CN102851263B - High-throughout screening method of lipase gene mutation database and lipase mutation gene - Google Patents
High-throughout screening method of lipase gene mutation database and lipase mutation gene Download PDFInfo
- Publication number
- CN102851263B CN102851263B CN201110183303.8A CN201110183303A CN102851263B CN 102851263 B CN102851263 B CN 102851263B CN 201110183303 A CN201110183303 A CN 201110183303A CN 102851263 B CN102851263 B CN 102851263B
- Authority
- CN
- China
- Prior art keywords
- lipase
- indicator
- gene
- solution
- acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention relates to a high-throughout screening method of lipase gene mutation database, and lipase mutation gene and its encoding lipase obtained from the screening method. Comparing to the method in the prior art, the inventive method has higher sensitivity. The invented lipase has higher activity than wild type lipase. The invention also relates to a reaction system for screening lipase.
Description
Technical field
The invention belongs to bioengineering field.Specifically, the present invention relates to a kind of lipase gene mutation library high-throughput screening method and screen the new lipase mutator gene obtained thus.
Background technology
Lipase (E.C.3.1.1.3) is also known as acylglycerol lytic enzyme; it is the enzyme that a class has multiple catalytic capability; can catalysis triglyceride and some other water-insoluble ester class hydrolysis, the reverse reaction reaction of catalyzed transesterification, alcoholysis reaction, transesterification and ester class and the synthesis of bio-surfactant, the fractionation of catalysis optically active isomer and the synthesis etc. of chiral drug can also be used for.Lipase is used widely in many fields such as Foodgrain and oilseed production, foodstuffs industry, daily chemical industry, oil chemical industry, agrochemical industry, paper industry, detergent industry and pharmaceutical synthesis.In grease production and oil and fat chemical, lipase has huge applications potentiality.Utilize its specificity catalytic performance, change the position of fatty acid chain in glyceryl ester or replace one or more new lipid acid and modify ester, the glyceride stock of cheapness is processed into expensive structured lipid, as theobroma oil, OPO, single glycosides fat and glycosides two fat etc.
Improving the catalysis Rate activity of lipase, is one of effective approach reducing lipase production cost.The present invention is to have 1,3 narrow spectrum rhizomucor miehei lipases are research object, first fallibility PCR method (ep-PCR) is adopted, lipase mutation library is set up in intestinal bacteria, by new high-throughput screening method, mutation library is screened, obtains the RML mutant lipase of Rate activity raising and corresponding mutator gene.
Summary of the invention
The invention provides a kind of isolated polypeptide, described polypeptide is selected from:
(1) aminoacid sequence shown in SEQ ID NO:4,6,8,10 or 12; With
(2) in the aminoacid sequence described in (1), pass through replacement, lack or add one or several amino acid, but at least retain in aminoacid sequence numbering the 57th amino acids residue of SEQ ID NO:2 for Val, and there is the polypeptide derivative by (1) of lipase activity.
In one embodiment, in the aminoacid sequence of SEQ ID NO:2 numbering, the polypeptide described in above-mentioned (2) at least also retains one or more with the residue on upper/lower positions: the Ala of the 67th, the Thr of the 111st, the Ala of Pro and the 65th of the 168th.
The invention provides a kind of polynucleotide of separation, the polynucleotide of described separation are selected from:
(1) to encode the polynucleotide of polypeptide of the present invention; With
(2) polynucleotide of the polynucleotide complementation and described in (1).
In one embodiment, the polypeptide of this polynucleotide encoding as shown in SEQ ID NO:4,6,8,10 or 12.
In one embodiment, the nucleotide sequence of these polynucleotide is as shown in SEQ ID NO:3,5,7,9 or 11.
The invention provides a kind of carrier, it contains polynucleotide of the present invention.
The invention provides a kind of genetically engineered host cell, described host cell contains carrier of the present invention or polynucleotide.
The invention provides a kind of method of screening lipase, the described method substrate comprised using triglyceride level as lipase to be screened carries out enzymolysis and filters out the step of the lipase that Rate activity improves according to the colour-change that pH indicator produces.
In one embodiment, said method comprising the steps of:
(1) lipase to be screened is provided;
(2) solution containing pH indicator and low-grade alkyl carboxylic acid's salt is provided;
(3) triglyceride level is added in the solution of step (2), obtains mixed solution;
(4) lipase is added in the mixed solution of step (3) gained; With
(5) observe the change of mixed solution color, the colour-change produced according to pH indicator filters out the lipase that Rate activity improves.
In one embodiment, the triglyceride level of described triglyceride level to be fatty acid chain length be 12-22.
In one embodiment, described low-grade alkyl carboxylic acid's salt is the IIA race metal-salt of long 2-6 carbon atom alkyl carboxylic acid.
In one embodiment, described pH indicator is selected from dibromothymolsulfonphthalein, phenolsulfonphthalein, methylenum coeruleum, toluylene red, methyl red, tetrabromo-mcresolsulfonphthalein, tropeolin-D, tetrabromophenol sulfonphthalein, Congo red or its combination.
In one embodiment, described method also comprises and uses wild type lipase in contrast, by contrasting color that lipase to be screened produces and contrasting the dithering produced and go out the lipase that Rate activity improves.
In one embodiment, described method uses porous plate to screen.
In one embodiment, described method also comprises:
Set up lipase mutated library;
Express mutant lipase.
In one embodiment, described method also comprises: adopt alkali titration to screen the lipase obtained and carries out multiple sieve, filter out the lipase of Rate activity raising.
The invention provides a kind of reaction system for screening lipase, described reaction system contains:
(1) triglyceride level; With
(2) pH indicator.
In one embodiment, described reaction system is also containing low-grade alkyl carboxylic acid's salt.
In one embodiment, reaction system meter described in every 200 μ l, described reaction system contains the pH indicator solution of 15 ~ 25 μ l, the Tris buffered soln of 0.1 ~ 0.3M low-grade alkyl carboxylic acid salt of 50 ~ 70 μ l and 80 ~ 120 μ l triglyceride level solution, wherein, described pH indicator solution is that pH indicator is dissolved in Tris damping fluid with the concentration of 0.3 ~ 1.5mg/L, and to be triglyceride level be dissolved in the volume ratio of 1:4 ~ 6 solution that organic solvent obtains to described triglyceride level solution.
In one embodiment, the pH of described reaction system is in the scope of 4.0 ~ 9.0.In one embodiment, the pH of described reaction system is in the scope of 5.0 ~ 9.0.In other specific embodiment, the pH of described reaction system is in the scope of 4.0 ~ 7.0.In other specific embodiment, the pH of described reaction system is in the scope of 7.0 ~ 9.0.
In one embodiment, the triglyceride level of described triglyceride level to be fatty acid chain length be 12-22.
In one embodiment, described low-grade alkyl carboxylic acid's salt is the IIA race metal-salt of long 2-6 carbon atom alkyl carboxylic acid.
In one embodiment, described pH indicator is selected from dibromothymolsulfonphthalein, phenolsulfonphthalein, methylenum coeruleum, toluylene red, methyl red, tetrabromo-mcresolsulfonphthalein, tropeolin-D, tetrabromophenol sulfonphthalein, Congo red or its combination.
Accompanying drawing explanation
Fig. 1 shows screening method susceptibility the result.
Fig. 2 shows the result adopting the inventive method and currently known methods to screen catalytic activity of lipase.
Fig. 3 shows the PCR result of lipase gene.No. 1 swimming lane is the PCR fragment for being cloned into pET30a carrier, and No. 2 swimming lanes are the PCR fragment for being cloned into pET32a carrier, and No. 3 swimming lanes are the PCR fragment for being cloned into pET22b carrier.
Fig. 4 shows positive clone identification.Wherein, A figure shows the positive clone identification of pET30a-lipase, and B figure shows the positive clone identification of pET32a-lipase, and C figure shows the positive clone identification of pET22b-lipase, arrow indication is the band of lipase gene, occurs that the clone of the target stripe shown in arrow is positive colony.
Fig. 5 shows the SDS-PAGE electrophoresis result of carrying out after recon carries out abduction delivering.M: protein electrophorese Marker; C: compare after the thalline ultrasonication of not inducing; 1: take pET32a as carrier, the albumen size of expression is approximately 50kD; 2: take pET30a as carrier, the albumen size of expression is about 38kD; 3: take pET22b as carrier, the albumen size of expression is about 38kD.Arrow indication is restructuring Lipase protein band.
Fig. 6 shows fallibility PCR result.
Fig. 7 shows the variation tendency of lipase Rate activity after orthogenesis and fixed point transformation.
Fig. 8 shows the typical curve that Xylene Brilliant Cyanine G surveys protein concn.
Fig. 9 shows the idiographic flow of the acid base titration that the present invention adopts.
Embodiment
As used herein, " separation " refers to that material is separated from its primal environment (if natural substance, namely primal environment is natural surroundings).As the polynucleotide under the native state in active somatic cell and polypeptide do not have separation and purification, but same polynucleotide or polypeptide as from native state with in other materials existed separately, then for separation and purification.
As used herein, " isolated polypeptide " or " lipase of separation " refers to that lipase is substantially free of natural other albumen relative, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein Purification of Lipase of standard.
Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, improvement on synthesis, preferred recombinant polypeptide.Polypeptide of the present invention can be native purified product, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (such as, bacterium, yeast, filamentous fungus, higher plant, insect and mammalian cell).The host used according to recombinant production scheme, polypeptide of the present invention can be glycosylated, can be maybe nonglycosylated.
In the present invention, term " lipase " comprise there is lipase activity SEQ ID NO:4,6,8, the polypeptide shown in 10 or 12.This term also comprise have lipase function, SEQ ID NO:4,6,8, the variant form of 10 or 12.These variant forms comprise (but being not limited to): one or more (such as 1-10,1-5 best, more preferably, 1-3) amino acid whose disappearance, insertion and/or replacement, and add or disappearance one or several (being generally within 10, is more preferably within 5) amino acid at C-terminal and/or N-terminal.Such as, in the art, when replacing with similar nature or similar amino acid, the function of protein can not usually be changed.Preferred described variant form comprises one or more (such as 1-10,1-5 best, more preferably, 1-3 is individual) conservative property and replaces." conservative property replacement " utilizes a kind of amino-acid residue with similar side chain to substitute another kind of amino-acid residue.The family with similar side chain has in this area and clearly defines.These families comprise amino acid (the such as Methionin with basic side chain, arginine, Histidine), there is amino acid (the such as aspartic acid of acid side-chain, L-glutamic acid), there is amino acid (the such as glycine of uncharged polar side chain, l-asparagine, glutamine, Serine, Threonine, tyrosine, halfcystine), there is amino acid (the such as L-Ala of non-polar sidechain, α-amino-isovaleric acid, leucine, Isoleucine proline(Pro), phenylalanine, methionine(Met), tryptophane), there is amino acid (the such as Threonine of β-branched building block, α-amino-isovaleric acid, Isoleucine) and there is amino acid (the such as tyrosine of aromatic side chain, phenylalanine, tryptophane, Histidine).
Should be understood that for SEQ ID NO:4 of the present invention, 6,8, the variant form of 10 and 12, preferably they remain specifically noted by the present invention mutational site on sudden change." reservation " refers to the variant form of polypeptide of the present invention in this article except the sudden change on the mutational site had specifically noted by the present invention, also containing other variation, such as occur to insert as previously described, lack or sudden change on other one or more (preferably 1 ~ 5, more preferably 1 ~ 3) site.Such as, the variant form of polypeptide of the present invention at least retains the 57th residue is Val.In other embodiments, described variant form at least retain the 57th residue be Val and the 168th for Pro.In other embodiments, described variant form at least retain the 57th residue be Val and the 111st for Thr.In other embodiments, described variant form at least retain the 57th residue be Val and the 67th for Ala.In other embodiments, described variant form at least retains that the 57th residue is Val, the 67th for Ala and the 111st for Thr.In other embodiments, described variant form at least retain the 57th residue be Val, the 67th be Ala, the 111st for Thr and the 168th for Pro.In other embodiments, described variant form at least retain the 57th residue be Val, the 65th be Ala, the 67th be Ala, the 111st for Thr and the 168th for Pro.
In addition, as well known to those skilled in the art, in gene clone operation, usually need to design suitable restriction enzyme site, this certainly will introduce one or more incoherent residue at expressed albumen end, and this does not affect the activity of target protein.And for example in order to construction of fusion protein, promote the expression of recombinant protein, obtain the recombinant protein that is automatically secreted into outside host cell or the purifying being beneficial to recombinant protein, usually need some aminoacid addition in other appropriate area in the N-end of recombinant protein, C-end or this albumen, such as, include but not limited to, the joint peptide, signal peptide, leading peptide, end extension etc. that are applicable to.The aminoterminal of lipase of the present invention or carboxyl terminal also can contain one or more polypeptide fragment, as protein tag.Any suitable label may be used to the present invention.Such as, described label can be FLAG, HA, HA1, c-Myc, Poly-His, Poly-Arg, Strep-TagII, AU1, EE, T7,4A6, ε, B, gE and Ty1.These labels can be used for carrying out purifying to albumen.Following table lists some labels wherein and sequence thereof.
Polynucleotide of the present invention can be DNA form or rna form.DNA form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-strand.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can the varient of or degeneracy identical with the coding region sequence shown in SEQ ID NO:3,5,7,9 or 11.As used herein, " varient of degeneracy " refer in the present invention coding SEQ ID NO:4,6,8, the protein of 10 or 12, but with shown in SEQ ID NO:3,5,7,9 or 11 shown in the differentiated nucleotide sequence of coding region sequence.
Term " polynucleotide of coded polypeptide " can be the polynucleotide comprising encoding such peptides, also can be the polynucleotide also comprising additional code and/or non-coding sequence.
The invention still further relates to and above-mentioned sequence hybridization and have at least 50% between two sequences, preferably at least 70%, the more preferably polynucleotide of at least 80% homogeny.The present invention be more particularly directed to polynucleotide interfertile with polynucleotide of the present invention under stringent condition (or stringent condition).In the present invention, " stringent condition " refers to: (1) compared with the hybridization under low ionic strength and comparatively high temps and wash-out, as 0.2 × SSC, 0.1%SDS, 60 DEG C; Or be added with denaturing agent during (2) hybridization, and as 50% (v/v) methane amide, 0.1% bSA/0.1%Ficoll, 42 DEG C etc.; Or (3) homogeny only between two sequences, at least more than 90%, is just hybridized when being more preferably more than 95%.Further, the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in SEQ ID NO:4,6,8,10 or 12.
The invention still further relates to the nucleic acid fragment with above-mentioned sequence hybridization.As used herein, the length of " nucleic acid fragment ", at 15 ~ 50 Nucleotide, is better between 15 ~ 30 Nucleotide.Nucleic acid fragment can be used for the amplification technique (as PCR) of nucleic acid to determine and/or to be separated the polynucleotide of encoding lipase.
Polypeptide in the present invention and polynucleotide preferably provide with the form be separated, and are more preferably purified to homogeneous.
Lipase Nucleotide full length sequence of the present invention or its fragment can obtain by the method for pcr amplification method, recombination method or synthetic usually.For pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the cDNA storehouse prepared by ordinary method well known by persons skilled in the art as template, amplification and relevant sequence.When sequence is longer, usually needs to carry out twice or repeatedly pcr amplification, and then the fragment that each time amplifies is stitched together by proper order.
Once obtain relevant sequence, just relevant sequence can be obtained in large quantity with recombination method.This is normally cloned into carrier, then proceeds to cell, is then separated from the host cell after propagation by ordinary method and obtains relevant sequence.
In addition, also relevant sequence can be synthesized, when especially fragment length is shorter by the method for synthetic.Usually, by first synthesizing multiple small segment, and then carry out connect can obtain the very long fragment of sequence.
At present, the DNA sequence dna of code book invention albumen (or its fragment, or derivatives thereof) can be obtained completely by chemosynthesis.Then this DNA sequence dna can be introduced in various existing DNA molecular (or as carrier) as known in the art and cell.In addition, also by chemosynthesis, sudden change is introduced in protein sequence of the present invention.
The method of application round pcr DNA amplification/RNA is optimized for and obtains gene of the present invention.When being particularly difficult to obtain the cDNA of total length from library, preferably can use RACE method (RACE-cDNA end rapid amplification), primer for PCR suitably can be selected according to sequence information of the present invention disclosed herein, and using conventional procedures synthesis.Using conventional procedures is as the DNA/RNA fragment increased by gel electrophoresis abstraction and purification.
The present invention also relates to the carrier comprising polynucleotide of the present invention, and with the host cell that carrier of the present invention or lipase encoding sequence produce through genetically engineered, and the method for polypeptide of the present invention is produced through recombinant technology.Preferably, carrier of the present invention is expression vector.
By the recombinant DNA technology of routine, polynucleotide sequence of the present invention can be utilized to can be used to the lipase of expression or Restruction.In general following steps are had:
(1). with the polynucleotide (or varient) of encoding lipase of the present invention, or transform or suitable host cell of transduceing with the recombinant expression vector containing these polynucleotide;
(2). the host cell cultivated in suitable substratum;
(3). separation, protein purification from substratum or cell.
In the present invention, the polynucleotide sequence of encoding lipase can be inserted in recombinant expression vector.Term " recombinant expression vector " refers to bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell is viral, mammalian cell is viral as adenovirus, retrovirus or other carrier.As long as can copy in host and stablize, any plasmid and carrier can be used.A key character of expression vector is usually containing replication orgin, promotor, marker gene and translation controlling elements.Expression vector also comprises ribosome bind site and the transcription terminator of translation initiation.
Method well-known to those having ordinary skill in the art can be used for building fatty enzyme DNA sequences encoding and the suitable expression vector of transcribing/translating control signal.These methods comprise recombinant DNA technology in vi, DNA synthetic technology, In vivo recombination technology etc.Described DNA sequence dna can be effectively connected in the suitable promotor in expression vector, synthesizes to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; Lambda particles phage PL promotor; Eukaryotic promoter comprise CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, the LTRs of retrovirus and some other known can the promotor expressed in protokaryon or eukaryotic cell or its virus of controlling gene.
In addition, expression vector preferably comprises one or more selected marker, to be provided for the phenotypic character selecting the host cell transformed, as Tetrahydrofolate dehydrogenase, neomycin resistance and green fluorescent protein (GFP) that eukaryotic cell is cultivated, or for colibacillary tsiklomitsin or amicillin resistance.
Comprise the carrier of above-mentioned suitable DNA sequence dna and suitably promotor or control sequence, may be used for transforming suitable host cell, with can marking protein.
Host cell can be prokaryotic cell prokaryocyte, as bacterial cell; Or the eukaryotic cell such as low, as yeast cell; Filamentous fungal cells or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; The bacterial cell of Salmonella typhimurium; Fungal cell is as yeast, filamentous fungus, vegetable cell; The insect cell of fruit bat S2 or Sf9; The zooblast etc. of CHO, COS, 293 cells or Bowes melanoma cells.
When polynucleotide of the present invention are expressed in higher eucaryotic cells, if will make to transcribe to be enhanced when inserting enhancer sequence in the carrier.Enhanser is the cis-acting factors of DNA, and nearly 10 to 300 base pairs, act on promotor transcribing with enhancing gene usually.
Persons skilled in the art all know how to select suitable carrier, promotor, enhanser and host cell.
Can carry out with routine techniques well known to those skilled in the art with recombinant DNA transformed host cell.When host be prokaryotic organism as intestinal bacteria time, the competent cell that can absorb DNA can be gathered in the crops at exponential growth after date, uses CaCl
2method process, step used is well-known in this area.Another kind method uses MgCl
2.If needed, transform and also can be undertaken by the method for electroporation.When host is eukaryote, can select following DNA transfection method: calcium phosphate precipitation, conventional mechanical methods is as microinjection, electroporation, liposome packaging etc.
The transformant obtained can be cultivated by ordinary method, expresses the polypeptide of coded by said gene of the present invention.According to host cell used, substratum used in cultivation can be selected from various conventional medium.Cultivate under the condition being suitable for host cell growth.When after host cell growth to suitable cell density, the promotor selected with the induction of suitable method (as temperature transition or chemical induction), cultivates for some time again by cell.
Recombinant polypeptide in the above methods can be expressed or be secreted into extracellular in cell or on cytolemma.If needed, can utilize its physics, the albumen of being recombinated by various separation method abstraction and purification with other characteristic of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation process, combination by protein precipitant process (salting-out method), centrifugal, the broken bacterium of infiltration, super process, ultracentrifugation, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.
The invention provides a kind of method of screening lipase, the described method substrate comprised using triglyceride level as lipase to be screened carries out enzymolysis and filters out the step of the lipase that Rate activity improves according to the colour-change that pH indicator produces.
Screening method of the present invention can comprise the following steps:
(1) lipase to be screened is provided;
(2) solution containing pH indicator and low-grade alkyl carboxylic acid's salt is provided;
(3) triglyceride level is added in the solution of step (2), obtains mixed solution;
(4) lipase is added in the mixed solution of step (3) gained; With
(5) observe the change of mixed solution color, the colour-change produced according to pH indicator filters out the lipase that Rate activity improves.
To be applicable to triglyceride level of the present invention can be fatty acid chain length is the triglyceride level of 12-22, includes but not limited to sweet oil, Zoomeric acid triglyceride level, linoleic acid triglyceride, a-linolenic acid triglyceride level, r-linolenic acid triglyceride level, 8A8, cis-5,8,11,14,17-timnodonic acid (EPA) triglyceride level, cis-4,7,10,13,16,19-docosahexenoic acid (DHA) triglyceride level etc.
Triglyceride level can be formulated in organic solvent, and organic solvent includes but not limited to DMF, DMSO, polyvinyl alcohol, Sudan Gum-arabic etc.
Be applicable to the IIA race metal-salt that low-grade alkyl carboxylic acid's salt of the present invention comprises long 2-6 carbon atom alkyl carboxylic acid, include but not limited to calcium salt and the magnesium salts of acetic acid, propionic acid, butyric acid etc.In a preferred embodiment, described low-grade alkyl carboxylic acid's salt is calcium acetate.
Be applicable to pH indicator of the present invention comprise various at pH 4.0 ~ 9.0 (such as, in the scope of 4.0 ~ 7.0, or in the scope of 7.0 ~ 9.0, or in the scope of 5.0 ~ 9.0, or in the scope of 5.0 ~ 8.0) under colour developing pH indicator, include but not limited to dibromothymolsulfonphthalein, phenolsulfonphthalein, methylenum coeruleum, toluylene red, methyl red, tetrabromo-mcresolsulfonphthalein, tropeolin-D, tetrabromophenol sulfonphthalein, Congo red.These pH indicator can be used alone, or can be used in combination.Such as, the combination of dibromothymolsulfonphthalein and phenolsulfonphthalein can be used, and the combination of phenolsulfonphthalein and methylenum coeruleum.If combinationally use, in combination, the ratio of each indicator can be 1: 5 ~ 5: 1, preferably 1: 1.Such as, can use 1: 1 dibromothymolsulfonphthalein and phenolsulfonphthalein or 1: 1 phenolsulfonphthalein and methylenum coeruleum.
Can shades of colour be shown for pH indicator of the present invention, only need there is colour-change (such as from depth to shallow or from light to dark) in enforcement process of the present invention, so that observation.
Usually, various damping fluid can be used to prepare the damping fluid of low-grade alkyl carboxylic acid's salt and pH indicator, if this damping fluid not with this reactant salt.Such as, the damping fluid of low-grade alkyl carboxylic acid's salt and pH indicator can be prepared with Tris damping fluid.Those skilled in the art can according to state of the art can determine which damping fluid can with low-grade alkyl carboxylic acid's reactant salt.Should be understood that and can prepare the damping fluid of low-grade alkyl carboxylic acid's salt and the damping fluid of pH indicator respectively, and then mixed; Also both can be added in damping fluid together and prepare.The damping fluid being preferred for preparing low-grade alkyl carboxylic acid's salt is identical with the damping fluid for preparing pH indicator.
Method of the present invention screens the lipase of Rate activity raising by the colour-change that pH indicator shows.Such as, the lipase that the change that the lipase caused by more different lipase adds the color of front and back mixed solution improves to screen Rate activity.Also can use wild type lipase in contrast, by contrasting color that lipase to be screened produces and contrasting the dithering produced and go out the lipase that Rate activity improves.Usually, colour-change is more obvious, shows that enzyme is lived higher.
The inventive method can use porous plate to screen, and is high-throughput screening method.Such as, method of the present invention can use 96 orifice plates to carry out.
For the screening method using porous plate to carry out, each Kong Zhongke adds the enzyme liquid of the pH indicator solution of about 15 ~ 25 μ l, the buffered soln of low-grade alkyl carboxylic acid's salt of about 50 ~ 70 μ l, about 80 ~ 120 μ l triglyceride level solution and about 5 ~ 30 μ l.Amount of solution in hole should be no more than the cubic capacity in hole, and such as, for 96 orifice plates, total amount of solution in every hole should be no more than 200 microlitres.
Therefore, in a preferred embodiment, containing the buffered soln of low-grade alkyl carboxylic acid's salt of the pH indicator solution of 20 microlitres of having an appointment, about 60 microlitres in the reaction soln of every 200 microlitres, the triglyceride level solution of about 100 microlitres and the enzyme liquid of about 20 microlitres.When using other porous plate, according to the volume of each composition in the volume adjustment solution of this porous plate hole, to avoid solution too much, outside overfolw hole, crossed contamination can be caused.
There is no particular restriction for the amount that should be understood that for screening triglyceride level used, pH indicator, low-grade alkyl carboxylic acid's salt.Usually, triglyceride level and low-grade alkyl carboxylic acid's salt can be excessive, as long as pH indicator can play discoloration indication, do not have the relation of Specific amounts with enzyme.And the amount of enzyme is also not particularly limited, enzyme liquid measure all can detect from 5 microlitres to 100 microlitres.Those skilled in the art can select the triglyceride level of appropriate amount, pH indicator, low-grade alkyl carboxylic acid's salt and enzyme to screen according to the reality situation of screening.
In one embodiment, when preparing separately, in described pH indicator solution, the concentration of pH indicator is 0.3 ~ 1.5mg/LTris damping fluid.When to use two or more pH indicator simultaneously, its total concn should within this scope.
In one embodiment, when preparing separately, in the damping fluid of described low-grade alkyl carboxylic acid's salt, the concentration of low-grade alkyl carboxylic acid's salt is 0.1 ~ 0.3M.When pH indicator and low-grade alkyl carboxylic acid's salt being added in damping fluid if should be understood that, their respective concentration should within the concentration range of pH indicator in the mixed solution of the solution gained of the above-mentioned independent preparation of mixing and low-grade alkyl carboxylic acid's salt simultaneously.
In one embodiment, triglyceride level solution be triglyceride level with about 1: 4 ~ 6 volume ratio be dissolved in the solution that organic solvent obtains.
Lipase to be screened obtains by following methods: adopt conventional gene engineering to set up lipase mutated library; With expression mutant lipase.Embodiment part describes the object lesson set up lipase mutated library and express mutant lipase herein.Should be understood that various libraries establishment method known in the art and protein expression method all can be used for implementing the present invention.
Adopting after aforesaid method screening obtains the lipase that Rate activity provides, can adopt alkali titration to screen the lipase obtained and carries out multiple sieve, filter out the lipase of Rate activity raising.An example of alkali titration can see the 2.1st part of the embodiment of the present application 2.More alkali titration can see Brockman H L.Triglyceride lipase from porcine pancrease, Methods Enzymol, 1981,71:619-627; He Yaoqiang, Wang Ping Wu, Tan Tianwei, the Study on Fermentation of candiyeast 99-125 lipase, biotechnology journal, 2004,20 (6): 918-921; Jiang Huifang, Wang Yaqin, Liu Chunguo, the comparison of three kinds of Determination Methods for Lipase Activities and improvement, chemistry and biotechnology, 2007,24 (8): 72-75.
The present invention also provides a kind of reaction system for screening lipase, and this reaction system contains:
(1) triglyceride level; With
(2) pH indicator.
In one embodiment, described reaction system is also containing low-grade alkyl carboxylic acid's salt.
To be applicable to triglyceride level of the present invention can be fatty acid chain length is the triglyceride level of 12-22, includes but not limited to sweet oil, Zoomeric acid triglyceride level, linoleic acid triglyceride, a-linolenic acid triglyceride level, r-linolenic acid triglyceride level, 8A8, cis-5,8,11,14,17-timnodonic acid (EPA) triglyceride level, cis-4,7,10,13,16,19-docosahexenoic acid (DHA) triglyceride level etc.
Be applicable to the IIA race metal-salt that low-grade alkyl carboxylic acid's salt of the present invention comprises long 2-6 carbon atom alkyl carboxylic acid, include but not limited to calcium salt and the magnesium salts of acetic acid, propionic acid, butyric acid etc.In a preferred embodiment, described low-grade alkyl carboxylic acid's salt is calcium acetate.
Be applicable to pH indicator of the present invention comprise various at pH 4.0 ~ 9.0 (such as, in the scope of 4.0 ~ 7.0, or in the scope of 7.0 ~ 9.0, or in the scope of 5.0 ~ 9.0, or in the scope of 5.0 ~ 8.0) under colour developing pH indicator, include but not limited to dibromothymolsulfonphthalein, phenolsulfonphthalein, methylenum coeruleum, toluylene red, methyl red, tetrabromo-mcresolsulfonphthalein, tropeolin-D, tetrabromophenol sulfonphthalein, Congo red.These pH indicator can be used alone, or can be used in combination.Such as, the combination of dibromothymolsulfonphthalein and phenolsulfonphthalein can be used, and the combination of phenolsulfonphthalein and methylenum coeruleum.If combinationally use, in combination, the ratio of each indicator can be 1: 5 ~ 5: 1, preferably 1: 1.Such as, can use 1: 1 dibromothymolsulfonphthalein and phenolsulfonphthalein or 1: 1 phenolsulfonphthalein and methylenum coeruleum.Therefore, the pH scope of reaction system of the present invention between 4.0 ~ 9.0, such as, in the scope of 4.0 ~ 7.0, or in the scope of 7.0 ~ 9.0, or in the scope of 5.0 ~ 9.0, or in the scope of 5.0 ~ 8.0.Those skilled in the art can select different pH scopes and pH indicator according to the screening conditions of reality.
Can shades of colour be shown for pH indicator of the present invention, only need there is colour-change (such as from depth to shallow or from light to dark) in enforcement process of the present invention, so that observation.
Usually, also contain for preparing the organic solvent of triglyceride level and the damping fluid for preparing pH indicator and/or low-grade alkyl carboxylic acid's salt in reaction system of the present invention.Therefore, in one embodiment, reaction system of the present invention contains: triglyceride level, pH indicator, organic solvent and damping fluid, and optional low-grade alkyl carboxylic acid's salt.Organic solvent includes but not limited to DMF, DMSO, polyvinyl alcohol, Sudan Gum-arabic etc.Various damping fluid can be used to prepare the damping fluid of low-grade alkyl carboxylic acid's salt and pH indicator, if this damping fluid not with this reactant salt.Such as, the damping fluid of low-grade alkyl carboxylic acid's salt and pH indicator can be prepared with Tris damping fluid.Those skilled in the art can according to state of the art can determine which damping fluid can with low-grade alkyl carboxylic acid's reactant salt.The damping fluid being preferred for preparing low-grade alkyl carboxylic acid's salt is identical with the damping fluid for preparing pH indicator.
There is no particular restriction for the amount that should be understood that for triglyceride level, pH indicator, low-grade alkyl carboxylic acid's salt in reaction system of the present invention.Usually, triglyceride level and low-grade alkyl carboxylic acid's salt can be excessive, as long as pH indicator can play discoloration indication, do not have the relation of Specific amounts with enzyme.
In a reaction system example of the present invention, reaction system described in every 200 μ l can containing and the pH indicator solution of about 80 ~ 120 μ l triglyceride level solution and about 15 ~ 25 μ l.Preferably, described triglyceride level solution be triglyceride level with 1: 4 ~ 6 volume ratio be dissolved in organic solvent and obtain.In pH indicator solution, the concentration of pH indicator is 0.3 ~ 1.5mg/L Tris damping fluid.When using two or more pH indicator, the total concn of pH indicator should within above-mentioned scope.Optionally, this reaction system also can containing the buffered soln of low-grade alkyl carboxylic acid's salt of 50 ~ 70 μ l that have an appointment.In the buffered soln of low-grade alkyl carboxylic acid's salt, the concentration of low-grade alkyl carboxylic acid's salt is generally 0.1 ~ 0.3M.
Usually, triglyceride level solution, pH indicator solution and/or low-grade alkyl carboxylic acid's salts solution can be prepared respectively, and then they are mixed.Therefore, reaction system of the present invention can contain the damping fluid of self-existent triglyceride level solution, pH indicator solution and/or low-grade alkyl carboxylic acid's salt.Or, triglyceride level, pH indicator and/or low-grade alkyl carboxylic acid's salt can be added in the mixed solution of such as organic solvent and damping fluid simultaneously, form the reaction system existed with mixed solution form.But under should be understood that latter event, after mixing, in gained solution, triglyceride level, pH indicator and/or low-grade alkyl carboxylic acid's salt concentration separately should mix within concentration range respective in the mixed solution of the solution gained of preparation separately.
Reaction system of the present invention also can the form of test kit provide.Such as, the container that above-mentioned each solution is housed respectively can be comprised in test kit; Or, the container of the mixed solution that above-mentioned solution is housed in test kit, can be comprised.Also can comprise in test kit such as implementing the porous plate etc. of high flux screening.The working instructions of conduct screening method of the present invention also can be comprised in test kit.
In a preferred embodiment, reaction system of the present invention contains: 20 microlitre indicator (bromine hundred li of Finland and phenolsulfonphthalein, each 0.5mg/mL is dissolved in Tris damping fluid), 60 microlitre 0.1M calcium acetates and 100ul sweet oil (being dissolved in DMF by 1: 6).
Should be understood that reaction system of the present invention can be used for high flux screening, therefore its cumulative volume is generally the volume being less than each hole of high flux screening porous plate.Therefore, suitable reaction system volume can be selected according to enzyme liquid sum pore volume to be added.Usually, enzyme liquid measure all can detect by reaction system of the present invention from 5 microlitres to 100 microlitres.In addition, when screening without high-throughput, those skilled in the art also can prepare reaction system of the present invention according to practical situation, and are not necessarily limited within scope mentioned above by its volume.
The experimental technique of unreceipted actual conditions in the following example, usual conveniently condition is as Sambrook etc., " molecular cloning: lab guide " (New York, United States: CSH Press (Cold SpringHarbor Laboratory Press), 1989) condition described in, or carry out according to the condition that manufacturer advises.For usage and the consumption of reagent, unless otherwise stated, usage conveniently and consumption use.
Embodiment 1: the cloning and expression of lipase
1.1 materials and methods
1.1.1 material
1.1.1.1 goal gene, bacterial strain and plasmid
The lipase gene deriving from eukaryote Rhizomucor miehei is synthesized by Shanghai Shan Jing molecular biosciences Science and Technology Ltd.; Expression plasmid pET30a (+), pET22b, pET32a and Host Strains E.coliBL21 are purchased from Novagen (WI) company (Wisconsin, USA).Bacterial strain uses therefor all adds corresponding microbiotic and carries out 37 DEG C of shaking tables cultivations in corresponding substratum.
1.1.1.2 toolenzyme
Taq DNA polymerase is purchased from Promega company, PrimeSTAR
tMhS DNA Polymerase is purchased from Takara company, and restriction enzyme EcoR I, Not I, HindIII, NcoI and T4DNA quick ligase are purchased from Sangon Biotech (Shanghai) Co., Ltd..
1.1.1.3 reagent
The Mg that regular-PCR is used
2+, Buffer, dNTP are purchased from Promega company, and High fidelity PCR Buffer used is (containing Mg
2+) being purchased from Takara company, PCR Cleanup test kit, plasmid extraction kit, gel purification kit and genome extract test kit and are all purchased from axygen company, and PCR primer is synthesized by the handsome biotech firm in Shanghai, and other reagent are domestic analytical pure.
LB substratum:
1% peptone, 0.5% yeast powder, 1%NaCl.Adjust pH7.2 with NaOH, 121 DEG C of sterilizings are for subsequent use.(solid medium adds 1.5-2% agar in LB substratum).
1.1.2 experimental technique
1.1.2.1 agarose gel electrophoresis
Reagent is joined by institute:
10 × TBE:108g Tri s alkali, 55g boric acid, 40ml 0.5mol/LEDTA (pH8.0), constant volume 1L
6 × sample-loading buffer: 50% glycerine, 0.25% tetrabromophenol sulfonphthalein, 0.25% xylene cyanol blue FF, 1mmol/L EDTA (pH8.0).
Experimental technique:
(1) weighing 0.2g agarose pours in Erlenmeyer flask, adds 0.5 × tbe buffer liquid 40ml;
(2) after in microwave oven, heated and boiled to agarose dissolves completely, room temperature is placed into about 50 DEG C, adds 2 μ l DNAGreen staining agents, pours two ends into and sealed and placed in the electrophoresis chamber of comb after shaking up;
(3), after being with agarose to solidify, taking comb away, gel slab is put into electrophoresis chamber, put well according to positive and negative electrode, add in glue hole after 5 μ l DNA sample and 1 μ l sample-loading buffer are mixed, switch on power, carry out the electrophoretic analysis of DNA with the voltage of 10V/cm.
1.1.2.2 the extraction and purification of plasmid
Reagent is joined by institute: all have plasmid extraction kit to carry
Experimental technique: the Host Strains containing target plasmid is linked in 5mlLB nutrient solution (containing corresponding microbiotic by millesimal inoculum size, ratio is thousandth), 37 DEG C, 200r/min cultivates 12-16 hour, then with reference to Plasmid extraction kit specification sheets process bacterium liquid, extraction and the purifying of plasmid is carried out.
1.1.2.3 the selection of cloning vector and design of primers and synthesis
According to different gene expression characteristics; select the carrier pET32a containing encoding thioredoxin sequence; carrier pET22b containing coded signal peptide and conventional coli expression carrier pET30a is cloning vector; and according to the different characteristics of each carrier; by Primer software, design of primers (comprising restriction enzyme site and protection base) is carried out to target gene.
PCR reaction system:
10 × DNA polymerase buffer liquid 5 μ l
MgCl
2(25mmol/L)4μl
dNTPs(10mmol/L)1μl
Forward primer (50 μm of ol/L) 1 μ l
Reverse primer (50 μm of ol/L) 1 μ l
Recombinant vectors pUC template containing goal gene: about 10pmol
Polysaccharase (5U/ μ l) 0.5 μ l
Add ddH
2o is 50 μ l to cumulative volume
PCR response procedures:
The first step: 95 DEG C of denaturation 3min
Second step: (35 circulations)
Sex change, 95 DEG C of 30s; Annealing, 55 DEG C, 50S; Extend, 72 DEG C, 1min
3rd step: 72 DEG C extend 10min
4 DEG C of insulations
1.1.2.4 the purifying of lipase gene, enzyme cut and with the connection of carrier
Purifying:
Reagent is joined by institute: reclaim test kit by Cleanup purification kit and gel and carry
Method: the gene obtained by pcr amplification directly carries out purifying by PCR-Cleanup kit or select DNA extraction kit test kit to carry out rubber tapping reclaiming purifying (protocol that method steps carries according to test kit operates).
Enzyme is cut:
Restriction enzyme site according to designed PCR primer carries out double digestion reaction, meanwhile, also adopts same restriction endonuclease to carry out double digestion reaction by needing the plasmid connected.
Enzyme cuts system (40 μ l):
PCR primer or plasmid DNA: 29 μ l
10 × Tango damping fluid: 8 μ l
Restriction endonuclease 1:1.5 μ l
Restriction endonuclease 2:1.5 μ l
Under 37 DEG C of conditions, enzyme cuts architecture heat preservation 3-4 hour.
Digestion products purifying:
Reagent is joined by institute: carry by gel purification kit
Method: after being mixed with 8 μ l6 × sample-loading buffers by digestion products, carry out gel electrophoresis, the method reclaimed by rubber tapping, purifying reclaims PCR digestion products and plasmid enzyme restriction product respectively.Rubber tapping recovery purification process carries explanation according to gel recovery test kit to carry out.
Connect:
By rubber tapping reclaim digestion products carry out electrophoresis after, roughly calculating concentration, with PCR primer: plasmid be 1: 5 concentration connect, wherein add T4DNA quick ligase (5U/ μ l) and the 1 μ l ligase enzyme damping fluid of 0.5 μ l, finally add ddH
2o complements to 10 μ l, connects 1 hour, for next step conversion at 22 DEG C.
1.1.2.5 the common competent preparation of e. coli bl21 and conversion
Reagent is joined by institute:
CaCl
2solution: 60mmol/LCaCl
2, 15% glycerine (pH7.2), 4 DEG C of preservations after 121 DEG C of sterilizings.
Method:
The preparation of competent cell:
(1) the single colony inoculation of picking bacterium is in 5ml LB substratum, and 12-16 hour is cultivated in 37 DEG C of concussions;
(2) getting 2ml culture is inoculated in 200ml LB substratum/500ml triangular flask, and 37 DEG C of concussion substratum are to OD
600for 0.3-0.4;
(3) culture is transferred in 50ml centrifuge tube, place 20min on ice;
(4) 4 DEG C, the centrifugal 5min of 3000rpm, collect thalline, abandoning supernatant;
(5) with the CaCl of 10ml precooling
2the resuspended thalline of solution, 4 DEG C, the centrifugal 5min of 3000rpm;
(6) with the CaCl of 10ml precooling
2the resuspended thalline of solution, ice bath 30min;
(7), in packing 100 μ l to eppendorf pipe, drop in liquid nitrogen immediately, then in-80 DEG C of preservations, for subsequent use.
The conversion of competent cell:
(1) preparation PCR connection product and plasmid (in this system, use ddH from the contrast connection product connected
2o replaces PCR primer);
(2) competent cell of two pipe 100 μ l is got, at thawed on ice;
(3) PCR of 10 μ l connection product and plasmid being joined in competent cell respectively from connecting product, mixing with rifle gently;
(4) ice bath 20-40min;
(5) 42 DEG C of thermal shock 90s, put into ice rapidly, ice bath 5min;
(6) add 1mlLB substratum, 37 DEG C, 40-50min is cultivated in 200rpm concussion;
(7) getting 200-300 μ l nutrient solution coats containing on corresponding antibiotic LB culture medium flat plate, after 30min cultivated by 37 DEG C of incubators, is inverted overnight incubation.
1.1.2.6 the qualification of recon
(1) from picking list colony inoculation transformation plate in 5mlLB substratum, 37 DEG C of shaking culture 6-8 hour, carry out plasmid extraction;
(2) according to the design of PCR primer, carry out enzyme with identical restriction endonuclease and cut (reaction system see on) 3 hours, digestion products is carried out gel electrophoresis, the existence of testing goal gene.
(3) positive colony is preserved, for using from now on.
1.1.2.7 the abduction delivering of target protein
Reagent is joined by institute:
100mmol/L IPTG (being dissolved in DMSO);
PBS：NaCl 8g/l，KCl 0.2g/l，Na
2HPO
4·12H
2O 3.63g/l，KH
2PO
40.24g/l，pH7.4。
Tris-HCl damping fluid: 50mmol/L Tris-HCl (pH8.0)
Experimental technique:
(1) by positive colony picking to 5ml containing antibiotic LB substratum test tube in, cultivate 12-16 hour, after with 2% inoculum size transfer in containing 50ml containing antibiotic LB substratum 250ml shaking flask in cultivate in 37 DEG C;
(2) bacterium liquid OD is treated
600when value reaches about 0.5, the IPTG adding 0.1mmol/L induces 16-20 hour under 16 DEG C of conditions;
(3) next day, collected by centrifugation thalline, and wash with PBS (pH7.4), collected after centrifugation thalline, be dissolved in 50mmol/L Tris-HCl (pH8.0) solution of 4ml, carry out ultrasonication;
(4) carry out centrifugal (4000rpm, 10min) after fragmentation, target protein is then dissolved in supernatant liquor, get wherein 10 μ l and 30 μ l 4 × protein sample-loading buffer mix after, carry out SDS-PAGE protein electrophorese.Electrophoresis terminates the dyeing of rear coomassie brilliant blue R_250, carries out gel imaging system and checks result.
1.1.2.8SDS-PAGE protein electrophoresis
Reagent is joined by institute:
10％APS；10％SDS
4 × protein electrophorese sample-loading buffer: 200mmol/L Tris-HCl (pH6.8), 8%SDS, 0.04% tetrabromophenol sulfonphthalein, 40% glycerine, 400mmol/L DDT, 4 DEG C of preservations;
10 × protein electrophorese electrode buffer: Tris 6g, Glyc i ne 28.8g, SDS10g, pH8.3, constant volume 1L;
30% glue mother liquor: 30%Acrylamide, 0.8%bis;
Separation gel damping fluid (pH8.8): 3.0mmol/L Tris;
Concentrated glue damping fluid (pH6.8): 1.0mol/L Tris;
Coomassie brilliant blue staining liquid: coomassie brilliant blue R_250 1.0g, methyl alcohol 500ml, Glacial acetic acid 100ml, constant volume 1L;
Destainer: methyl alcohol 50ml, acetic acid 75ml, constant volume 1L;
Separation gel and concentrated glue formula are in table 1:
The formula of separation gel and concentrated glue in table 1:SDS-PAGE protein electrophoresis
Experimental technique:
Prepare before electrophoresis:
(1) plate is filled;
(2) separation gel (adopting 15% gel) is joined
(3), after the separation gel solution prepared being mixed, fill with immediately in glue;
(4) on separation gel, cover one deck Virahol (about 200 μ l), room temperature places about 2 hours, and separation gel is polymerized completely;
(5) remove Virahol, with water cleaning, blot more than after moisture, the concentrated glue of preparation;
(6), after concentrating sol solution mixing, pour in glue immediately, and plug comb, attention can not produce bubble;
(7) room temperature places about half an hour, after waiting concentrated glue to be polymerized completely, with distilled water wash, then adds after 1 × SDS electrophoretic buffer cleans well repeatedly in upper and lower electrophoresis chamber, adds 1 × SDS electrophoretic buffer in upper and lower electrophoresis chamber.1 × SDS electrophoretic buffer of upper groove will exceed gel well.
Electrophoretic procedures:
(1) mixed by 4 × SDS sample-loading buffer of the protein solution of 30 μ l with 10 μ l, 100 DEG C of process 5min, get supernatant after centrifugal;
(2) add in well by sample, voltage is adjusted to 100V and starts electrophoresis, after sample enters concentrated glue, high voltage is that 150V is until electrophoresis terminates;
(3) carefully take out glue, prescind concentrated glue, carry out soaking (not having glue) with Xylene Brilliant Cyanine G R520 solution, mild shake, after about 1 hour, is removed dye liquor, then is decoloured with destainer, change several times after destainer and decolouring spend the night;
(4) SDS-PAGE electrophoresis is put in gel imaging system, checks result.
1.1.2.9Bradford method measures protein concentration
Material: measure protein standard curve test kit Quick Start
tMbovine Serum Albumin (BSA) Standard Set is purchased from Bio-RAD company.
Reagent is joined by institute:
Coomassie brilliant G-250 dye reagent: claim 100mg Coomassie brilliant G-250, after being dissolved in the ethanol of 50ml95%, then add 120ml 85% phosphoric acid, be diluted with water to 1 liter.
Experimental technique:
(1) glass cuvette is immersed in 95% ethanol in advance cleans, then carefully use tweezers gripping, dry with blower.Then add 1.0ml Coomassie brilliant G-250 reagent wherein, measure light absorption value in 595nm place, as blank.
(2) protein standard substance (0.125mg/ml, 0.25mg/ml, 0.5mg/ml, 0.75mg/ml, 1mg/ml) the 20 μ l of different concns is chosen respectively, carefully add mention in previous step be added with in the cuvette of Xylene Brilliant Cyanine G, mix gently, be uniformly distributed after whole cuvette until blueness, in 595nm place reading numerical values, then it is albumen light absorption value corresponding under this concentration.
(3) with OD
595numerical value is X-coordinate, is ordinate zou mapping, namely obtains the typical curve that Xylene Brilliant Cyanine G surveys protein concn, as shown in Figure 8 by standard protein quality (mg).
Result:
The amplification of lipase gene
According to the different cloning vectors selected, design primer is as follows:
Carrier: pET30a; Restriction enzyme site: EcoRI+HindIII,
Upper primer: 5 ' GCGGAATTCGGTGCCAATCAAGAGACAATC3 ' (SEQ ID NO:13)
Lower primer: 5 ' GCGAAGCTTTTAATGGTGGTGATGATGGT3 ' (SEQ ID NO:14)
Carrier: pET32a; Restriction enzyme site: EcoRI+NotI,
Upper primer: 5 ' GCGGAATTCGGTGCCAATCAAGAGACAATC3 ' (SEQ ID NO:15)
Lower primer: 5 ' GCGGCGGCCGCTTAATGGTGGTGATGATGGT3 ' (SEQ ID NO:16)
Carrier: pET22b; Restriction enzyme site: EcoRI+NotI,
Upper primer: 5 ' GCGGAATTCAGGTGCCAATCAAGAGACAATC3 ' (SEQ ID NO:17)
Lower primer: 5 ' GCGGCGGCCGCTTAATGGTGGTGATGATGGT3 ' (SEQ ID NO:18)
PCR primer, after 1.0% agarose gel electrophoresis qualification, obtains and estimates PCR primer of the same size (see Fig. 3).Gene order (wild-type) is presented at SEQ ID NO:1, and aminoacid sequence is shown in SEQ IDNO:2.
The structure of recombinant expression vector
The selection of expression vector and host cell
In cloning procedure, select suitable expression vector and host extremely important.Different strain Escherichia coli has the difference comparing and reach in the ability to express of culture condition and foreign gene.Expression product has three approach in intestinal bacteria: (1) forms native conformation, solvable and have vigor, is not easy to be degraded; (2) protein is solvable, but conformation is not natural, is easily degraded by proteolytic enzyme identification various in born of the same parents; (3) form insoluble inclusion body each other between polypeptide chain, and there is protease resistant.Wherein, form native conformation, and not to be easily degraded by proteases be optimal form, and for later orthogenesis, the product of expression is solvable and to have vigor most important to carrying out high flux screening smoothly.Therefore, suitable expression system will be selected before construction of expression vector.Because target gene derives from eucaryon rice black mould, therefore to there is protein disulfide bond in the expression in intestinal bacteria form difficulty, and lack the problems such as posttranslational modification, thus have impact on the expression effect of target protein in intestinal bacteria.The present invention selects pET32a as cloning vector, because it is with the sequence of encoding thioredoxin, can help the formation of the disulfide linkage of target protein when protein expression, thus helps target protein solubility expression; Select pET22b as cloning vector, because it is with the sequence of coded signal peptide, when protein expression, can enter colibacillus periplasm space by guiding target albumen, there is more conducive to the formation of intestinal bacteria disulfide linkage, thus helps target protein solubility expression; Select pET30a as cloning vector, because it is escherichia coli expression common carrier, easy to operate, research is ripe, and without any fusion tag on this carrier, if therefore desirable solubility expression can be carried out to target protein with this carrier, for late protein purifying, transformation be all very easily.Have successfully been obtained in experiment by the recon of above three kinds of plasmids as carrier, positive clone identification as shown in Figure 4, occurs that the clone of the target stripe shown in arrow is positive colony.
The abduction delivering of recombinant expression vector
According to aforesaid method, abduction delivering is carried out to the recon of having cloned.After induction, cleer and peaceful precipitation on collected by centrifugation.Carry out the SDS-PAGE electrophoresis of 15%, electrophoresis result shows, and target protein has the band of expression in the position of estimating, as shown in Figure 5.
Embodiment 2: the mensuration of lipase activity and the purifying of albumen
The mensuration of 2.1 enzyme apparent activity and specific activity:
In this research, the mensuration of lipase activity mainly adopts acid base titration, and concrete operation step is as follows:
(1) experiment reagent and instrument
Sweet oil, 0.02kg/L polyvinyl alcohol (PVA) solution, 0.05mol/L Tris-HCl pH of buffer 8.0,95% ethanol, phenolphthalein, 0.05mol/L NaOH standardized solution.
Ultrasonic Cell Disruptor, vortex oscillator, constant-temperature table, alkaline drop-burette.
(2) experimental procedure
4ml sweet oil emulsion: 3ml polyvinyl alcohol (2%W/V), 1ml mixed with olive oil, prior to vibrations mixing on mixing concussion instrument, then carries out further emulsification in Ultrasonic Cell Disruptor, until form oyster white corpus mamillare, oil, water no longer layering.
Concrete steps as shown in Figure 9.
Lipase activity unit of force is defined as: the enzyme amount that per minute catalytic substrate discharges 1 μm of ol lipid acid is 1 lipase activity unit of force (U).
Enzyme calculation formula alive:
In formula: V: the NaOH solution volume (ml) that titration sample liquid consumes
V
0: the NaOH solution volume (ml) that the blank sample of titration consumes
T: reaction times (min)
N: enzyme liquid amasss (ml)
M: the concentration (mmol/L) of the NaOH solution of titration
The concentration (mg/ml) of enzyme activity (the U/ml)/sample of the specific activity=sample of sample enzyme
The separation and purification of 2.2 protein
2.2.1 material
Bacterial strain: pET30a-RML;
Equipment: AKTA protein purification instrument;
Solidification Ni
2+chromatography column (prepacked column): be purchased from GE Healthcare Bio-Science AB (Sweden) company
Reagent; Binding buffer liquid (pH7.8):
20mmol/L sodium phosphate; 500mmol/L NaCl; 20mmol/L imidazoles
Elution buffer (pH6.0):
20mmol/L sodium phosphate; 500mmol/L NaCl; 500mmol/L imidazoles
Attention: when binding buffer liquid and elution buffer have been prepared, carry out suction filtration, and ultrasonic bubble removing
2.2.2 experimental technique:
(1) process of target protein sample to be purified
1., according to the method for aforementioned processing thalline, obtain crude enzyme liquid by ultrasonication;
2. crude enzyme liquid is sub-packed in 2ml eppendorf pipe, in the centrifugal 5-10min of 13000rpm, is separated further soluble proteins and inclusion body and cell debris;
3. collect centrifugal after supernatant liquor, use water-soluble metre filter, purification of samples;
(2) purifying band histidine-tagged protein
1. by Ni
2+be loaded on protein purification instrument;
2. with the aseptic water washing potting resin of 3 times of scapus volumes;
3. balance resin with the binding buffer liquid (pH7.8) of 3 times of column volumes;
4. by the binding buffer liquid drainage on resin to column top;
5. cell lysate supernatant is carried out upper prop, flow velocity is adjusted to 10 column volumes per hour;
6. wash post with the binding buffer liquid (pH7.8) of 6 column volumes;
7. wash post, until A280 < 0.01 with the elution buffer (pH6.0) of 4 column volumes;
8., with the 10mmol/L imidazole elution buffer elution of bound albumen of 6 column volumes, every part of 1ml distribution is collected, and detects the value of A280;
9., with greater concn imidazole elution buffer wash-out, every part of 1ml distribution is collected, and detects the value of A280;
10. the SDS-PAGE albumen collecting acquisition being carried out 12% carries out electrophoresis, analyzes the distribution of polyhistidyl tags albumen.
Result:
Recombinant protein concentration and apparent activity measure
Take bovine serum albumin as standard protein, adopt the Bradford method described in embodiment 1 to measure the concentration of recombinant protein; Adopt acid base titration, measure the apparent activity of recombinant protein.
Shown in table specific as follows:
The concentration of recombinant protein and apparent activity measure
Surveying lives compares, and the proteolytic activity adopting pET30a to express is best, and amixis label on carrier, principle is simple, therefore the final pET30a that selects is as final cloning vector.
Embodiment 3: improve lipase stereoselectivity by orthogenesis
3.1 materials and methods:
3.1.1 material
Bacterial strain: the recombinant bacterium that previous experiments has built, recombinant plasmid is pET30a-RML, and Host Strains is BL21, does the template of fallibility PCR for extracting plasmid DNA.
Toolenzyme: restriction enzyme, T4DNA quick ligase are purchased from Sangon Biotech (Shanghai) Co., Ltd.; Needed for Taq archaeal dna polymerase and supporting PCR thereof, reagent is all purchased from Promega (USA) company.
Reagent is domestic analytical pure.
Cell pyrolysis liquid: Tris-HCl damping fluid (pH8.0-pH8.5) 500ml first configuring 50mmol/L, then add magnesium chloride (its final concentration reaches 5mmol/L), N,O-Diacetylmuramidase 250mg, DNA enzymatic 1000U.
Dibromothymolsulfonphthalein and phenolsulfonphthalein indicator: the Dual-indicator concentration being made into each 0.5mg/ml with 10mM pH 8.5Tris-HCl solution.
Calcium acetate solution: join 50mM calcium acetate solution with 10mM pH 8.5Tri s-HCl solution.
Inoue transfer buffer:
The preparation of PIPES (pH6.7) [piperazine-N.N '-bis-(2-ethanesulfonic acid)] solution a.0.5mol/L: be dissolved in by 15.1gPIPES in 80ml water, adjusts pH to 6.7 with 5mol/LKOH.Finally add pure water and be settled to 100ml.(-20 DEG C of preservations), uses the metre filter of sterilising treatment in advance degerming.
B. following component is dissolved in 800ml pure water, then adds the PIPES (pH6.7) of 20ml0.5mol, add pure water and be settled to 1L:MnCl
24H
2o, 55mmol/L; CaCl
22H
2o, 15mmol/L; KCl, 250mmol/L
3.1.2 experimental technique:
3.1.2.1BL21 super competent preparation
(1) Inoue transfer buffer (with front precooling on ice) is prepared
(2) the single bacterium colony (BL21) of picking one on 37 DEG C of cultivation 16-20h flat boards.Be seeded in 250ml Erlenmeyer flask and have in 25mlLB substratum, 37 DEG C of shaking tables (250-300r/min) cultivate 6-8 hour.
(3) about 6 o'clock of evening, above-mentioned initial incubation thing is inoculated in one and fills in the 500ml Erlenmeyer flask of 125mlLB nutrient solution, first adds 500 μ l, and second adds 1ml, and the 3rd adds 2ml, in 18-22 DEG C, 200r/min incubator overnight.
(4) morning next day, the OD of three bottles of cultures is measured
600value, per half an hour surveys once, as the wherein OD of a bottle
600when value reaches 0.55, culturing bottle is placed in 20min on ice, discards another two bottles of cultures.
(5) in 4 DEG C, the centrifugal 10min of 4000r/min collects thalline.
(6) remove nutrient solution, centrifuge tube is tipped upside down on 2min on thieving paper and, to blot remaining liq, add the resuspended bacterial precipitation of Inoue transfer buffer (rotate piping and druming gently, do not use vibrator) of 40ml precooling.
(7) in 4 DEG C, the centrifugal 10min of 4000r/min collects thalline.
(8) with the resuspended bacterial precipitation of Inoue transfer buffer of 10ml precooling.
(9) add 0.75mlDMSO, gently engagement bacterial precipitation, place 10min on ice.
(10) be dispensed in the aseptic eppendorf pipe of cooling by suspension rapidly, be tamping the mouth of pipe, drop into frozen section competent cell in liquid nitrogen ,-80 DEG C for subsequent use.
3.1.2.2 the foundation of fallibility PCR and mutated library
PCR primer:
Forward primer: 5 '-CGCG
cCATGGtGCCAATCAAGAGACAATC-3 ', NcoI; (SEQ IDNO:19)
Reverse primer: 5 '-GCCG
aAGCTTaAGTACAGAGGCCTGTGT-3 ', Hi ndI I I; (SEQ IDNO:20)
PCR system: prepare 7 PCR pipe, often in pipe, PCR system is 50 μ l, wherein plasmid DNA template 1 μ l (being about 10pmol), upstream primer 1 μ l, downstream primer 1 μ l, dNTP 1 μ l, Mg
2+4l, Buffer 5 μ l, enzyme 0.5 μ l, separately adds Mn in system
2+, make its concentration reach 0mmol/L successively, 0.1mmol/L, 0.2mmol/L, 0.3mmol/L, 0.4mmol/L, 0.5mmol/L, 0.6mmol/L; All the other use ddH
2o supplies, and selects suitable Mn according to DNA gel electrophoretic image result
2+concentration.
PCR condition: denaturation, 95 DEG C, 3min, sex change, 95 DEG C, 30S; Annealing, 55 DEG C, 50S; Extend, 72 DEG C, 1min, totally 35 circulations, 72 DEG C extend 10min, 4 DEG C of insulation 30min.
By PCR primer with the agarose gel electrophoresis of 1% (W/V), with PCR purify reclaim test kit carry out purifying recovery.The enzyme that fallibility PCR primer restriction enzyme NcoI and hindIII after purifying carries out 3-4 hour 37 DEG C is cut, and connect with the same pET30a carrier cut through enzyme afterwards, method of attachment and system see above to be stated.Then will connect in the super competent cell of product conversion e. coli bl21, coat LB (containing 50mg/ml Kanamyc in) dull and stereotyped, cultivate 16-20 hour for 37 DEG C.Mutant number requires to reach about 6000-8000.
3.1.2.3RML the abduction delivering of lipase mutant
For RML lipase mutant, 96 microwell plates are adopted to express.Single bacterium colony on LB solid culture flat board being chosen one by one each hole contains in 96 orifice plates of 200 μ l LB substratum (this plate is called mother matrix), in 37 DEG C, 200r/min rotating speed cultivates 12-16 hour, then with 2% inoculum size, the bacterium liquid in hole each on motherboard is inoculated into new each hole containing in 96 hole micro plates of 500 μ lLB substratum (this plate is daughter board).Meanwhile, in motherboard, each hole adds the glycerine of 10%, preserves in order to being suitable for from now on for-80 DEG C.Meanwhile, daughter board, in 37 DEG C, is cultivated in 200r/min shaking table.Treating that the concentration of bacterium liquid in each hole reaches OD value is about 0.5, adds IPTG induction, makes its final concentration reach 0.1mmol/l.Induce after 4 hours, through centrifugal, washing after, collect thalline.Daughter board containing abduction delivering thalline put into-80 DEG C spend the night after, add the cell pyrolysis liquid of 250 μ l in each hole, be positioned over 37 DEG C of 1-2 hour, make cellular lysate.Now, due to cold and hot expansion, somatic cells wall is broken, and contained zymoprotein will discharge in a liquid.Then 4000rpm, 4 DEG C centrifugal 20 minutes, and namely target protein is dissolved in supernatant, by it 4 DEG C of preservations, for assaying reaction afterwards.
3.1.2.4 mutant is to the primary dcreening operation (high flux screening) of grease catalytic activity
Principle is as implied above.Using dibromothymolsulfonphthalein and phenolsulfonphthalein as pH indicator, it is in pH=7.5 variable color, selects this color transition point to be because this meter of black mould enzyme liquid likes weakly alkaline environment.The Dual-indicator concentration of each 0.5mg/ml is made into 10mM pH8.5Tris-HCl solution.50mM calcium acetate solution is joined with 10mM pH 8.5Tris-HCl solution.Sweet oil is dissolved in (1: 6 of about volume ratio) in dimethyl formamide.
We add expection product oleic acid and substitute sweet oil to verify the susceptibility of this method.As shown in Figure 1, wherein, when the oleic acid concentration added is 0, the color of reaction system presents mazarine to its colour-change, and along with the increase of oleic acid concentration, the color of reaction system becomes light blue gradually, green and light blue.
Reaction system on 96 orifice plates is as follows:
1. each hole adds 20 μ l indicator and 60 μ l calcium acetate solutions.In advance they can be mixed into 100 μ l mixed solutions again this mixed solution to be added in hand-hole.
2. add 100 μ l and be dissolved in sweet oil in dimethyl formamide.
3. add 20 μ l enzyme liquid.React and can be observed colour-change in 15 minutes.
This new high throughput method orthogenesis that is effective and rice black mould lipase combines and therefore obtains good dominant bacteria.
With p-NPP Measures compare, as follows by the advantage of the inventive method: the first, active large enzyme can not be distinguished by p-NPP method.A-G2 and a-G1 in Fig. 2 shows the result using p-NPP test, wherein shows, even if along with the minimizing of enzyme amount, p-NPP method can not show the graded of color.Figure b-G2 and b-G1 shows the result of the inventive method, and shown in the display of this result, the gradient of color can obviously show.The second, triglyceride level is stable, and p-NPP is easy to hydrolysis, and this hydrolysis rate affects by the extraneous factor such as temperature and solvent very much.The result drawn by the inventive method is consistent with the result of acid base titration, and not having by p-NPP method.In figure, G1 and G2 is respectively the lipase shown in SEQ ID NO:3 and 5.
3.1.2.5 mutant is to the multiple sieve of grease catalytic activity
By high flux screening, each is taken turns and chooses the active bacterial strain comparing raising compared with wild mushroom of about 20 strains, and adopt alkali titration to measure active, concrete operation step as previously mentioned.
Reaction system is:
4ml sweet oil emulsion: 3ml polyvinyl alcohol (2%W/V), 1ml mixed with olive oil, prior to vibrations mixing on mixing concussion instrument, then carries out further emulsification in Ultrasonic Cell Disruptor, until form oyster white corpus mamillare, oil, water no longer layering.
3ml Tri s-HCl damping fluid or phosphoric acid buffer (50mmol/L; PH8.5);
2ml ddH
2O，
Add 10 μ l enzyme liquid (the enzyme liquid after crude enzyme liquid and purifying have react).
Experimental result
Orthogenesis result
Fallibility PCR the results are shown in Figure 6, wherein, and swimming lane 1-7:No, 0.1mmol/L Mn
2+, 0.2mmol/LMn
2+, 0.3mmol/L Mn
2+, 0.4mmol/L Mn
2+, 0.5mmol/L Mn
2+, 0.6mmol/L Mn
2+.
As can be seen from the figure, Mn is added along with in system
2+concentration become large, the band of PCR is dimmed successively, if select Mn
2+the PCR condition that concentration is excessive, then PCR brightness is inadequate, and can not ensure mutational equilibrium, has too high sudden change, causes expressing protein activity decrease; If select Mn
2+the PCR condition that concentration is too low, then do not ensure certain mutation rate, therefore, to sum up analyze, and selects Mn
2+concentration is 0.4mmol/L is ideal abrupt concentration.
By above-mentioned primary dcreening operation and multiple sieve, the present invention screens the lipase of a series of sudden change, obtains these lipase, and check order and determination of activity to it according to method purifying mentioned above.
Determination of activity result and transgenation result as follows:
The nucleotide sequence of wild type lipase is shown in SEQ ID NO:1, and aminoacid sequence is shown in SEQ ID NO:2.
Fig. 7 shows lipase variation tendency active after orthogenesis and fixed point transformation, and wherein, apparent activity comparatively wild-type is compared, and improves 5.5 times; Specific activity comparatively wild-type is compared, and improves 6.7 times.
Claims (5)
1. an isolated polypeptide, is characterized in that, described polypeptide is selected from aminoacid sequence shown in SEQ ID NO:4,6,8,10 or 12.
2. the polynucleotide be separated, it is characterized in that, the polynucleotide of described separation are selected from:
(1) to encode the polynucleotide of polypeptide according to claim 1; With
(2) polynucleotide of the polynucleotide complementation and described in (1).
3. polynucleotide as claimed in claim 2, it is characterized in that, the nucleotide sequence of these polynucleotide is as shown in SEQ ID NO:3,5,7,9 or 11.
4. a carrier, is characterized in that, it contains the polynucleotide according to any one of claim 2-3.
5. a genetically engineered host cell, is characterized in that, described host cell contains carrier according to claim 4, or containing the polynucleotide according to any one of claim 2-3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110183303.8A CN102851263B (en) | 2011-07-01 | 2011-07-01 | High-throughout screening method of lipase gene mutation database and lipase mutation gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110183303.8A CN102851263B (en) | 2011-07-01 | 2011-07-01 | High-throughout screening method of lipase gene mutation database and lipase mutation gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102851263A CN102851263A (en) | 2013-01-02 |
| CN102851263B true CN102851263B (en) | 2015-04-01 |
Family
ID=47398242
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110183303.8A Active CN102851263B (en) | 2011-07-01 | 2011-07-01 | High-throughout screening method of lipase gene mutation database and lipase mutation gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102851263B (en) |
Families Citing this family (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102337253B (en) * | 2011-10-13 | 2017-08-22 | 浙江大学 | Polypeptide, polynucleotides, carrier and the host cell of separation |
| CN103361327B (en) * | 2013-07-19 | 2015-07-29 | 中国农业大学 | The recombinant yeast pichia pastoris of allos high expression lipase |
| EP3696264B1 (en) * | 2013-07-19 | 2023-06-28 | Danisco US Inc. | Compositions and methods comprising a lipolytic enzyme variant |
| CN103627685B (en) * | 2013-11-20 | 2015-07-01 | 华南理工大学 | Higher-activity partial glyceride lipase mutant and application thereof |
| WO2015181118A1 (en) | 2014-05-27 | 2015-12-03 | Novozymes A/S | Methods for producing lipases |
| CN104195151B (en) * | 2014-07-31 | 2016-08-24 | 江南大学 | A kind of method combining bioinformatics specificity screening rhizopus chinensis lipase gene based on full-length genome |
| CN105779418B (en) * | 2014-12-23 | 2020-07-31 | 丰益(上海)生物技术研发中心有限公司 | Novel lipase |
| CN105779415B (en) * | 2014-12-23 | 2020-07-03 | 丰益(上海)生物技术研发中心有限公司 | Novel lipase |
| CN105779417B (en) * | 2014-12-23 | 2020-07-31 | 丰益(上海)生物技术研发中心有限公司 | Novel lipase |
| CN105779412B (en) * | 2014-12-23 | 2020-07-07 | 丰益(上海)生物技术研发中心有限公司 | Novel lipase |
| CN105779414B (en) * | 2014-12-23 | 2020-07-03 | 丰益(上海)生物技术研发中心有限公司 | Novel lipase |
| CN105779413B (en) * | 2014-12-23 | 2020-07-31 | 丰益(上海)生物技术研发中心有限公司 | Novel lipase |
| CN105779416B (en) * | 2014-12-23 | 2020-07-03 | 丰益(上海)生物技术研发中心有限公司 | Novel lipase |
| CN108239648B (en) * | 2016-12-26 | 2023-04-07 | 丰益(上海)生物技术研发中心有限公司 | Method for efficiently expressing rhizomucor miehei lipase |
| CN108239626B (en) * | 2016-12-27 | 2022-10-04 | 丰益(上海)生物技术研发中心有限公司 | Lipase mutant with high esterification activity |
| CN107142273B (en) * | 2017-06-13 | 2020-11-27 | 华东理工大学 | Enzyme immobilization method and application thereof |
| CN109722422A (en) * | 2018-12-31 | 2019-05-07 | 苏州埃斯腾特生物科技有限公司 | High temperature resistant lipase and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1834236A (en) * | 2006-03-31 | 2006-09-20 | 清华大学 | Lipase A variant of wild Bacillus subtilis and application thereof |
| WO2007087508A2 (en) * | 2006-01-23 | 2007-08-02 | Novozymes A/S | Lipase variants |
-
2011
- 2011-07-01 CN CN201110183303.8A patent/CN102851263B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007087508A2 (en) * | 2006-01-23 | 2007-08-02 | Novozymes A/S | Lipase variants |
| CN1834236A (en) * | 2006-03-31 | 2006-09-20 | 清华大学 | Lipase A variant of wild Bacillus subtilis and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| Effect of mutation in non-consensus sequence Thr-X-Ser-X-Gly of Candida antarctica lipase B on lipase specificity, specific activity and thermostability;Patkar;《Journal of molecular catalysis》;19970610;第3卷(第1期);51-54 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102851263A (en) | 2013-01-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102851263B (en) | High-throughout screening method of lipase gene mutation database and lipase mutation gene | |
| WO2000047750B1 (en) | Metalloproteases of the neprilysin family | |
| CN102337253B (en) | Polypeptide, polynucleotides, carrier and the host cell of separation | |
| CN112725307A (en) | Low-temperature inulase exonuclease mutant MutG169 delta 4 with reduced heat resistance and application thereof | |
| US8153861B2 (en) | Genes for improving salt tolerance and drought tolerance of plant and the uses thereof | |
| CN103756985B (en) | Myrmecia incisa Reisigl diacylglycerol acyltransferase gene sequence and use thereof | |
| CN109280656A (en) | Recombinate muscardine Proteinase K mutant PK-M1 and preparation method | |
| EP2161331A1 (en) | Thermostable duplex-specific nuclease | |
| US11325953B2 (en) | Protein of ‘dangshan suli’ having function of promoting growth of pollen tube, encoding gene PBRTTS1 and use thereof | |
| CN102260657B (en) | Lipase gene and recombinase thereof, and application of lipase gene in preparing optically active mandelic acid | |
| CN113354745B (en) | Composition and method for large-scale production of fibroblast growth factor | |
| CN104498450A (en) | Candida rugosa lipase 1 mutant and gene | |
| CN104232611A (en) | Recombinant beauveria brongniartii proteinase K as well as industrial production and purification method thereof | |
| CN103146709A (en) | Yunnan red pear PybHLH gene as well as prokaryotic expression vector and application thereof | |
| CN109207460A (en) | Recombinate muscardine Proteinase K mutant PK-M2 and preparation method | |
| CN106834252A (en) | A kind of high stable type MazF mutant and its application | |
| CN106754816A (en) | A kind of high-fidelity rapid amplifying fusion enzyme and preparation method thereof | |
| CN102898512B (en) | Recombinant plectasin as well as preparation method and application of recombinant plectasin | |
| CN106701629B (en) | Pseudomonas fluorescens, pseudomonas fluorescens lipase LIPASEBJ10 and application thereof | |
| CN108531491A (en) | Incise edge green alga lysophosphatidate acyltransferase gene and its application | |
| CN105368802A (en) | Salt-tolerant esterase, coding gene of salt-tolerant esterase and application of salt-tolerant esterase | |
| CN105349536A (en) | Specific PCR primer for pathogenesis-related protein PR10 gene of tobacco and application thereof | |
| CN102517265B (en) | Esterase, and preparation method and application thereof | |
| CN106632683A (en) | Polypeptide having pNPPC hydrolase activity and coding gene, preparation method and application thereof | |
| CN101245345B (en) | Goat S6K1 gene cDNA encoding zone nucleotide sequence |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |