CN108660195A - Functional nucleic acid rapid PCR methods and kit for the identification of MSTN gene knock-out pigs - Google Patents
Functional nucleic acid rapid PCR methods and kit for the identification of MSTN gene knock-out pigs Download PDFInfo
- Publication number
- CN108660195A CN108660195A CN201810421781.XA CN201810421781A CN108660195A CN 108660195 A CN108660195 A CN 108660195A CN 201810421781 A CN201810421781 A CN 201810421781A CN 108660195 A CN108660195 A CN 108660195A
- Authority
- CN
- China
- Prior art keywords
- primer
- mstn
- seq
- pcr
- pig
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to transgenic biological material transgenic composition detection fields, are related to the functional nucleic acid rapid PCR methods identified for MSTN gene knock-out pigs and kit.Special primer is designed according to gene knockout site, different specific fragments is gone out for different amplified alleles, realizes the detection to MSTN gene knock-out pigs.1 sequence of PCR primer combination such as SEQ ID NO:3 and SEQ ID NO:4, obtain SEQ ID NO:1 amplified fragments；Primer combination 2 such as SEQ ID NO:5 and SEQ ID NO:Shown in 4, SEQ ID NO are obtained:2 amplified fragments.When amplified production only has a 290bp band to be determined as wild type, an only 268bp band is determined as that MSTN gene knockouts are homozygous, while the band containing 268bp and 290bp is determined as MSTN gene knockout heterozygous.Also disclose kit configuration and its application.
Description
Technical field
The invention belongs to the detection technique fields of transgenic biological material transgenic ingredient, and in particular to be used for MSTN bases
Because of the functional nucleic acid rapid PCR methods and kit of knock-out pig identification.
Background technology
With the continuous formation of transgenosis new varieties, the genetically modified organism for being transferred to foreign gene is constantly subjected to social query,
So that the popularization of genetically modified organism is difficult.In order to eliminate the psychology that consumer contradicts foreign gene, turn base at present
Because the development direction of biology has shifted towards the research of endogenous gene knockout, gene knockout is by making target gene inactivate, to real
Now to the accurate modification of genome.And it is current to become to be identified Gene Knock-Out Animal Model and establish easily detection method
Gesture.
MSTN (Myostatin) gene (GenBank accession number：NM_214435) i.e. myostatin gene, is also named
Growth and differentiation factor (Growth differentiation factor 8) gene can be pressed down by regulating and controlling sarcoblast
Muscle growth processed.The missing or inactivation of animal MSTN genes can be with positive regulation myocyte quantity, the diameter sum numbers of muscle fibre
Amount, shows as double-muscling shape (Marraffini LA, Sontheimer EJ.CRISPR interference limits
horizontal gene transfer in staphy-lococci by targeting DNA[J].science,2008,
322(5909):1843-1845.).And the MSTN genes of pig are knocked out using gene editing technology, it is beneficial to improve pig
The speed of growth and lean meat percentage have important research significance and application prospect to the development of pig breeding industry.And functional nucleic acid be for
The nucleic acid molecules of detection.
There are I endonuclease enzyme process of T7E, Surveyor endonuclease enzyme process for the detection method of gene knockout biology at present
And DNA sequencing method.T7E I and Surveyor endonuclease enzyme process are capable of detecting when existing for gene knockout biology full-length genome
It misses the target site, but it is not high for the detection efficiency of gene knockout result, it is struck especially for single or a small number of bases
Except the case where cannot effectively detect.DNA sequencing method is prefered method in gene knockout detection, and generally acknowledged goldstandard
Method, but experimental cost is high.Therefore, it how effectively, accurately and rapidly to detect whether as Gene Knock-Out Animal Model, and establishes
A kind of simple and practicable detection method has become current research focus.
Invention content
It is an object of the invention to overcome the deficiencies of existing technologies, a kind of detection MSTN genes (GenBank logins are provided
Number：NM_214435) the PCR primer and kit of knock-out pig.
The present invention designs special primer according to gene knockout site, goes out for different amplified alleles different special
Property segment, to realize detection and identification to MSTN gene knock-out pigs.The PCR primer is respectively such as SEQ ID NO:3、
SEQ ID NO:(the piece of amplification such as SEQ ID NO shown in 4:Shown in 1) and SEQ ID NO:4 and SEQ ID NO:5 (amplifications
Segment such as SEQ ID NO:Shown in 2).
The kit of the present invention includes PCR primer, reaction reagent and the positive control dna mould of MSTN gene knock-out pigs
Plate, negative control DNA profiling and distilled water.Using PCR amplification, can be determined whether to be MSTN gene knock-out pigs, wild type pig or
MSTN gene knockout heterozygous pigs.
In terms of the kit of the present invention can be additionally used in pig MSTN Genotypings.
Specifically, the present invention uses following technical scheme：
The present invention according to gene knockout site, designs 2 different forward primers and a shared reverse primer first；
A wherein forward primer terminates at corresponding knockout site AG bases for wild type detection design, 3 ' ends
Place, and design (GCTTATCTATAGCATTGAAG) in 5 ' end addition 20bp functional nucleic acid connectors；Another forward direction is drawn
Object re-extends into CT bases for knockout type detection design, 3 ' ends of the primer across after knocking out site AG bases；In turn
Reach through PCR amplification, realizes the detection fast and convenient to gene knock-out pig and genotype.
The creativeness of the present invention is：The sample of three kinds of genotype can be identified by a PCR, and primer
Design is also different from Standard PCR design of primers, since sample is the knockout of a small number of bases (i.e. bis- bases of AG), passes through routine
The amplification of PCR primer cannot effectively distinguish MSTN gene knockout heterozygous pigs after electrophoresis.So applicant draws in design
It is added to the functional nucleic acid sequence of one section of 20bp at the 5 ' ends of MSTN-W-F first when object, MSTN-W-F's and MSTN-KO-F
3 ' ends are also innovated, and the 3 ' ends of MSTN-W-F, which terminate at, to be knocked out on base AG, and MSTN-KO-F is across knocking out base AG
Two base CT are extended downwardly, while MSTN-W-F and MSTN-KO-F shares a reverse primer, in PCR amplification three
Primer is added in the same PCR reaction systems is expanded simultaneously.Due to the sample to be tested of different genotype, different primers
Role is different, makes the sample there are two base difference that can also be expanded by regular-PCR in this way, then can be with by general electrophoresis
Clearly band is distinguished.
Agarose gel electrophoresis presentation can be used in testing result in the present invention, can also be examined by sequencing or other effective ways
It surveys.Wherein, the method for extraction sample gene group DNA can refer to conventional phenol-chloroform extraction.
Whether the kit that the present invention assembles can be contains MSTN gene knockout type pigs and wild type in Rapid identification sample
(non-transgenic) pig ingredient, in addition primer of the invention combination can also carry out Classification Identification to the genotype of pig.
The method of the present invention can be used for transgenic animals detection, the identification of transgene component.The reagent that the present invention assembles
Box can be used for quick, specifically detection transgenic animals, the identification of transgene component and the screening of non-transgenic material.
Description of the drawings
SEQ ID NO:1 is the nucleotide sequence of wild type measuring samples amplified fragments.Sequence length is 290bp；
SEQ ID NO:2 be the nucleotide sequence of gene knockout type measuring samples amplified fragments.Sequence length is 268bp；
SEQ ID NO:3 be the sequence of the forward primer MSTN-WT-F of the primer pair in detection method and kit
Row.
SEQ ID NO:4 be the sequence of the reverse primer MSTN-R of primer pair in detection method and kit.
SEQ ID NO:5 be the forward primer MSTN-KO-F of another primer pair in detection method and kit
Sequence.
Fig. 1：Testing result of the method for the present invention in different type measuring samples.Reference sign：Fig. 1 respectively with
The homozygous pig genomic DNA of wild type pig genomic DNA, MSTN gene knockouts and MSTN gene knockout heterozygous pig genomes
DNA is the result that template carries out PCR amplification respectively.A band can only be amplified when template is wild type pig genomic DNA
(290bp)；A band (268bp) can only be also amplified when template is MSTN gene knockouts type (homozygous) pig genomic DNA,
And the band is smaller 22bp than the band for the sample that wild type is template；When template is MSTN gene knockouts type (heterozygous)
When pig genomic DNA it is amplifiable go out two bands, respectively 290bp and 268bp, and the size of this two band respectively with wild type and
Homozygous band is identical.Number is described as follows in swimming lane：M：MarkerⅠ；1：Blank control；2：Wild type pig；3：MSTN bases
Because knocking out homozygous pig；4：MSTN gene knockout heterozygous pigs.
Specific implementation mode
The design of primers of 1 MSTN gene knock-out pig detection methods of embodiment
A kind of PCR primer design method of detection MSTN gene knock-out pig ingredients is applicant provided, according to knockout site
Design 2 different forward primer (SEQ ID NO:3, i.e. forward primer 1 and SEQ ID NO:5, i.e. forward primer 2) and share
A reverse primer (i.e. SEQ ID NO:4).It is the forward direction for detecting wild primer to have one in above-mentioned forward primer
The sequence of primer such as SEQ ID NO:Shown in 3,3 ' ends of the primer terminate at corresponding knockout site (SEQ ID NO:The 42 of 3
At two bases of 43AG)；Another forward primer is for knockout type detection design, the sequence of the forward primer
Such as SEQ ID NO:Shown in 5,3 ' ends of the primer, which are crossed over, knocks out site (that is, SEQ ID NO:42 and 43AG, two alkali of 3 sequences
It carries out extending two base (i.e. SEQ ID NO again after Ji Chu):At 5 22 and 23CT, two bases).Applicant is for wild
5 ' ends of the forward primer of type pig detection carry out functional nucleic acid connector design, that is, add the random sequence of 20bp
(GCTTATCTATAGCATTGAAG), to make wild type pig and the amplified fragments size of knockout type pig have differences, reach logical
PCR amplification is crossed, MSTN gene knock-out pigs, wild type pig and MSTN clpp gene heterozygosis piglings is enable to amplify different size segment,
Realize the detection fast and convenient to gene knock-out pig.
A kind of PCR primer of MSTN gene knock-out pigs is applicant provided, the nucleotide sequence of the primer is as follows：
Forward primer MSTN-WT-F：5′-GCTTATCTATAGCATTGAAGCCCTCTAACTGTGGATTTTGAAG-3′；
Forward primer MSTN-KO-F：5′-CCCTCTAACTGTGGATTTTGACT-3′；
Reverse primer MSTN-R：5′-CACCCACAGCGATCTACTACCA-3′；
The PCR primer length of above-mentioned detection MSTN gene knock-out pigs is generally 22~43bp, and the design of primer needs to consider
Whether the various aspects such as mispairing, expanding fragment length, reaction temperature are easy to happen.
Above-mentioned primer can specifically identify MSTN gene knock-out pigs, wild type pig and its Genotyping of pig.
For ease of use, above-mentioned primer and related reagent can be assembled into convenient applicable kit.The examination
Agent box is assembled according to following configuration：
(1) PCR primer
Forward primer MSTN-WT-F：5′-GCTTATCTATAGCATTGAAGCCCTCTAACTGTGGATTTTGAAG-3′；
Forward primer MSTN-KO-F：5′-CCCTCTAACTGTGGATTTTGACT-3′；
Reverse primer MSTN-R：5′-CACCCACAGCGATCTACTACCA-3′；
(2) related reagent
10 × PCR Buffe, dNTP Mix, Taq polymerase, positive control dna template, negative control DNA profiling, double steamings
Water (blank control).
Positive control dna template is MSTN gene knock-out pig homozygous gene group DNA, and negative control DNA profiling is wild
Type pig (i.e. non-transgenic pig) genomic DNA；
The primer and kit of the present invention can be applied in MSTN gene knock-out pigs, wild type pig and Genotyping.
Applicant provide a kind of PCR detection method suitable for MSTN gene knock-out pigs comprising following steps：
(1) pig genomic DNA is extracted according to a conventional method；
(2) forward primer MSTN-WT-F (SEQ ID NO are used:3), forward primer MSTN-KO-F (SEQ ID NO:5) and
Reverse primer MSTN-R (SEQ ID NO:4) PCR amplification is carried out to MSTN genes, with the homozygous pig DNA mould of MSTN gene knockouts
Plate is positive control, using wild type (non-transgenic) pig DNA template as negative control, using distilled water as blank control.
(3) pcr amplification product and result judgement are detected.
The reaction system of PCR amplification such as table 1.
The reaction system of 1 PCR amplification of table
PCR response procedures：
94 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, 65 DEG C of annealing 30s, 72 DEG C extend 30s, 35 cycles；72 DEG C of ends prolong
Stretch 5min, 4 DEG C of cooling 2min.
Result judgement：When PCR reaction products contain and an only amplified fragments (268bp) and with positive control expand piece
Duan great little is identical, and when blank control is without amplified production, it can determine that and detect MSTN gene knock-out pig ingredients in sample, determining should
Genotype is homozygous.When contain in PCR reaction products and an only amplified fragments (290bp) and with negative control expand piece
Duan great little is identical, and when blank control is without amplified production, judge not detecting MSTN gene knock-out pig ingredients in sample, determining should
Genotype is wild type (i.e. non-transgenic).When in PCR reaction products contain two amplified fragments (that is, 268bp and 290bp),
And the size of two amplified fragments is identical as positive control and negative control amplified fragments size respectively, and blank control is without amplification
When product, then judge to detect MSTN gene knock-out pig ingredients in sample, genotype is to knock out heterozygous.If positive or cloudy
Property sample in do not detect expected segment, illustrate seminal plasma fructose detection kit failure or operating method error.If blank control and the positive
Sample or negative sample detect expected segment, illustrate reagent contamination or the operating method error of kit.
Detection of the 2 MSTN gene knock-out pigs detection method of embodiment in different type sample.
One, the preparation and preservation of sample
1, it samples
Pig (plum mountain pig is conventional variety) all product of ear are acquired, are saved backup at -20 DEG C.
It is prepared by DNA profiling：
DNA profiling is prepared using common phenol chloroform thick formulation (Pehanorm Brooker J, not Ritchie E F, Manny A Disi
T. the golden winter wild geese of Molecular Cloning:A Laboratory guide [M] second editions, Beijing Li Meng maple, Science Press, 1999,465-467) or it is public
Other conventional extractions recognizing, with identical effect.
Two, design of primers
The primer sequence of the present embodiment is as shown in table 2.
The PCR amplification primer of 2 embodiment 1 of table
It is expected that amplified fragments size can be obtained：The amplified fragments size of wild type pig template is 290bp, MSTN gene knockouts
The amplified fragments of the homozygous pig template of type are 268bp, and the heterozygous template pig amplified fragments of MSTN gene knockout types are two
Size segment, respectively 290bp and 268bp.
Experiments have shown that method of the invention and its primer combine high specificity, it can specificity in different types of template
Ground amplifies expected target fragment, and sensitivity is higher.It is evaluated from economical and resultant effect, with the primer sets in table 2
It is combined into best primer combination.
Three, PCR is detected
(1) sample PCR reacts
1) reaction reagent (being shown in Table 1), mixing are sequentially added in PCR reaction tubes, then 25 μ L paraffin oils is added (to have hot lid equipment
PCR instrument can be not added with).
2) by PCR pipe, the 000g of 500g~3 centrifuge 10s on centrifuge, then take out PCR pipe, are put into PCR instrument.
3) PCR reactions are carried out.Program：94 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, 65 DEG C of annealing 30s, 72 DEG C extend
30s carries out 35 cycles altogether；72 DEG C extend 5min, 4 DEG C of cooling 2min eventually.
4) PCR pipe is taken out after reaction, and electrophoresis detection is carried out to PCR reaction products.
(2) control PCR reactions
1) while sample PCR reacts, setting blank control, negative control and positive control.Each control PCR reactants
In system, remaining outer component of removing template and PCR reaction conditions are identical as (1), and negative, positive control dna template concentrations should also reach
To the requirement of sample DNA template concentration.
2) using wild type pig genomic DNA as the negative control template of PCR reaction systems.
3) using the homozygous pig DNA of MSTN gene knockouts as the positive control template of PCR reaction systems.
4) using distilled water as the blank control template of PCR reaction systems.
The detection of four .PCR amplified productions and result judgement
Agarose is weighed by the mass concentration of 25g/L, is added in 1 × TAE buffer solutions, dissolves by heating, is configured to agarose
Solution.5 μ L ethidium bromides (EB) solution are added in per 100mL agarose solutions, mixing is poured into after slightly cooling down on electrophoresis plate,
Pecten is plugged, after being frozen into gel at room temperature, is placed in 1 × TAE buffer solutions, gently takes out pecten vertically upward.Take 3 μ L
PCR product and 1 μ L sample loading buffer (preparation methods：250.0mg bromophenol blues are weighed, 10mL water is added, dissolves 1h at room temperature；
250.0mg xylene nitrile blue FF are weighed, 10mL water dissolutions are added；50.0g sucrose is weighed, 30mL water dissolutions are added.Mix three of the above
Solution adds water to be settled to 100mL, is preserved at 4 DEG C) gel loading wells is added after mixing, while in a wherein loading wells
DNA molecular amount standard is added, powers on and is detected after 2~3h of electrophoresis under the conditions of 2V/cm~5V/cm.
After electrophoresis, Ago-Gel is taken out, is placed in gel imager or is imaged on ultraviolet transilluminator.According to DNA
Molecular weight standard judges the size of amplified band, and electrophoresis result is formed electronic document archive or is taken pictures with photographic system.
Five, interpretation of result and statement
1, control test interpretation of result
In the PCR reactions of positive control, sample is expanded, and amplified fragments are 268bp, and is amplified in negative control
The band of 290bp shows that PCR amplification system works normally without any amplified fragments in addition to primer dimer in blank control.
Otherwise, it detects again.
2, sample detection interpretation of result and statement
(1) if sample has and an only amplified fragments and amplified fragments size are 268bp, show to detect in sample
It is homozygous to be measured as knockout through genotyping for MSTN gene knockout ingredients.
(2) if it is 268bp and 290bp that sample, which has two amplified fragments and amplified fragments size, show to detect in sample
MSTN gene knock-out pig ingredients, through being measured as knockout heterozygous in genotyping.
(3) if sample has and an only amplified fragments and amplified fragments size are 290bp, show not detect in sample
MSTN gene knockout ingredients, through being measured as wild type in genotyping.
(4) if sample does not have amplified fragments or amplified fragments size and expected clip size inconsistent, show in sample not
Detect MSTN gene knockout ingredients.
The assembling of 3 kit of embodiment
The assembling of kit：
Forward primer MSTN-WT-F (SEQ ID NO:3)；MSTN-KO-F(SEQ ID NO:4)；
Reverse primer MSTN-R (SEQ ID NO:5)；
10×PCR Buffer；
dNTP Mix；
Taq archaeal dna polymerases；
Positive control dna template (the homozygous pig DNA template of MSTN gene knockouts)；
Negative control DNA profiling (wild type pig DNA profiling)；
Distilled water.
The term of validity of this kit stores 12 months at -20 DEG C, does not influence using effect.
The application process of kit：
It is loaded according to PCR reaction systems below, is managed in the EP of 200 μ L, be shown in Table 3.
The PCR reaction systems of 3 embodiment 2 of table
10 × PCR Buffer, dNTP Mix and Taq archaeal dna polymerases are purchased from TaKaPa.10 × PCR Buffer are to be
By the MgCl needed for PCR reactions2And reaction buffer is pre-configured to the mixture of 10 times of concentration.
2. the PCR amplification condition loading according to embodiment 1
3. taking 3 μ L pcr amplification products, 2.50% agarose gel electrophoresis (technical parameter after reaction：2V/cm~
5V/cm, 2~3h of electrophoresis), it is dyed with ethidium bromide (EB), gel imaging system testing result.
Blank control, positive control and negative control need to be arranged in each reaction, and reaction system and amplification condition are the same as by test sample
Product.
Sequence table
<110>Hua Zhong Agriculture University
<120>Functional nucleic acid rapid PCR methods and kit for the identification of MSTN gene knock-out pigs
<141> 2018-05-04
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 290
<212> DNA
<213>Pig (Sus scrofa)
<220>
<221> gene
<222> (1)..(290)
<400> 1
gcttatctat agcattgaag ccctctaact gtggattttg aagcttttgg atgggactgg 60
attattgcac ccaaaagata taaggccaat tactgctctg gagagtgtga atttgtattt 120
ttacaaaaat accctcacac tcatcttgtg caccaagcaa accccagagg ttcagcaggc 180
ccctgctgta ctcccacaaa gatgtctcca atcaatatgc tatattttaa tggcaaagaa 240
caaataatat atgggaaaat tccagccatg gtagtagatc gctgtgggtg 290
<210> 2
<211> 268
<212> DNA
<213>Pig (Sus scrofa)
<220>
<221> gene
<222> (1)..(268)
<400> 2
ccctctaact gtggattttg acttttggat gggactggat tattgcaccc aaaagatata 60
aggccaatta ctgctctgga gagtgtgaat ttgtattttt acaaaaatac cctcacactc 120
atcttgtgca ccaagcaaac cccagaggtt cagcaggccc ctgctgtact cccacaaaga 180
tgtctccaat caatatgcta tattttaatg gcaaagaaca aataatatat gggaaaattc 240
cagccatggt agtagatcgc tgtgggtg 268
<210> 3
<211> 43
<212> DNA
<213>Pig (Sus scrofa)
<220>
<221> primer_bind
<222> (1)..(43)
<400> 3
gcttatctat agcattgaag ccctctaact gtggattttg aag 43
<210> 4
<211> 22
<212> DNA
<213>Pig (Sus scrofa)
<220>
<221> primer_bind
<222> (1)..(22)
<400> 4
cacccacagc gatctactac ca 22
<210> 5
<211> 23
<212> DNA
<213>Pig (Sus scrofa)
<220>
<221> primer_bind
<222> (1)..(23)
<400> 5
ccctctaact gtggattttg act 23
Claims (3)
1. a kind of PCR method of detection MSTN gene knock-out pig ingredients, feature includes, according to gene knockout site, designing 2
Different forward primers and a shared reverse primer；A wherein forward primer is drawing for wild type detection
Object, the sequence such as SEQ ID NO of the forward primer:Shown in 3,3 ' ends of the primer terminate at corresponding knockout site, i.e. SEQ
ID NO:At the 42nd of sequence shown in 3 and the 43rd two bases of AG；Another forward primer is for knockout
The primer of type detection, the sequence such as SEQ ID NO of the forward primer:Shown in 5,3 ' ends of the primer, which are crossed over, knocks out site, i.e. SEQ
ID NO:Two bases, i.e. SEQ ID NO are re-extended after at the 42nd of sequence shown in 3 and the 43rd two bases of AG:5 institutes
Show the 22nd and the 23rd two bases of CT of sequence；Function is carried out for 5 ' ends of the forward primer detected for wild type
Nucleic acid linker designs, i.e., the functional nucleic acid sequence in 5 ' end addition 20bp of forward primer, the sequence are
GCTTATCTATAGCATTGAAG makes the primer of wild type and the amplified fragments size of the primer of knockout type difference occur, passes through
PCR amplification enables MSTN genes to be knocked pig, wild type pig and its heterozygosis pigling and amplifies different size of segment, realization pair
The fast and convenient detection of gene knock-out pig.
2. a kind of PCR primer of detection MSTN gene knock-out pig ingredients, feature include being combined to target base using following primer
Because carrying out PCR amplification：
Primer combination 1：
Forward primer MSTN-WT-F：GCTTATCTATAGCATTGAAGCCCTCTAACTGTGGATTTTGAAG；
Reverse primer MSTN-R：CACCCACAGCGATCTACTACCA；
It obtains such as sequence table SEQ ID NO:The amplified fragments of sequence shown in 1；
With
Primer combination 2：
Forward primer MSTN-KO-F：CCCTCTAACTGTGGATTTTGACT；
Reverse primer MSTN-R：CACCCACAGCGATCTACTACCA；
It obtains such as sequence table SEQ ID NO:The amplified fragments of sequence shown in 2.
3. a kind of kit of detection MSTN gene knock-out pigs, feature includes that the kit is according to following configuration：
(1) PCR primer：
Forward primer MSTN-WT-F：GCTTATCTATAGCATTGAAGCCCTCTAACTGTGGATTTTGAAG；
Forward primer MSTN-KO-F：CCCTCTAACTGTGGATTTTGACT；
Reverse primer MSTN-R：CACCCACAGCGATCTACTACCA；
(2) related reagent：
10 × PCR Buffer, dNTP Mix, Taq polymerase, positive control dna template, negative control DNA profiling, blank pair
According to distilled water；
After PCR amplification, genotype is identified according to gained band, if the band of a 290bp can be amplified, is determined as open country
Raw type；If the band of a 268bp can be amplified, it is determined as the homozygous of MSTN gene knockouts；If 290bp can be amplified simultaneously
With two band of 268bp, it is determined as heterozygous.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810421781.XA CN108660195A (en) | 2018-05-04 | 2018-05-04 | Functional nucleic acid rapid PCR methods and kit for the identification of MSTN gene knock-out pigs |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810421781.XA CN108660195A (en) | 2018-05-04 | 2018-05-04 | Functional nucleic acid rapid PCR methods and kit for the identification of MSTN gene knock-out pigs |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108660195A true CN108660195A (en) | 2018-10-16 |
Family
ID=63780729
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810421781.XA Pending CN108660195A (en) | 2018-05-04 | 2018-05-04 | Functional nucleic acid rapid PCR methods and kit for the identification of MSTN gene knock-out pigs |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108660195A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111235223A (en) * | 2020-02-18 | 2020-06-05 | 华中农业大学 | Primer and test strip detection method for small fragment deletion typing detection |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101955996A (en) * | 2010-06-29 | 2011-01-26 | 西北农林科技大学 | Method for detecting single base Indel mutation |
| CN103088044A (en) * | 2011-11-02 | 2013-05-08 | 内蒙古大学 | Targeting vector for knockout of bovine MSTN gene and application thereof |
| CN103184266A (en) * | 2011-12-28 | 2013-07-03 | 协和干细胞基因工程有限公司 | APOE gene detection kit, amplification method and detection method |
| CN104059877A (en) * | 2014-06-27 | 2014-09-24 | 中国农业科学院北京畜牧兽医研究所 | Method for preparing 'imitated Belgian blue cattle' myostatin (MSTN) genetype gene editing pig |
| TW201510225A (en) * | 2013-08-16 | 2015-03-16 | Pei-Hwa Wang | Identification for carcass traits in pigs |
| CN106011258A (en) * | 2016-06-22 | 2016-10-12 | 海南波莲水稻基因科技有限公司 | Molecular marker for rice seed peel color gene Pb and application of molecular marker |
| CN107058516A (en) * | 2017-03-09 | 2017-08-18 | 海南波莲水稻基因科技有限公司 | The molecular labeling of wide gene GW2 of rice grain a kind of and its application |
-
2018
- 2018-05-04 CN CN201810421781.XA patent/CN108660195A/en active Pending
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101955996A (en) * | 2010-06-29 | 2011-01-26 | 西北农林科技大学 | Method for detecting single base Indel mutation |
| CN103088044A (en) * | 2011-11-02 | 2013-05-08 | 内蒙古大学 | Targeting vector for knockout of bovine MSTN gene and application thereof |
| CN103184266A (en) * | 2011-12-28 | 2013-07-03 | 协和干细胞基因工程有限公司 | APOE gene detection kit, amplification method and detection method |
| TW201510225A (en) * | 2013-08-16 | 2015-03-16 | Pei-Hwa Wang | Identification for carcass traits in pigs |
| CN104059877A (en) * | 2014-06-27 | 2014-09-24 | 中国农业科学院北京畜牧兽医研究所 | Method for preparing 'imitated Belgian blue cattle' myostatin (MSTN) genetype gene editing pig |
| CN106011258A (en) * | 2016-06-22 | 2016-10-12 | 海南波莲水稻基因科技有限公司 | Molecular marker for rice seed peel color gene Pb and application of molecular marker |
| CN107058516A (en) * | 2017-03-09 | 2017-08-18 | 海南波莲水稻基因科技有限公司 | The molecular labeling of wide gene GW2 of rice grain a kind of and its application |
Non-Patent Citations (2)
| Title |
|---|
| A.-M. LINDEN ET AL.: ""Anxiolytic-like activity of the mGLU2/3 receptor agonist LY354740 in the elevated plus maze test is disrupted in metabotropic glutamate receptor 2 and 3 knock-out mice"", 《PSYCHOPHARMACOLOGY》 * |
| 苏秋菊等: ""MSTN 基因编辑牛的鉴定及基因分型新方法"", 《生物技术通报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111235223A (en) * | 2020-02-18 | 2020-06-05 | 华中农业大学 | Primer and test strip detection method for small fragment deletion typing detection |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106282394A (en) | The method of high throughput testing Semen Maydis south rust resistance gene type and test kit thereof | |
| CN107400720B (en) | Method for detecting growth traits of cattle under assistance of KLF3 gene CNV marker and special kit thereof | |
| CN108754000A (en) | Drug resistant gene mcr-4/5/8 fluorescent quantitative PCR detection methods | |
| CN110408716A (en) | Containing there are many DNA standard sample of internal standard gene specific segment and its applications | |
| CN104862312A (en) | Primer pair for screening mammalian experiment animal SNP (Single Nucleotide Polymorphism) markers and application thereof | |
| CN110923333B (en) | Haplotype marker related to lambing number in first intron of goat ZBP1 gene and application thereof | |
| CN101824411A (en) | Flanking sequence of transgenic rice Kefeng No. 6 and qualitative PCR detection method | |
| CN107988385B (en) | Method for detecting marker of PLAG1 gene Indel of beef cattle and special kit thereof | |
| CN108456743B (en) | SNP (Single nucleotide polymorphism) marker related to flowering period and mature period of soybean as well as detection primer, method and application thereof | |
| CN101921852B (en) | Method for detecting single nucleotide polymorphism of cattle AdPLA gene | |
| CN102296110A (en) | Method for detecting mononucleotide polymorphism of FGF 21 gene of yellow cattle | |
| CN106367498B (en) | Periplaneta americana microsatellite loci and application thereof | |
| CN108660195A (en) | Functional nucleic acid rapid PCR methods and kit for the identification of MSTN gene knock-out pigs | |
| CN107022646A (en) | Primer sets, kit and method for detecting cotton MON1445 transformant | |
| CN102827936A (en) | Composition and reagent kid for testing human serum albumin transgenic rice strain 114-7-2 | |
| CN112430675B (en) | Method for identifying anti-cysticercosis trait of bee colony by using SNP marker KZ 288474.1-322717 | |
| CN112410441B (en) | Method for identifying character of bee colony for resisting saccular larva disease by utilizing SNP marker KZ288479.1_95621 | |
| CN101812450B (en) | Auxiliary identification method of chickens with different weight characters and special primers thereof | |
| CN105543362B (en) | Detection method and molecular breeding method for single nucleotide polymorphism of cattle PPAR β gene | |
| CN104498509B (en) | HMG1 gene and application of HMG1 gene in silkworm microsporidia molecular detection | |
| CN102086475A (en) | Method for detecting drift treatment of target gene | |
| KR101736670B1 (en) | Primer sets for identification of Phalaenopsis and composition of marker comprising the same | |
| CN110592237A (en) | Primer, probe, kit and detection method for detecting weight traits of white geese in east Zhejiang province | |
| CN102199599B (en) | Specific detection target sequences of transgenic tomato, plasmid molecule and its detection kit thereof | |
| CN109055575A (en) | A kind of SNP marker for the identification of Larimichthys crocea group |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181016 |