CN102827838A

CN102827838A - Flanking sequence of human serum albumin transgenic rice strain 114-7-2 and identification method of flanking sequence

Info

Publication number: CN102827838A
Application number: CN2012103130987A
Authority: CN
Inventors: 张丽丽; 黄新
Original assignee: Chinese Academy of Inspection and Quarantine CAIQ
Current assignee: Chinese Academy of Inspection and Quarantine CAIQ
Priority date: 2012-08-29
Filing date: 2012-08-29
Publication date: 2012-12-19
Anticipated expiration: 2032-08-29
Also published as: CN103484455A; CN103484455B; CN102827838B

Abstract

The invention discloses a flanking sequence of a human serum albumin transgenic rice strain 114-7-2 and an identification method of the flanking sequence. The identification method includes steps of taking genome DNA (deoxyribose nucleic acid) of rice to be tested as a template; and carrying out PCR (polymerase chain reaction) testing for the template by a specificity primer set to determine whether the rice to be tested belongs to the human serum albumin transgenic rice strain 114-7-2 or not. The primer set is prepared by a method (1) or (2), the method (1) includes respectively designing a forward primer and a reverse primer in the primer set according to bits from No.1 to No.379 and bits from No.380 to No.525 in a sequence 1, and the method (2) includes respectively designing a forward primer and a reverse primer in the primer set according to bits from No.1 to No.533 and bits from No.534 to No.785 in a sequence 2. As shown in experiments, the method for identifying whether the rice to be tested belongs to the human serum albumin transgenic rice strain 114-7-2 or not is high in accuracy, specificity and sensitivity and short in consumed time, and accordingly safety of transgene is guaranteed.

Description

Change flanking sequence and the authentication method thereof of human serum albumin rice strain 114-7-2

Technical field

The present invention relates to flanking sequence and the authentication method thereof of a kind of hsa of commentaries on classics genetic expression human serum protein rice strain 114-7-2; Be specifically related to be used to identify or whether assistant identification paddy rice to be measured is the right method of design of primer of changeing human serum albumin rice strain 114-7-2; Change the authentication method of human serum albumin rice strain 114-7-2, and change human serum albumin rice strain 114-7-2 external source and insert segmental flanking sequence.

Background technology

Paddy rice is one of most important food crop of the China and even the whole world, is edible in the world farm crop most populous, with the longest history.Along with development of biology, transgenic technology just is being widely used in the farm crop modification, wherein China's approved in 2009 safety certificate of transgenic paddy rice Bt63.At present, also having a plurality of transgenic strains to get into environment discharges and the industrial experimentation stage.

Changeing human serum albumin rice strain 114-7-2 is the proteoplast that is utilized rice-embryo milk cell by professor Yang Daichang of Wuhan University; Adopt rice endosperm specific property expression promoter and signal peptide; The mediation RHA gets into the endomembrane system of rice-embryo milk cell; And be stored in the proteoplast of paddy endosperm, thereby the transgenic paddy rice strain that RHA can be accumulated in rice paddy seed in a large number, the foreign gene that imports is human serum albumin (HSA).Change human serum albumin rice strain 114-7-2 as an efficient protein matter expression technology platform; Can be used to express the protein or the polypeptide that comprise medicine, foodstuff additive, beauty treatment, nutrition and various uses such as industrial; Making the industrial fermentation mode of production of traditional protein drug become the agriculture prodn mode produces; Have promotional value and application prospect highly, can produce huge economy and social effect.

Receiving the current society that more and more widely pays close attention in genetically modified organism safety, is the effective means that basic transgenic detection method has become supervision transgenic plant and food with the biotechnology.Real-time fluorescence PCR (Real time PCR) is exactly one of them the most frequently used effective means.Real-time fluorescence PCR is on conventional PCR basis, to add fluorescence labeling probe, realizes starting template quantitatively and is qualitatively analyzed through the real-time detection to each circulation products fluorescent signal in the pcr amplification reaction, has high specific and highly sensitive advantage.

The transgenic plant exogenous insertion vector flanking sequence that at present partial monopoly and bibliographical information arranged; For example: people such as Peng Yufa utilized the gene step to move with the LD-PCR methods analyst rich No. 6 external source of rice strain section and insert segmental flanking sequence in 2007, set up the rich No. 6 strain specificity detection method of transgenic paddy rice section.Yet, in analysis, find also have no the article and the patent report that insert segmental flanking sequence about the external source of changeing hsa genetic expression human serum protein rice strain 114-7-2 to existing patent and document.

Summary of the invention

An object of the present invention is to provide a kind of identify or whether assistant identification paddy rice to be measured is the right method of design of PCR primer of changeing human serum albumin rice strain 114-7-2.

Provided by the present invention identify or whether assistant identification paddy rice to be measured is the right method of design of PCR primer of changeing human serum albumin rice strain 114-7-2 is (1) or (2) as follows:

(1) designs the forward primer of said primer centering according to the 1-379 position of sequence in the sequence table 2, design the reverse primer of said primer centering according to the 380-525 position of sequence in the sequence table 2;

(2) design the forward primer of said primer centering according to the 1-533 position of sequence in the sequence table 1, design the reverse primer of said primer centering according to the 534-785 position of sequence in the sequence table 1.

Wherein, sequence 1 is respectively two flanking sequences that change human serum albumin rice strain 114-7-2 with sequence 2.Sequence 1 is for being positioned at the distolateral wing sequence of 5' on rice genome the 5th karyomit(e); Total length 785bp; Preceding 533bp is rice genome sequence fragment (the 2496104-2496636 position of GenBank:NC008398), and back 252bp is a T-DNARBS sequence fragment on the conversion carrier.Sequence 2 is for being positioned at the distolateral wing sequence of 5' on rice genome the 4th karyomit(e); Total length 525bp; Preceding 379bp is rice genome sequence fragment (the 30911165-30911543 position of GenBank:NC008397), and back 146bp is a T-DNARBS sequence fragment on the conversion carrier.

Another object of the present invention provides a kind of detection or whether auxiliary detection paddy rice to be measured is the method for changeing human serum albumin rice strain 114-7-2.

This method comprises the steps: that the genomic dna with said paddy rice to be measured is a template; The utilization primer that design obtains according to aforesaid method (promptly identify or whether assistant identification paddy rice to be measured is the right method of design of PCR primer of changeing human serum albumin rice strain 114-7-2) detects carrying out PCR, thereby confirms whether said paddy rice to be measured is to change human serum albumin rice strain 114-7-2.

In one embodiment of the invention, said primer is to specifically being made up of sequence in the sequence table 3 and two single strand dnas shown in the sequence 4.

Wherein, sequence 3 is made up of 17 Nucleotide; Sequence 4 is made up of 20 Nucleotide.

For the accuracy that increases qualification result, sensitivity etc., said PCR can be real-time fluorescence PCR.

The probe that said real-time fluorescence PCR adopted can be the TaqMan fluorescent probe, and in the present invention, the nucleotide sequence of said probe is specifically shown in sequence in the sequence table 5.

Wherein, sequence 5 is made up of 21 Nucleotide.

The TaqMan fluorescent probe is a kind of oligonucleotide probe, and the report fluorophor is connected 5 ' end of probe, and the cancellation fluorophor is connected 3 ' end of probe.When adding a pair of primer, add a specific fluorescent probe during pcr amplification, when probe was complete, the reporter group fluorescent signal emitted was absorbed by quenching group; During pcr amplification; The 5'-3' 5 prime excision enzyme activity of Taq enzyme is cut degraded with probe enzyme; The report fluorophor is separated with the cancellation fluorophor, thereby the fluorescence monitoring system can receive fluorescent signal, DNA chain of promptly every amplification; Just there is a fluorescence molecule to form, realized that the accumulation of fluorescent signal and PCR product form fully synchronously.

Said report fluorophor can be Fam (FAM), Hex (HEX), Tet (TET), Joe (JOE), Vic (VIC), Fite (FITE), Cy3 (CY3) or Cy5 (CY5).Said cancellation fluorophor can be Tamra (TAMRA), Rox (ROX), Dabcy (DABCY), Bhq1 (BHQ1) or Bhq2 (BHQ2).In the present invention, the report fluorophor of said probe 5 ' end mark is specially the FAM fluorophor, and the cancellation fluorophor of 3 ' end mark is specially the TAMRA fluorophor.

In the PCR system of said real-time fluorescence PCR, two primers of said primer centering and the mol ratio of said probe can be 2:2:1.

In one embodiment of the invention, when reacting initial, the concentration of two primers of said primer centering is 0.2 μ mol/L, and the concentration of said probe is 0.1 μ mol/L.

The annealing temperature of said real-time fluorescence PCR can be 60 ℃.

In one embodiment of the invention, the reaction parameter of said real-time fluorescence PCR is specific as follows: 50 ℃ of 2min; 95 ℃ of 10min; 95 ℃ of 5s, 60 ℃ of 1min, totally 40 circulations.

A further object of the present invention provides commentaries on classics human serum albumin rice strain 114-7-2 external source and inserts segmental flanking sequence.

The nucleotide sequence that commentaries on classics human serum albumin rice strain 114-7-2 external source provided by the present invention is inserted segmental flanking sequence is specially sequence 1 or sequence 2 in the sequence table.

Utilize that aforesaid method (identify or whether assistant identification paddy rice to be measured is the right method of design of PCR primer of changeing human serum albumin rice strain 114-7-2) design obtains identify or whether assistant identification paddy rice to be measured is that the PCR primer that changes human serum albumin rice strain 114-7-2 also belongs to protection scope of the present invention to method.

The experiment proof; The present invention is through the method for real-time fluorescence PCR; It is right with the primer shown in the sequence 4 that utilization obtains by sequence in the sequence table 3 according to the flanking sequence design of changeing hsa genetic expression human serum protein rice strain 114-7-2; And the probe shown in the sequence 5 whether can detect paddy rice to be measured be to change hsa genetic expression human serum protein rice strain 114-7-2, and this method accuracy rate height, high specificity, weak point highly sensitive, consuming time.This provides assurance for transgenic safety.

Description of drawings

Fig. 1 is a HSA expression casette collection of illustrative plates.

Fig. 2 detects the strain specificity result for real-time fluorescence PCR.Wherein, △ Rn is the stdn result (△ Rn=Rn – baseline) who obtains behind the Rn deduction baseline.Rn (Normalized reporter) is the ratio of fluorescent emission intensity of fluorescent emission intensity and the reference dyestuff of fluorescence report group.Lines represent to change human serum albumin rice strain 114-7-2 shown in the mark 1.

Fig. 3 detects the sensitivity experiment result who changes human serum albumin rice strain 114-7-2 for real-time fluorescence PCR.

Embodiment

Employed experimental technique is ordinary method like no specified otherwise among the following embodiment.

Used material, reagent etc. like no specified otherwise, all can obtain from commercial sources among the following embodiment.

Change HSA trans-genetic hybrid rice (GMO+), promptly change human serum albumin rice strain 114-7-2:Large-scale production of functional human serum albumin from transgenic rice seeds.Proceedings of the National Academy of Sciences 10.1073/pnas.1109736108.

The non-transgenic paddy rice Taibei 309 (GMO-): paddy rice prolamine 4a gene promoter specific expressed in transgenic paddy rice. Journal of Agricultural Biotechnology, JOURNAL OF AGRICULTURAL BIOTECHNOLOGY, 1999 03 phases.

Transgenic Fructus Lycopersici esculenti " China kind No. 1 ": Huang Wen wins the precious beam Zhu Shui virtue of the Chen Hongyun Zhao Wen Chen Ying of army Xu. and transgenic is prolonged the strain specificity detection method [J] of border tribes who are assimilated to Han Chinese eggplant " China kind No. ". Plant Quarantine, 2005, (6): 321-324.

Transgenic paddy rice " Kemingdao ": the structure of phytase gene qualitative PCR detection method and positive plasmid molecule. Acta Agronomica Sinica ACTA AGRONOMICA SINICA 2012,38 (4): 639-647.ISSN 0496-3490.

Transgenic paddy rice " rich No. 6 of section ": the structure of phytase gene qualitative PCR detection method and positive plasmid molecule. Acta Agronomica Sinica ACTA AGRONOMICA SINICA 2012,38 (4): 639-647.ISSN 0496-3490.

Transgenic paddy rice " extensive No. 1 of China ": Transgenic Bt Rice is to biocenological Sichuan Agricultural University's journal 2003,21 (2): the 185-186 that influences in rice field

Transgenic paddy rice Bt63: the structure of phytase gene qualitative PCR detection method and positive plasmid molecule. Acta Agronomica Sinica ACTA AGRONOMICA SINICA 2012,38 (4): 639-647.ISSN 0496-3490.

Soil of transgenic Bt cotton: change content and the expression of each organ toxalbumin of Bt Insect Resistant Cotton. Journal of Agricultural Biotechnology, 2002 the 3rd phases.

Transgenic corns MON810: the structure of phytase gene qualitative PCR detection method and positive plasmid molecule. Acta Agronomica Sinica ACTA AGRONOMICA SINICA 2012,38 (4): 639-647.ISSN 0496-3490.

Transgenic corns MON88017: the structure of phytase gene qualitative PCR detection method and positive plasmid molecule. Acta Agronomica Sinica ACTAAGRONOMICA SINICA 2012,38 (4): 639-647.ISSN 0496-3490.

Transgenic corns NK603: the structure of phytase gene qualitative PCR detection method and positive plasmid molecule. Acta Agronomica Sinica ACTAAGRONOMICA SINICA 2012,38 (4): 639-647.ISSN 0496-3490.

The external source of embodiment 1, commentaries on classics human serum albumin rice strain 114-7-2 is inserted the clone of fragment flanking sequence

One, experiment material

1, vegetable material

Transgenic paddy rice: change HSA trans-genetic hybrid rice (GMO+), promptly change human serum albumin rice strain 114-7-2, the conversion carrier of this transgenic paddy rice contains HSA expression casette as shown in Figure 1.

Conventional rice: the non-transgenic paddy rice Taibei 309 (GMO-).

2, enzyme and reagent

Fluorescent quantitation ABIMIx reagent is available from ABI company, other molecular biology reagent, like Extaq archaeal dna polymerase, DL2000Marker available from the precious biotinylated biomolecule in Dalian Engineering Co., Ltd.Other biochemical reagents are import packing or homemade analytical pure.Primer is given birth to worker Bioisystech Co., Ltd by Shanghai and is synthesized.

3, laboratory apparatus

Pcr amplification appearance: Veriti ^TM96 hole grads PCR appearance (ABI company)

Nucleic acid electrophoresis apparatus: DYY-III type nucleic acid electrophoresis apparatus (Liuyi Instruments Plant, Beijing)

Other Instruments comprises: whizzer, electronic balance, incubator etc.

Two, experimental technique

1, plant genome DNA extracts and detects

(1) process for extracting of DNA of plants

A gets the about 0.1g of transgenic paddy rice (or conventional rice) blade in mortar, adds liquid nitrogen and is ground to Powdered rapidly.

B is transferred to prior adding 700 μ l CTAB damping fluid (CTAB 15g rapidly with the blade powder; 1M TrisCl (pH 8.0) 75ml; 0.5M EDTA 30ml; NaCl 61.4g; DdH ₂O supplies 1000ml) the 2ml centrifuge tube in, gently behind the mixing, 65 ℃ of water bath heat preservations 30 minutes.Every mixing that carefully rocked at a distance from ten minutes.

C takes out centrifuge tube, waits to be chilled to (25 ℃) after the room temperature, adds the phenol/chloroform (being each 350 μ l of phenol and chloroform) of 700 μ l equal-volume ratios.The thorough mixing that turns upside down, extracting 5 minutes.

Under the d room temperature, centrifugal 10 minutes of 12000rpm transfers to supernatant in another new centrifuge tube with the 1ml rifle head that cuts off head, adds 2 μ l RNaseA (10mg/ml).

E adds and the isopyknic chloroform of supernatant (700 μ l), the thorough mixing that turns upside down, extracting 5 minutes.

Under the f room temperature, centrifugal 10 minutes of 12000rpm draws supernatant in another new centrifuge tube.

G adds isopyknic Virahol (700 μ l), abundant mixing, and normal temperature is placed visible precipitate after 10 minutes.For precipitating fully, can place 1-2 hour at-20 ℃.

Under the h room temperature, centrifugal 10 minutes of 12000rpm, the heavy pipe end that is deposited on.Abandon most supernatant.

I adds 700 μ l 70% (volumn concentration) aqueous ethanolic solutions and cleaned 30 minutes.

J removes the aqueous ethanolic solution in the centrifuge tube, DNA is deposited in the pipe dries naturally.

K adds an amount of TE (50 μ l) dissolving, puts into-20 ℃ of refrigerators and preserves subsequent use.

(2) DNA detection

Get the dna solution that 5 μ l steps (1) are extracted, the agarose gel electrophoresis with 0.8% comes the preliminary quality of extracting DNA of judging according to its brightness and banding pattern.Adopt ultraviolet spectrophotometer to measure concentration and the purity of the DNA that is extracted.

2, the acquisition of the flanking sequence of the exogenous insertion vector of commentaries on classics human serum albumin rice strain 114-7-2

This research adopts the method separation of Genome walking to obtain changeing two 5' end flanking sequences of human serum albumin rice strain 114-7-2.Genome walking is a kind of method of the known array side zone of ignorance sequence that increases, and (TaKaRa Code:D316) explains that main operational steps is following with reference to Genome walking test kit:

(1) design specific primers

According to known T-DNA RBS sequence; Utilize Primer 5 softwares to design three respectively in the same way and the higher Auele Specific Primer (SP Primer) of annealing temperature: SP1, SP2 and SP3; The position of SP2 is in the inboard of SP1; SP3 is positioned at the inboard of SP2, and it is synthetic to serve sea living worker Bioisystech Co., Ltd, sees table 1.

Table 1 special primer sequence relevant information

The primer title	Primer sequence (5 ' 3 ')	Primer length (bp)	Annealing temperature (Tm)
				SP1	CGTTACCCAACTTAATCGCCTTGC	24	66.3
SP2	CTCCTTCAACGTTGCGGTTCTGT	23	65.4
				SP3	AACGTGACTCCCTTAATTCTCCGC	24	65.1

(2) the 1st take turns the PCR reaction

The AP Primer that provides with test kit (any one among four kinds of the AP1-AP4, below for AP1 be example) as upstream primer, SP1 Primer is a downstream primer, carries out 1st PCR reaction.

Reaction system is seen table 2, in the PCR reaction tubes, adds reaction reagent successively by table 2, at the centrifugal 10s of desk centrifuge.

Table 2 the 1st is taken turns the PCR reaction system

Response procedures is following:

Reaction finishes the back and takes out the PCR reaction tubes, and the PCR reaction product is carried out electrophoresis detection, or for use 4 ℃ of preservations.

The electrophoretic detection of PCR product is following: the 0.8g agarose is added in 1 * TAE damping fluid of 100ml, heating is its dissolving, is mixed with concentration and is 0.8% agarose solution; Add SYBR Green I solution in the ratio that adds 5 μ l SYBR Green I solution in every 100ml agarose solution then, mixing is after the right slightly cooling; Be poured on the electrophoresis plate, plug pecten, be frozen into gel under the room temperature after; Put into 1 * TAE damping fluid, take out pecten gently vertically upward.The PCR product of drawing 5 μ l be added in the gel swimming lane after an amount of sample loading buffer mixes, a swimming lane adds dna molecular amount standard therein, carries out electrophoresis.After electrophoresis finishes, take out sepharose, place lightly on the gel imaging appearance and form images.If the PCR product is the disperse shape, carry out follow-up reaction.

(3) the 2nd take turns the PCR reaction

After taking turns 100 times of PCR reaction solution dilutions with the 1st; Get 1 μ l as the 2nd take turns PCR reaction template, with the 1st take turns the PCR reacting phase with AP Primer (is example with AP1) be upstream primer, SP2Primer is a downstream primer; Carry out the 2nd and take turns the PCR reaction, reaction system is seen table 3.

Table 3 the 2nd is taken turns the PCR reaction system

Response procedures is following:

Reaction finishes the back and takes out the PCR reaction tubes, and the PCR reaction product is carried out electrophoresis detection or for use 4 ℃ of preservations.

The same step of the electrophoretic detection of PCR product (2) is said.If the PCR product is disperse shape band, carry out follow-up reaction.

(4) the 3rd take turns the PCR reaction

After taking turns 100 times of PCR reaction solution dilutions with the 2nd; Get 1 μ l as the 3rd take turns PCR reaction template, with the 1st take turns the PCR reacting phase with AP Primer (is example with AP1) be upstream primer, SP3 Primer is a downstream primer; Carry out the 3rd and take turns PCR reaction, reaction system such as table 4.

Table 4 the 3rd is taken turns the PCR reaction system

Response procedures is following:

The same step of the electrophoretic detection of PCR product (2) is said.The result shows to have only the 3rd of AP1 primer to take turns the PCR product and be clear electrophoretic band, cuts glue and reclaims.

(5) sequence order-checking and analysis

The PCR product recovery test kit of employing day root company reclaims the 3rd and takes turns pcr amplification product, is connected on the PMD18 carrier (TaKaRa company), and transformed into escherichia coli is delivered to the big genome company of China with the positive colony that obtains and checked order.Adopt the sequence and the carrier sequence similarity of DNA Star (ver 5.01) and BioXM (ver 2.6) comparison and assay determination, the similar rice genome sequence of retrieval in ncbi database (http://www.ncbi.nlm.nib.gov/).

Three, experimental result

Two external sources that adopt Genome walking amplification to obtain commentaries on classics human serum albumin rice strain 114-7-2 are inserted segmental flanking sequence.

1, is positioned at the distolateral wing sequence of 5' on the 5th karyomit(e)

Be positioned at the distolateral wing sequence of the 5' total length 785bp on the 5th karyomit(e), its nucleotide sequence is shown in sequence in the sequence table 1.The distolateral wing sequence of this 5' is made up of T-DNA RBS sequence fragment (252bp) two portions on rice genome sequence fragment (533bp) and the conversion carrier.Concrete, the 1-533 position of sequence 1 is the rice genome sequence (the 2496104-2496636 position of GenBank:NC008398) that said rice genome sequence fragment is; The 534-785 position of sequence 1 is a T-DNA RBS sequence fragment on the said conversion carrier.

2, be positioned at the distolateral wing sequence of 5' on the 4th karyomit(e)

Be arranged in its nucleotide sequence of the distolateral wing sequence of 5' total length 525bp on the 4th karyomit(e) shown in sequence table sequence 2.The distolateral wing sequence of this 5' is made up of T-DNA RBS sequence fragment (146bp) two portions on rice genome sequence fragment (379bp) and the conversion carrier.Concrete, the 1-379 position of sequence 2 is the rice genome sequence (the 30911165-30911543 position of GenBank:NC008397) that said rice genome sequence fragment is; The 380-525 position of sequence 2 is a T-DNA RBS sequence fragment on the said conversion carrier.

Embodiment 2, identify that whether paddy rice to be measured is the primer design of changeing human serum albumin rice strain 114-7-2

The external source of the commentaries on classics human serum albumin rice strain 114-7-2 that present embodiment will obtain according to embodiment 1 insert segmental flanking sequence be designed for identify or assistant identification paddy rice to be measured whether to be that the specific PCR that changes human serum albumin rice strain 114-7-2 detects primer right, its method of design can be as follows (1) or (2):

(1) designs the forward primer of said primer centering according to the 1-379 position of sequence in the sequence table 1, design the reverse primer of said primer centering according to the 380-525 position of sequence in the sequence table 1;

(2) design the forward primer of said primer centering according to the 1-533 position of sequence in the sequence table 2, design the reverse primer of said primer centering according to the 534-785 position of sequence in the sequence table 2.

According to above-mentioned (2) described method of design; Promptly to being positioned at the distolateral wing sequence of 5' on the 4th karyomit(e); Sequence 2 designs, be used to as follows to identify or assistant identification paddy rice to be measured whether to be that the specific PCR that changes human serum albumin rice strain 114-7-2 detects primer right:

HSA-F (forward): 5 '-CCGACGCGGAGGAAGAC-3 ' (sequence 3) (sequence of the 348-364 position of sequence 2)

HSAR (oppositely): 5 '-CGTTTCCCGCCTTCAGTTTA-3 ' (sequence 4) (reverse complementary sequence of the 396-415 position of sequence 2)

In addition, according to above-mentioned designed primer (HSA-F and HSA-R) design is obtained following probe (TaqMan probe):

HSA – P:5 '-CGGAGGCGGCGTCAAACACTG-3 ' (sequence 5) (the 369-389 position of sequence 2)

5 ' the end of probe HSA-P is with report fluorophor FAM mark, and 3 ' end is with cancellation fluorophor TAMRA mark.

The primer of embodiment 3, embodiment 2 to the specific detection of probe

The primer that obtains with embodiment 2 changes human serum albumin rice strain 114-7-2, the non-transgenic paddy rice Taibei 309 (GMO-), transgenic Fructus Lycopersici esculenti " China kind No. 1 ", transgenic paddy rice Bt63, soil of transgenic Bt cotton, transgenic paddy rice " Kemingdao ", transgenic paddy rice " rich No. 6 of section ", transgenic paddy rice " extensive No. 1 of China ", transgenic corns MON810, transgenic corns MON88017 and transgenic corns NK603 to detecting respectively with probe, with the checking primer to the specificity of probe.The detection method that each samples using is identical comprises extraction and two steps of real-time fluorescence PCR of the total DNA of sample.

One, the extraction of sample total DNA

With embodiment 1 two 1 (1).

Two, real-time fluorescence PCR

Total DNA of each sample that obtains with step 1 respectively is that template is carried out real-time fluorescence PCR.

Real-time fluorescence PCR reaction system: 12.5 μ l ABI TaqMan Gene Expression Master Mix (ABI company), 5 μ l dna profilings, 5 μ l sterilization ultrapure water, 1 μ l forward primer (HSA-F), 1 μ l reverse primer (HSA-R) and 0.5 μ l probe (HSA-P) are mixed, obtain the reaction system of 25 μ l; In the reaction system, when reacting initial, the concentration of upstream and downstream primer is 0.2 μ mol/L, and the concentration of probe is 0.1 μ mol/L.

Real-time fluorescence PCR reaction parameter: 50 ℃ of 2min; 95 ℃ of 10min; 95 ℃ of 15s, 60 ℃ of 1min, totally 40 circulations.

Reaction finishes the back according to the amplification curve result of determination.

The result is as shown in Figure 2, and having only changes human serum albumin rice strain 114-7-2 fluorescent signal is arranged, and equal no signal in other samples, shows that primer that embodiment 2 obtains is to having stronger specificity with probe.

The primer of embodiment 4, embodiment 2 to probe sensitivity detect

With the seed powder that changes the HSA trans-genetic hybrid rice (GMO+) and the non-transgenic paddy rice Taibei 309 (GMO-) is the examination material; Both are mixed; The biased sample to be measured that HSA trans-genetic hybrid rice (GMO+) seed powder weight percent is followed successively by 5%, 1%, 0.5%, 0.1% and 0.01% (W/W) is changeed in preparation; Extracting total DNA of 5 biased samples to be measured respectively, is template with the total DNA of 20ng, and the primer that obtains with embodiment 2 reacts carrying out real-time fluorescence PCR with probe.The detection method that each samples using is identical.Real-time fluorescence PCR reaction system and reaction parameter are with embodiment 3 step 2.

The result is as shown in Figure 3, and it is 0.01% biased sample that the method for stating can detect the weight percent that changes HSA trans-genetic hybrid rice (GMO+) at least, shows that primer that embodiment 2 obtains is to having higher sensitivity with probe.

Claims

1. identify or whether assistant identification paddy rice to be measured is the right method of design of PCR primer of changeing human serum albumin rice strain 114-7-2, be (1) or (2) as follows:

2. whether detection or auxiliary detection paddy rice to be measured are the method for changeing human serum albumin rice strain 114-7-2; Comprise the steps: that the genomic dna with said paddy rice to be measured is a template; The utilization primer that said method design obtains according to claim 1 detects carrying out PCR, thereby confirms whether said paddy rice to be measured is to change human serum albumin rice strain 114-7-2.

3. method according to claim 2 is characterized in that: said primer is to being made up of sequence in the sequence table 3 and two single strand dnas shown in the sequence 4.

4. according to claim 2 or 3 described methods, it is characterized in that: said PCR is a real-time fluorescence PCR.

5. method according to claim 4, it is characterized in that: the nucleotide sequence of the probe that said real-time fluorescence PCR adopted is shown in sequence in the sequence table 5.

6. method according to claim 5 is characterized in that: 5 ' end of said probe is marked with the FAM fluorophor, and 3 ' end is marked with the TAMRA fluorophor.

7. according to arbitrary described method among the claim 4-6, it is characterized in that: in the PCR system of said real-time fluorescence PCR, two primers of said primer centering and the mol ratio of said probe are 2:2:1.

8. according to arbitrary described method among the claim 4-7, it is characterized in that: the annealing temperature of said real-time fluorescence PCR is 60 ℃.

9. change human serum albumin rice strain 114-7-2 external source and insert segmental flanking sequence, its nucleotides sequence is classified sequence 1 or the sequence 2 in the sequence table as.

10. utilize that the design of the said method of claim 1 obtains identify or whether assistant identification paddy rice to be measured is that to change the PCR primer of human serum albumin rice strain 114-7-2 right.