gtgccgcaag taagtgccaa aactgctatg 30
<210> 12
<211> 24
<212> DNA
<213> ORF-F
<400> 12
cgggatccat ggacacctcc tcgg 24
<210> 13
<211> 35
<212> DNA
<213> ORF-R
<400> 13
gctctagatt agagacatgg gacaaatgcc acgga 35
<210> 14
<211> 18
<212> DNA
<213> RT-F
<400> 14
gctggctgcc gtggatgc 18
<210> 15
<211> 20
<212> DNA
<213> RT-R
<400> 15
agcagggcgc agaggacaag 20
<210> 16
<211> 16
<212> DNA
<213> Lgr5-a
<400> 16
gcggagatgc tgctgc 16
<210> 17
<211> 16
<212> DNA
<213> Lgr5-b
<400> 17
gagcgtgcga gcggag 16
<210> 18
<211> 17
<212> DNA
<213> Lgr5-X
<400> 18
acgggcaagg acaggag 17
<210> 19
<211> 237
<212> DNA
<213> overlapping fragments
<400> 19
gctggctgcc gtggatgcct ttacttttgg cagctttgcg cggcacggag cgtggtggga 60
gcagggggtc ggttgccaaa tcgttgggtt tttgtccatt tttgcctcgg aatcctccgt 120
tttcctgctt actctggcag ccctggagcg agggttctct gtgaaatgct ctgcgaaatt 180
cgaaatgaaa actccctcct ccagcctgaa agcagccctt gtcctctgcg ccctgct 237
Claims (10)
1. a boar Lgr5 gene, is characterized in that, gene order is as shown in SEQ ID NO:1.
2. the albumen of coding pig Lgr5 gene, it is characterized in that, its aminoacid sequence is as shown in SEQ ID NO:2.
3. for the primer of the gene described in claim 1 that increases, it is characterized in that, described primer sequence is as shown in SEQ ID NO:3 ~ 13.
4. require a primer for pig Lgr5 gene described in 1 for test right, it is characterized in that, primer sequence is as shown in SEQ ID NO:14 ~ 15.
5. the carrier containing gene described in claim 1.
6. the recombinant chou containing carrier described in claim 5.
7. albumen described in gene described in claim 1 or claim 2 promotes the application in the preparation of cell proliferation in preparation.
8. albumen described in gene described in claim 1 or claim 2 accelerates the application in the preparation that cell injury repairs in preparation.
9. application according to claim 7, is characterized in that, described cell is chitterlings epithelial cell.
10. application according to claim 8, is characterized in that, described cell is chitterlings epithelial cell.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510082658.6A CN104818281B (en) | 2015-02-16 | 2015-02-16 | One boar Lgr5 genes and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510082658.6A CN104818281B (en) | 2015-02-16 | 2015-02-16 | One boar Lgr5 genes and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104818281A true CN104818281A (en) | 2015-08-05 |
| CN104818281B CN104818281B (en) | 2018-08-07 |
Family
ID=53728761
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510082658.6A Active CN104818281B (en) | 2015-02-16 | 2015-02-16 | One boar Lgr5 genes and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104818281B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111394370A (en) * | 2020-03-03 | 2020-07-10 | 华南农业大学 | Pig RagA gene and application thereof |
| CN112175923A (en) * | 2020-09-30 | 2021-01-05 | 东南大学 | Biological factor and application thereof in promoting inner ear hair cell regeneration |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1850269A (en) * | 2005-04-22 | 2006-10-25 | 中国科学院上海生命科学研究院 | Function of GPR39 gene for central nervous system of mammal and its use |
-
2015
- 2015-02-16 CN CN201510082658.6A patent/CN104818281B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1850269A (en) * | 2005-04-22 | 2006-10-25 | 中国科学院上海生命科学研究院 | Function of GPR39 gene for central nervous system of mammal and its use |
Non-Patent Citations (8)
| Title |
|---|
| LIU,Z. 等: "Homo sapiens leucine-rich repeat containing G protein-coupled receptor variant 1, mRNA", 《GENBANK DATABASE》 * |
| MARC VAN DE WETERING 等: "The Catenin/TCF-4 Complex Imposes a Crypt Progenitor Phenotype on Colorectal Cancer Cells", 《CELL》 * |
| MARIE ISABELLE GARCIA 等: "LGR5 deficiency deregulates Wnt signaling and leads to precocious Paneth cell differentiation in the fetal intestine", 《DEVELOPMENTAL BIOLOGY》 * |
| SUNG-HEE KIM 等: "Induction of LGR5 by H2O2 treatment is associated with cell proliferation via the JNK signaling pathway in colon cancer cells", 《INTERNATIONAL JOURNAL OF ONCOLOGY》 * |
| 丁建华: "猪GPR6基因的克隆与表达分析", 《中国优秀硕士学位论文全文数据库（电子期刊）农业科技辑D0505-169》 * |
| 周国岭 等: "基因克隆技术", 《华中农业大学学报》 * |
| 戴梦源 等: "Lgr5在干细胞及肿瘤中的研究进展", 《医学综述》 * |
| 王秀玉: "Wnt1、β-catenin 及Lgr5在胃病变组织中的表达及其相关性研究", 《中国优秀硕士学位论文全文数据库（电子期刊）医药卫生科技辑E072-127》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111394370A (en) * | 2020-03-03 | 2020-07-10 | 华南农业大学 | Pig RagA gene and application thereof |
| CN111394370B (en) * | 2020-03-03 | 2022-03-25 | 华南农业大学 | Pig RagA gene and application thereof |
| CN112175923A (en) * | 2020-09-30 | 2021-01-05 | 东南大学 | Biological factor and application thereof in promoting inner ear hair cell regeneration |
| CN112175923B (en) * | 2020-09-30 | 2022-04-22 | 东南大学 | Biological factor and application thereof in promoting inner ear hair cell regeneration |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104818281B (en) | 2018-08-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110845622B (en) | Preparation of fusion protein with deletion of different structural domains and application of fusion protein in improvement of protein synthesis | |
| CN111719008B (en) | SNP coseparated with wheat powdery mildew disease-resistant gene Pm5e and application thereof | |
| CN105647937A (en) | In-vitro expression method and application of scallop byssus protein | |
| US20110088121A1 (en) | Genes for improving salt tolerance and drought tolerance of plant and the uses thereof | |
| CN113308453B (en) | Amidohydrolase SaAH, and coding gene and application thereof | |
| CN104818281A (en) | pig Lgr5 gene and applications thereof | |
| CN107574171B (en) | Corn salt-resistant major QTL and related gene, molecular marker and application thereof | |
| CN104212757A (en) | Method for high-efficiently producing L-theanine through production of coli [gamma]-glutamylmethylamine synthetase with escherichia coli | |
| CN109112227A (en) | Rape bloom key gene as the rape ecotype improvement and Mature breeding molecular labeling and application | |
| CN112538494A (en) | TMPRSS2 mutant protein, expression vector, expression engineering bacterium and preparation method thereof | |
| CN109988771B (en) | Corn salt-resistant QTL and application thereof | |
| CN102382840B (en) | Haliotis diversicolor calmodulin cDNA sequence | |
| CN102559708B (en) | EPSP synthase AroA-Ra multisite mutant of rahnella aquatilis | |
| CN103966231B (en) | Pig flesh characters is correlated with the molecular cloning of GLP2R gene fragment and application | |
| CN114807172B (en) | Salt response corn functional gene | |
| CN112481278B (en) | Biosensor based on AIP induction and application thereof | |
| CN112779262B (en) | Application of pig RagC gene | |
| CN104109669A (en) | SNP in promoter region of pig AMPD1 gene as genetic marker of pig carcass characteristics and applications thereof | |
| CN114717362A (en) | Method for detecting respiratory syncytial virus by using Cas13a protein and application thereof | |
| CN109517814B (en) | Mutant of organophosphorus degrading enzyme and application thereof | |
| CN110066817A (en) | Kelp α type carbonic anhydrase gene Sj α-CA2 and its coding albumen and application | |
| CN101058805B (en) | Method of producing mutation procarboxypeptidase B and mutation carboxypeptidase B | |
| CN101245345B (en) | Goat S6K1 gene cDNA encoding zone nucleotide sequence | |
| CN106434583B (en) | Glucose dehydrogenase and its encoding gene and application | |
| CN112646822B (en) | Cell nucleus proliferation antigen gene of binocyano-algae and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |