CN102827838B - Flanking sequence of human serum albumin transgenic rice strain 114-7-2 and identification method of flanking sequence - Google Patents
Flanking sequence of human serum albumin transgenic rice strain 114-7-2 and identification method of flanking sequence Download PDFInfo
- Publication number
- CN102827838B CN102827838B CN201210313098.7A CN201210313098A CN102827838B CN 102827838 B CN102827838 B CN 102827838B CN 201210313098 A CN201210313098 A CN 201210313098A CN 102827838 B CN102827838 B CN 102827838B
- Authority
- CN
- China
- Prior art keywords
- sequence
- rice
- human serum
- serum albumin
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a flanking sequence of a human serum albumin transgenic rice strain 114-7-2 and an identification method of the flanking sequence. The identification method includes steps of taking genome DNA (deoxyribose nucleic acid) of rice to be tested as a template; and carrying out PCR (polymerase chain reaction) testing for the template by a specificity primer set to determine whether the rice to be tested belongs to the human serum albumin transgenic rice strain 114-7-2 or not. The primer set is prepared by a method (1) or (2), the method (1) includes respectively designing a forward primer and a reverse primer in the primer set according to bits from No.1 to No.379 and bits from No.380 to No.525 in a sequence 1, and the method (2) includes respectively designing a forward primer and a reverse primer in the primer set according to bits from No.1 to No.533 and bits from No.534 to No.785 in a sequence 2. As shown in experiments, the method for identifying whether the rice to be tested belongs to the human serum albumin transgenic rice strain 114-7-2 or not is high in accuracy, specificity and sensitivity and short in consumed time, and accordingly safety of transgene is guaranteed.
Description
Technical field
The present invention relates to flanking sequence and the authentication method thereof of a kind of hsa of turning genetic expression human serum protein rice strain 114-7-2, be specifically related to for the identification of or assistant identification paddy rice to be measured whether be the method for design that turns the primer pair of human serum albumin rice strain 114-7-2, turn the authentication method of human serum albumin rice strain 114-7-2, and the flanking sequence that turns human serum albumin rice strain 114-7-2 external source Insert Fragment.
Background technology
Paddy rice is one of most important food crop of China and even the whole world, is to eat in the world farm crop most populous, with the longest history.Along with the development of biotechnology, transgenic technology is just being widely used in farm crop modification, wherein China's approved in 2009 safety certificate of transgenic paddy rice Bt63.At present, also have a plurality of transgenic strains entered environment discharge and the industrial experimentation stage.
Turn the proteoplast that human serum albumin rice strain 114-7-2 Shi You professor Yang Daichang of Wuhan University utilizes rice-embryo milk cell, the promotor and the signal peptide that adopt rice endosperm specific to express, mediation recombination human serum albumin enters the endomembrane system of rice-embryo milk cell, and be stored in the proteoplast of paddy endosperm, thereby the transgenic paddy rice strain that recombination human serum albumin can be accumulated in a large number in rice paddy seed, the foreign gene that imports is human serum albumin (HSA).Turn human serum albumin rice strain 114-7-2 as an efficient protein matter expression technology platform, can be for expressing protein or the polypeptide comprise medicine, foodstuff additive, beauty treatment, nutrition and the various uses such as industrial, make the industrial fermentation mode of production of traditional protein drug become mode of agriculture production, there is promotional value and application prospect highly, can produce huge economy and social effect.
At genetically modified organism, be subject to safely the more and more society of extensive concern, the biotechnology of take has become the effective means of supervision transgenic plant and food as basic transgenic detection method.Real-time fluorescence PCR (Real time PCR) is exactly one of them the most frequently used effective means.Real-time fluorescence PCR is to add fluorescence labeling probe on conventional PCR basis, by the real-time detection of each circulation products fluorescent signal in pcr amplification reaction is realized starting template quantitatively and is qualitatively analyzed, has high specific and highly sensitive advantage.
The transgenic plant exogenous insertion vector flanking sequence that had partial monopoly and bibliographical information at present, such as: people such as the Peng Yufa flanking sequence of external source Insert Fragment of rich No. 6 of rice strain section that utilized gene walking and LD-PCR methods analyst in 2007, set up the event-specific detection method of rich No. 6 of transgenic paddy rice section.Yet, in to the analysis of existing patent and document, find, also without any about turning article and the patent report of flanking sequence of the external source Insert Fragment of hsa genetic expression human serum protein rice strain 114-7-2.
Summary of the invention
An object of the present invention is to provide a kind of identify or whether assistant identification paddy rice to be measured is the method for design that turns the PCR primer pair of human serum albumin rice strain 114-7-2.
Provided by the present invention identify or whether assistant identification paddy rice to be measured is the method for design that turns the PCR primer pair of human serum albumin rice strain 114-7-2 is following (1) or (2):
(1) according to the 1-379 position of sequence in sequence table 2, design the forward primer in described primer pair, according to the 380-525 position of sequence in sequence table 2, design the reverse primer in described primer pair;
(2) according to the 1-533 position of sequence in sequence table 1, design the forward primer in described primer pair, according to the 534-785 position of sequence in sequence table 1, design the reverse primer in described primer pair.
Wherein, sequence 1 and sequence 2 are respectively two flanking sequences that turn human serum albumin rice strain 114-7-2.Sequence 1 is for being positioned at the 5' end flanking sequence on rice genome the 5th karyomit(e), total length 785bp, front 533bp is rice genome sequence fragment (the 2496104-2496636 position of GenBank:NC008398), and rear 252bp is T-DNARBS sequence fragment on conversion carrier.Sequence 2 is for being positioned at the 5' end flanking sequence on rice genome the 4th karyomit(e), total length 525bp, front 379bp is rice genome sequence fragment (the 30911165-30911543 position of GenBank:NC008397), and rear 146bp is T-DNARBS sequence fragment on conversion carrier.
Another object of the present invention is to provide a kind of detection or whether auxiliary detection paddy rice to be measured is the method that turns human serum albumin rice strain 114-7-2.
The method comprises the steps: to take that the genomic dna of described paddy rice to be measured is template, the utilization primer pair that design obtains according to aforesaid method (identify or whether assistant identification paddy rice to be measured is the method for design that turns the PCR primer pair of human serum albumin rice strain 114-7-2) carries out PCR detection, thereby determines that whether described paddy rice to be measured is for turning human serum albumin rice strain 114-7-2.
In one embodiment of the invention, described primer pair specifically in sequence table two single strand dnas shown in sequence 3 and sequence 4 form.
Wherein, sequence 3 is comprised of 17 Nucleotide; Sequence 4 is comprised of 20 Nucleotide.
In order to increase accuracy, sensitivity of qualification result etc., described PCR can be real-time fluorescence PCR.
The probe that described real-time fluorescence PCR adopts can be TaqMan fluorescent probe, and in the present invention, the nucleotide sequence of described probe is specifically as shown in sequence in sequence table 5.
Wherein, sequence 5 is comprised of 21 Nucleotide.
TaqMan fluorescent probe is a kind of oligonucleotide probe, and report fluorophor is connected to 5 ' end of probe, and cancellation fluorophor is connected to 3 ' end of probe.During pcr amplification, when adding pair of primers, add a specific fluorescent probe, when probe is complete, the fluorescent signal of reporter group transmitting is quenched group and absorbs; During pcr amplification, the 5'-3' 5 prime excision enzyme activity of Taq enzyme is cut degraded by probe enzyme, make to report that fluorophor is separated with cancellation fluorophor, thereby fluorescence monitoring system can receive fluorescent signal, it is DNA chain of every amplification, just have a fluorescence molecule to form, accumulation and the PCR product of having realized fluorescent signal form Complete Synchronization.
Described report fluorophor can be Fam(FAM), Hex (HEX), Tet (TET), Joe (JOE), Vic (VIC), Fite (FITE), Cy3 (CY3) or Cy5 (CY5).Described cancellation fluorophor can be Tamra(TAMRA), Rox (ROX), Dabcy (DABCY), Bhq1 (BHQ1) or Bhq2 (BHQ2).In the present invention, the report fluorophor of described probe 5 ' end mark is specially FAM fluorophor, and the cancellation fluorophor of 3 ' end mark is specially TAMRA fluorophor.
In the PCR system of described real-time fluorescence PCR, two primers in described primer pair and the mol ratio of described probe can be 2:2:1.
In one embodiment of the invention, while reacting initial, the concentration of two primers in described primer pair is 0.2 μ mol/L, and the concentration of described probe is 0.1 μ mol/L.
The annealing temperature of described real-time fluorescence PCR can be 60 ℃.
In one embodiment of the invention, the reaction parameter of described real-time fluorescence PCR is specific as follows: 50 ℃ of 2min; 95 ℃ of 10min; 95 ℃ of 5s, 60 ℃ of 1min, totally 40 circulations.
A further object of the present invention is to provide the flanking sequence that turns human serum albumin rice strain 114-7-2 external source Insert Fragment.
The nucleotide sequence that turns the flanking sequence of human serum albumin rice strain 114-7-2 external source Insert Fragment provided by the present invention is specially sequence 1 or the sequence 2 in sequence table.
Wherein, sequence 1 and sequence 2 are respectively two flanking sequences that turn human serum albumin rice strain 114-7-2.Sequence 1 is for being positioned at the 5' end flanking sequence on rice genome the 5th karyomit(e), total length 785bp, front 533bp is rice genome sequence fragment (the 2496104-2496636 position of GenBank:NC008398), and rear 252bp is T-DNARBS sequence fragment on conversion carrier.Sequence 2 is for being positioned at the 5' end flanking sequence on rice genome the 4th karyomit(e), total length 525bp, front 379bp is rice genome sequence fragment (the 30911165-30911543 position of GenBank:NC008397), and rear 146bp is T-DNARBS sequence fragment on conversion carrier.
Utilize that aforesaid method (identify or whether assistant identification paddy rice to be measured is the method for design that turns the PCR primer pair of human serum albumin rice strain 114-7-2) design obtains identify or whether assistant identification paddy rice to be measured is that the PCR primer pair method that turns human serum albumin rice strain 114-7-2 also belongs to protection scope of the present invention.
Experimental results show that, the present invention is by the method for real-time fluorescence PCR, utilize according to the flanking sequence design that turns hsa genetic expression human serum protein rice strain 114-7-2 and obtain the primer pair shown in sequence 3 and sequence 4 in sequence table, and whether the probe shown in sequence 5 can detect paddy rice to be measured for turning hsa genetic expression human serum protein rice strain 114-7-2, and the method accuracy rate is high, high specificity, highly sensitive, consuming time short.This provides assurance for Transgene-safty.
Accompanying drawing explanation
Fig. 1 is HSA expression casette collection of illustrative plates.
Fig. 2 is that real-time fluorescence PCR detects strain specificity result.Wherein, △ Rn is the stdn result (△ Rn=Rn – baseline) obtaining after Rn deduction baseline.Rn(Normalized reporter) be the ratio of the fluorescent emission intensity of fluorescence report group and the fluorescent emission intensity of reference dyestuff.Shown in mark 1, lines represent to turn human serum albumin rice strain 114-7-2.
Fig. 3 is that real-time fluorescence PCR detects the sensitivity experiment result that turns human serum albumin rice strain 114-7-2.
Embodiment
The experimental technique using in following embodiment if no special instructions, is ordinary method.
In following embodiment, material used, reagent etc., if no special instructions, all can obtain from commercial channels.
Turn HSA trans-genetic hybrid rice (GMO+), turn human serum albumin rice strain 114-7-2:Large-scale production of functional human serum albumin from transgenic rice seeds.Proceedings of the National Academy of Sciences 10.1073/pnas.1109736108.
Non-transgenic paddy rice Taibei 309(GMO-): specific expressed in transgenic paddy rice of Rice Prolamines 4a gene promoter. Journal of Agricultural Biotechnology, JOURNAL OF AGRICULTURAL BIOTECHNOLOGY, 03 phase in 1999.
Transgenic Fructus Lycopersici esculenti " China kind No. 1 ": the precious beam Zhu Shui virtue of the Huang Wen victory Chen Hongyun Zhao Wen Chen Ying of army Xu. transgenosis is prolonged the event-specific detection method [J] of border tribes who are assimilated to Han Chinese eggplant " Bioscein ". Plant Quarantine, 2005, (6): 321-324.
Transgenic paddy rice " Kemingdao ": the structure of phytase gene qualitative PCR detection method and positive plasmid molecule. Acta Agronomica Sinica ACTA AGRONOMICA SINICA 2012,38 (4): 639-647.ISSN 0496-3490.
Transgenic paddy rice " rich No. 6 of section ": the structure of phytase gene qualitative PCR detection method and positive plasmid molecule. Acta Agronomica Sinica ACTA AGRONOMICA SINICA 2012,38 (4): 639-647.ISSN 0496-3490.
Transgenic paddy rice " extensive No. 1 of China ": Transgenic Bt Rice is on biocenological Sichuan Agricultural University's journal 2003,21 (2): the 185-186 that affects in rice field
Transgenic paddy rice Bt63: the structure of phytase gene qualitative PCR detection method and positive plasmid molecule. Acta Agronomica Sinica ACTA AGRONOMICA SINICA 2012,38 (4): 639-647.ISSN 0496-3490.
Soil of transgenic Bt cotton: turn content and the expression of each organ toxalbumin of Bt Insect Resistant Cotton. Journal of Agricultural Biotechnology, the 3rd phase in 2002.
Transgenic corns MON810: the structure of phytase gene qualitative PCR detection method and positive plasmid molecule. Acta Agronomica Sinica ACTA AGRONOMICA SINICA 2012,38 (4): 639-647.ISSN 0496-3490.
Transgenic corns MON88017: the structure of phytase gene qualitative PCR detection method and positive plasmid molecule. Acta Agronomica Sinica ACTAAGRONOMICA SINICA 2012,38 (4): 639-647.ISSN 0496-3490.
Transgenic corns NK603: the structure of phytase gene qualitative PCR detection method and positive plasmid molecule. Acta Agronomica Sinica ACTAAGRONOMICA SINICA 2012,38 (4): 639-647.ISSN 0496-3490.
One, experiment material
1, vegetable material
Transgenic paddy rice: turn HSA trans-genetic hybrid rice (GMO+), turn human serum albumin rice strain 114-7-2, the conversion carrier of this transgenic paddy rice contains HSA expression casette as shown in Figure 1.
Conventional rice: non-transgenic paddy rice Taibei 309(GMO-).
2, enzyme and reagent
Fluorescent quantitation ABIMIx reagent is purchased from ABI company, and other molecular biology reagent, if Extaq archaeal dna polymerase, DL2000Marker are purchased from Dalian precious biotinylated biomolecule Engineering Co., Ltd.Other biochemical reagents are import packing or domestic analytical pure.Primer is synthetic by Shanghai Sheng Gong Bioisystech Co., Ltd.
3, laboratory apparatus
Pcr amplification instrument: Veriti
tM96 hole grads PCR instrument (ABI company)
Nucleic acid electrophoresis apparatus: DYY-III type nucleic acid electrophoresis apparatus (Liuyi Instruments Plant, Beijing)
Other Instruments comprises: whizzer, electronic balance, incubator etc.
Two, experimental technique
1, plant genome DNA extracts and detects
(1) extracting method of DNA of plants
A gets the about 0.1g of transgenic paddy rice (or conventional rice) blade in mortar, adds liquid nitrogen to be ground to rapidly Powdered.
B is transferred to blade powder rapidly and adds in advance 700 μ l CTAB damping fluid (CTAB 15g; 1M TrisCl (pH 8.0) 75ml; 0.5M EDTA 30ml; NaCl 61.4g; ddH
2o supplies 1000ml) 2ml centrifuge tube in, after mixing gently, 65 ℃ of water bath heat preservations 30 minutes.Every ten minutes, carefully rock and mix.
C takes out centrifuge tube, after being chilled to room temperature (25 ℃), adds the phenol/chloroform (being each 350 μ l of phenol and chloroform) of 700 μ l equal-volume ratios.Turn upside down and fully mix, extracting 5 minutes.
Under d room temperature, centrifugal 10 minutes of 12000rpm, transfers to supernatant in another new centrifuge tube with the 1ml rifle head that cuts off head, adds 2 μ l RNaseA(10mg/ml).
E adds and the isopyknic chloroform of supernatant (700 μ l), turns upside down and fully mixes, extracting 5 minutes.
Under f room temperature, centrifugal 10 minutes of 12000rpm, draws supernatant in another new centrifuge tube.
G adds isopyknic Virahol (700 μ l), fully mixes, and normal temperature is placed visible precipitate after 10 minutes.For precipitating completely, can place 1-2 hour at-20 ℃.
Under h room temperature, centrifugal 10 minutes of 12000rpm, the heavy pipe end that is deposited on.Abandon most supernatant liquor.
I adds 700 μ l 70%(volumn concentrations) aqueous ethanolic solution cleans 30 minutes.
J removes the aqueous ethanolic solution in centrifuge tube, DNA is deposited in pipe and naturally dries.
K adds appropriate TE(50 μ l) dissolve, put into-20 ℃ of Refrigerator stores standby.
(2) DNA detection
Get the DNA solution that 5 μ l steps (1) are extracted, the agarose gel electrophoresis with 0.8%, tentatively judges according to its brightness and banding pattern the quality of extracting DNA.Adopt ultraviolet spectrophotometer to measure concentration and the purity of the DNA extracting.
2, turn the acquisition of flanking sequence of the exogenous insertion vector of human serum albumin rice strain 114-7-2
This research adopts the method separation of Genome walking to obtain turning two 5' end flanking sequences of human serum albumin rice strain 114-7-2.Genome walking is a kind of method of the known array side zone of ignorance sequence that increases, and with reference to Genome walking test kit (TaKaRa Code:D316), illustrates, main operational steps is as follows:
(1) design Auele Specific Primer
According to known T-DNA RBS sequence, utilize the Auele Specific Primer that Primer 5 softwares design respectively three in the same way and annealing temperature is higher (SP Primer): SP1, SP2 and SP3, the position of SP2 is in the inner side of SP1, SP3 is positioned at the inner side of SP2, serve Hai Sheng work Bioisystech Co., Ltd synthetic, in Table 1.
Table 1 special primer Serial relation information
| Primer title | Primer sequence (5 ' 3 ') | Primer length (bp) | Annealing temperature (Tm) |
| SP1 | CGTTACCCAACTTAATCGCCTTGC | 24 | 66.3 |
| SP2 | CTCCTTCAACGTTGCGGTTCTGT | 23 | 65.4 |
| SP3 | AACGTGACTCCCTTAATTCTCCGC | 24 | 65.1 |
(2) the 1st take turns PCR reaction
Any one in tetra-kinds of the AP Primer(AP1-AP4 that provide with test kit, below for AP1 is example) as upstream primer, SP1 Primer is downstream primer, carries out 1st PCR reaction.
Reaction system, in Table 2, adds successively reaction reagent by table 2 in PCR reaction tubes, at the centrifugal 10s of desk centrifuge.
Table 2 the 1st is taken turns PCR reaction system
Response procedures is as follows:
Reaction finishes rear taking-up PCR reaction tubes, and PCR reaction product is carried out to electrophoresis detection, or stand-by 4 ℃ of preservations.
The electrophoretic detection of PCR product is as follows: 0.8g agarose is added in 1 * TAE damping fluid of 100ml, heating is dissolved, be mixed with concentration and be 0.8% agarose solution, then, in adding the ratio of 5 μ l SYBR Green I solution to add SYBR Green I solution in every 100ml agarose solution, mix, after slightly suitable cooling, be poured on electrophoresis plate, plug pecten, under room temperature, be frozen into after gel, put into 1 * TAE damping fluid, take out vertically upward gently pecten.The PCR product of drawing 5 μ l is added in gel swimming lane after mixing with appropriate sample loading buffer, and a swimming lane adds DNA molecular amount standard therein, carries out electrophoresis.After electrophoresis finishes, take out sepharose, be placed in lightly imaging on gel imaging instrument.If PCR product is disperse shape, carry out follow-up reaction.
(3) the 2nd take turns PCR reaction
By the 1st, take turns after 100 times of PCR reaction solution dilutions, get 1 μ l as the 2nd template of taking turns PCR reaction, with the 1st take turns PCR reacting phase with AP Primer(take AP1 as example) as upstream primer, SP2Primer is downstream primer, carry out the 2nd and take turns PCR reaction, reaction system is in Table 3.
Table 3 the 2nd is taken turns PCR reaction system
Response procedures is as follows:
Reaction finishes rear taking-up PCR reaction tubes, and PCR reaction product is carried out to electrophoresis detection or stand-by 4 ℃ of preservations.
Described in the same step of electrophoretic detection (2) of PCR product.If PCR product is disperse shape band, carry out follow-up reaction.
(4) the 3rd take turns PCR reaction
By the 2nd, take turns after 100 times of PCR reaction solution dilutions, get 1 μ l as the 3rd template of taking turns PCR reaction, with the 1st take turns PCR reacting phase with AP Primer(take AP1 as example) as upstream primer, SP3 Primer is downstream primer, carry out the 3rd and take turns PCR reaction, reaction system is as table 4.
Table 4 the 3rd is taken turns PCR reaction system
Response procedures is as follows:
Described in the same step of electrophoretic detection (2) of PCR product.Result shows to only have the 3rd of AP1 primer to take turns PCR product and be clear electrophoretic band, cuts glue and reclaims.
(5) sequence order-checking and analysis
Adopt the PCR product recovery test kit recovery the 3rd of Tian Gen company to take turns pcr amplification product, be connected to PMD18 carrier (TaKaRa company) upper, transform intestinal bacteria, the positive colony obtaining is delivered to Hua Da genome company and check order.Adopt DNA Star (ver 5.01) and BioXM (ver 2.6) to compare and analyze sequence and the carrier sequence similarity of measuring, the similar rice genome sequence of retrieval in ncbi database (http://www.ncbi.nlm.nib.gov/).
Three, experimental result
Adopt Genome walking amplification to obtain the flanking sequence of two external source Insert Fragments that turn human serum albumin rice strain 114-7-2.
1, be positioned at the 5' end flanking sequence on the 5th karyomit(e)
Be positioned at the 5' end flanking sequence total length 785bp on the 5th karyomit(e), its nucleotide sequence is as shown in sequence in sequence table 1.This 5' end flanking sequence is comprised of T-DNA RBS sequence fragment (252bp) two portions on rice genome sequence fragment (533bp) and conversion carrier.Concrete, the 1-533 position of sequence 1 is the rice genome sequence (the 2496104-2496636 position of GenBank:NC008398) that described rice genome sequence fragment is; The 534-785 position of sequence 1 is T-DNA RBS sequence fragment on described conversion carrier.
2, be positioned at the 5' end flanking sequence on the 4th karyomit(e)
The 5' being arranged on the 4th karyomit(e) holds its nucleotide sequence of flanking sequence total length 525bp as shown in sequence table sequence 2.This 5' end flanking sequence is comprised of T-DNA RBS sequence fragment (146bp) two portions on rice genome sequence fragment (379bp) and conversion carrier.Concrete, the 1-379 position of sequence 2 is the rice genome sequence (the 30911165-30911543 position of GenBank:NC008397) that described rice genome sequence fragment is; The 380-525 position of sequence 2 is T-DNA RBS sequence fragment on described conversion carrier.
The present embodiment is identified being designed for according to the flanking sequence of the external source Insert Fragment that turns human serum albumin rice strain 114-7-2 of embodiment 1 acquisition or whether assistant identification paddy rice to be measured is that the specific PCR that turns human serum albumin rice strain 114-7-2 detects primer pair, and its method of design can be (1) or (2) as follows:
(1) according to the 1-379 position of sequence in sequence table 1, design the forward primer in described primer pair, according to the 380-525 position of sequence in sequence table 1, design the reverse primer in described primer pair;
(2) according to the 1-533 position of sequence in sequence table 2, design the forward primer in described primer pair, according to the 534-785 position of sequence in sequence table 2, design the reverse primer in described primer pair.
According to the method for design above-mentioned (2) Suo Shu, for the 5' end flanking sequence being positioned on the 4th karyomit(e), sequence 2 designs, obtain as follows for the identification of or assistant identification paddy rice to be measured whether be that the specific PCR that turns human serum albumin rice strain 114-7-2 detects primer pair:
HSA-F(forward): 5 '-CCGACGCGGAGGAAGAC-3 ' (sequence 3) (sequence of the 348-364 position of sequence 2)
HSAR(is reverse): 5 '-CGTTTCCCGCCTTCAGTTTA-3 ' (sequence 4) (reverse complementary sequence of the 396-415 position of sequence 2)
In addition, according to the primer pair of above-mentioned design (HSA-F and HSA-R), design obtains following probe (TaqMan probe):
HSA – P:5 '-CGGAGGCGGCGTCAAACACTG-3 ' (sequence 5) (the 369-389 position of sequence 2)
Report fluorophor FAM mark for the 5 ' end of probe HSA-P, cancellation fluorophor TAMRA mark for 3 ' end.
The primer pair of embodiment 3, embodiment 2 and the specific detection of probe
The primer pair obtaining with embodiment 2 and probe detect respectively and turn human serum albumin rice strain 114-7-2, non-transgenic paddy rice Taibei 309(GMO-), transgenic Fructus Lycopersici esculenti " China kind No. 1 ", transgenic paddy rice Bt63, soil of transgenic Bt cotton, transgenic paddy rice " Kemingdao ", transgenic paddy rice " rich No. 6 of section ", transgenic paddy rice " extensive No. 1 of China ", transgenic corns MON810, transgenic corns MON88017 and transgenic corns NK603, to verify the specificity of primer pair and probe.Each sample adopts identical detection method, comprises extraction and two steps of real-time fluorescence PCR of the total DNA of sample.
One, the extraction of sample total DNA
With embodiment 1 two 1(1).
Two, real-time fluorescence PCR
Total DNA of each sample that the step 1 of take respectively obtains carries out real-time fluorescence PCR as template.
Real-time fluorescence PCR reaction system: by 12.5 μ l ABI TaqMan Gene Expression Master Mix(ABI companies), 5 μ l DNA profilings, 5 μ l sterilizing ultrapure waters, 1 μ l forward primer (HSA-F), 1 μ l reverse primer (HSA-R) and 0.5 μ l probe (HSA-P) mix, and obtains the reaction system of 25 μ l; In reaction system, while reacting initial, the concentration of upstream and downstream primer is 0.2 μ mol/L, and the concentration of probe is 0.1 μ mol/L.
Real-time fluorescence PCR reaction parameter: 50 ℃ of 2min; 95 ℃ of 10min; 95 ℃ of 15s, 60 ℃ of 1min, totally 40 circulations.
Reaction finishes rear according to amplification curve result of determination.
As shown in Figure 2, only turn human serum albumin rice strain 114-7-2 has fluorescent signal to result, and equal no signal in other samples shows that primer pair and probe that embodiment 2 obtains have stronger specificity.
The primer pair of embodiment 4, embodiment 2 and probe sensitivity detect
Take and turn HSA trans-genetic hybrid rice (GMO+) and non-transgenic paddy rice Taibei 309(GMO-) seed powder be examination material, both are mixed, preparation turn HSA trans-genetic hybrid rice (GMO+) seed powder weight percent be followed successively by 5%, 1%, 0.5%, 0.1% and 0.01%(W/W) biased sample to be measured, extract respectively total DNA of 5 biased samples to be measured, the total DNA of the 20ng of take is template, and the primer pair obtaining with embodiment 2 and probe carry out real-time fluorescence PCR reaction.Each sample adopts identical detection method.Real-time fluorescence PCR reaction system and reaction parameter are with embodiment 3 step 2.
As shown in Figure 3, the method for stating at least can detect and turn the biased sample that the weight percent of HSA trans-genetic hybrid rice (GMO+) is 0.01% result, shows that primer pair and probe that embodiment 2 obtains have higher sensitivity.
Claims (6)
1. whether detection or auxiliary detection paddy rice to be measured are the method that turns human serum albumin rice strain 114-7-2, the genomic dna that comprises the steps: to take described paddy rice to be measured is template, utilization primer pair and the probe as shown in sequence in sequence table 5 that in sequence table, two single strand dnas shown in sequence 3 and sequence 4 form carry out PCR detection, thereby determine that whether described paddy rice to be measured is for turning human serum albumin rice strain 114-7-2.
2. method according to claim 1, is characterized in that: described PCR is real-time fluorescence PCR.
3. method according to claim 2, is characterized in that: 5 ' end of described probe is marked with FAM fluorophor, and 3 ' end is marked with TAMRA fluorophor.
4. according to the method in claim 2 or 3, it is characterized in that: in the PCR system of described real-time fluorescence PCR, two primers in described primer pair and the mol ratio of described probe are 2:2:1.
5. method according to claim 4, is characterized in that: the annealing temperature of described real-time fluorescence PCR is 60 ℃.
6. two primer pairs that single strand dna forms shown in sequence 3 and sequence 4 in sequence table.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210313098.7A CN102827838B (en) | 2012-08-29 | 2012-08-29 | Flanking sequence of human serum albumin transgenic rice strain 114-7-2 and identification method of flanking sequence |
| CN201310409259.7A CN103484455B (en) | 2012-08-29 | 2012-08-29 | A kind of flanking sequence turning human serum albumin rice strain 114-7-2 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210313098.7A CN102827838B (en) | 2012-08-29 | 2012-08-29 | Flanking sequence of human serum albumin transgenic rice strain 114-7-2 and identification method of flanking sequence |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310409259.7A Division CN103484455B (en) | 2012-08-29 | 2012-08-29 | A kind of flanking sequence turning human serum albumin rice strain 114-7-2 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102827838A CN102827838A (en) | 2012-12-19 |
| CN102827838B true CN102827838B (en) | 2014-03-19 |
Family
ID=47331150
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210313098.7A Expired - Fee Related CN102827838B (en) | 2012-08-29 | 2012-08-29 | Flanking sequence of human serum albumin transgenic rice strain 114-7-2 and identification method of flanking sequence |
| CN201310409259.7A Expired - Fee Related CN103484455B (en) | 2012-08-29 | 2012-08-29 | A kind of flanking sequence turning human serum albumin rice strain 114-7-2 |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310409259.7A Expired - Fee Related CN103484455B (en) | 2012-08-29 | 2012-08-29 | A kind of flanking sequence turning human serum albumin rice strain 114-7-2 |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN102827838B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103966208B (en) * | 2014-03-06 | 2016-04-20 | 安徽省农业科学院水稻研究所 | Transgenic paddy rice PA110-15 external source Insert Fragment flanking sequence and application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1782074A (en) * | 2004-12-01 | 2006-06-07 | 中国农业科学院生物技术研究所 | Method for amplifying rice T-DNA insertion site flanking sequence |
| CN102634506A (en) * | 2012-04-06 | 2012-08-15 | 湖南杂交水稻研究中心 | Method for applying adhesive tail end joints to flanking sequence separation |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100540667C (en) * | 2005-07-13 | 2009-09-16 | 杨代常 | Utilize rice-embryo milk cell to produce recombination human serum albumin as bio-reactor |
| CN101240277B (en) * | 2007-02-09 | 2011-07-20 | 中国农业科学院植物保护研究所 | PCR detection method of transgene paddy strain Bt Shanyou 63 |
| CN101240279B (en) * | 2007-02-09 | 2010-06-23 | 中国农业科学院植物保护研究所 | Side sequence of exogenous insert of transgene paddy strain Kefeng 6 |
| CN101240278B (en) * | 2007-02-09 | 2011-07-06 | 中国农业科学院植物保护研究所 | Side sequence of exogenous insert of transgene paddy strain Kemingdao 1 |
-
2012
- 2012-08-29 CN CN201210313098.7A patent/CN102827838B/en not_active Expired - Fee Related
- 2012-08-29 CN CN201310409259.7A patent/CN103484455B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1782074A (en) * | 2004-12-01 | 2006-06-07 | 中国农业科学院生物技术研究所 | Method for amplifying rice T-DNA insertion site flanking sequence |
| CN102634506A (en) * | 2012-04-06 | 2012-08-15 | 湖南杂交水稻研究中心 | Method for applying adhesive tail end joints to flanking sequence separation |
Non-Patent Citations (2)
| Title |
|---|
| Large-scale production of functional human serum albumin from transgenic rice seeds;Y He et al;《PNAS》;20111031;第108卷(第47期);19078-19083 * |
| Y He et al.Large-scale production of functional human serum albumin from transgenic rice seeds.《PNAS》.2011,第108卷(第47期),19078-19083. |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103484455A (en) | 2014-01-01 |
| CN103484455B (en) | 2015-08-05 |
| CN102827838A (en) | 2012-12-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102827936B (en) | Composition and reagent kid for testing human serum albumin transgenic rice strain 114-7-2 | |
| CN106048010A (en) | RPA (recombinase polymerase amplification) technology based method for detecting phomopsis helianthi, RPA primers and kit | |
| CN101824411B (en) | Flanking sequence of transgenic rice Kefeng No. 6 and qualitative PCR detection method | |
| CN102162012B (en) | Qualitative PCR detection method for transgenic rice kefeng No. 6 | |
| CN101724698B (en) | Method and special kit for testing whether rice to be tested is CpTI transgenic rice | |
| KR20100021834A (en) | Method of discriminating ginseng cultivars using sts primers | |
| CN103146824A (en) | Recombinant standard plasmid and kit for PCR (Polymerase Chain Reaction) detection of transgenic rice | |
| CN108588091A (en) | A kind of okra reference gene and its application | |
| CN103667464A (en) | Method for identifying haplotypes of wheat grain heavy gene TaGW2-6B promoter region and special mark of haplotypes | |
| CN102827838B (en) | Flanking sequence of human serum albumin transgenic rice strain 114-7-2 and identification method of flanking sequence | |
| CN108384873A (en) | SSR marker and method for the green phoenix hybrid seed purity identification of watermelon | |
| CN112501335A (en) | Method for identifying drought resistance of wheat and special complete set of reagent thereof | |
| CN116397049A (en) | Multiplex PCR detection method for multiple fusarium species of wheat stem-based rot and application | |
| CN106282338A (en) | The molecular detecting method of rice photo-thermo-sensitive male sterility pms3 and p/tms12 1 gene and molecular marker thereof | |
| CN106701968A (en) | Primer for simultaneously detecting Botryosphaeria dothidea and Cryptosporella viticola and application of primer | |
| CN103898225B (en) | A kind of primer and discrimination method differentiating the hidden kind of Bemisia tabaci and trialeurodes vaporariorum | |
| CN101724699B (en) | Method and special kit for testing whether rice to be tested is transgenic rice 'Kefeng No.6' | |
| CN108728569A (en) | A kind of okra reference gene and its application | |
| CN102676674A (en) | Plasmid reference molecule for genetically modified maize detection and preparation method thereof | |
| CN103397086B (en) | Probe for transgenic maize strain MLPA detection and primer for preparation of long probe | |
| CN104164486B (en) | The LAMP detection kit of the shrivelled pathogen of a kind of Eucalyptus and using method thereof | |
| Lu et al. | Comparison of Genomic DNA Extraction Methods for Chenopodium quinoa Willd | |
| CN102199599B (en) | Specific detection target sequences of transgenic tomato, plasmid molecule and its detection kit thereof | |
| CN102912026A (en) | Polymerase chain reaction (PCR) system for identification or auxiliary identification of wheat vernalization gene VRN-1 | |
| CN108660195A (en) | Functional nucleic acid rapid PCR methods and kit for the identification of MSTN gene knock-out pigs |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140319 Termination date: 20180829 |