CN102766607A - Fusion protein for screening and evaluating anti-enterovirus 71 medicine and application of fusion protein - Google Patents
Fusion protein for screening and evaluating anti-enterovirus 71 medicine and application of fusion protein Download PDFInfo
- Publication number
- CN102766607A CN102766607A CN2012102554953A CN201210255495A CN102766607A CN 102766607 A CN102766607 A CN 102766607A CN 2012102554953 A CN2012102554953 A CN 2012102554953A CN 201210255495 A CN201210255495 A CN 201210255495A CN 102766607 A CN102766607 A CN 102766607A
- Authority
- CN
- China
- Prior art keywords
- nucleotide sequence
- egfp
- seq
- medicine
- fusion protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses fusion protein for screening and evaluating an anti-enterovirus 71 (EV 71) medicine and application of the fusion protein. According to the fusion protein, firefly luciferase (Fluc) is used as a reporter gene, two micromolecule polypeptides which can be bonded tightly pepA and pepB are bonded with the N end and the C end of the firefly luciferase respectively, the middles of the firefly luciferase are connected by an EV713C protease effect substrate, and a fusion gene is inserted into an eukaryotic expression vector and is expressed to generate the fusion protein. Simultaneously, enhanced green fluorescent protein (EGFP) which is inserted reversely can indicate the transfection efficiency of the EGFP in cells which are transfected in vitro by observing the condition of green fluorescence. By utilizing an indication vector provided by the fusion protein, the reproduction condition of EV 71 can be indicated simply, quickly, flexibly and quantitatively, and the indication vector also can be applied to the screening and evaluation of the anti-EV 71 medicine, has high actual application value and has a broad application prospect in the field of medical science.
Description
Technical field
The present invention relates to a kind of fusion rotein and application thereof that is used to screen and estimate medicine, particularly a kind of fusion rotein and application thereof of screening and estimate anti-EV71 medicine based on chemiluminescence method.Belong to biological technical field.
Background technology
(enterovirus 71, EV71) are a kind of important neural infectious enteroviruses, still do not have treat-ment and vaccine effectively at present for enterovirus 71 types.In the Asian-Pacific area and worldwide all relevant for the report (AbuBakar, S., et al..Enterovirus71 outbreak, Brunei.Emerg.Infect.Dis.2009,15:79 – 82.) of the relevant outbreak of communicable diseases of EV71 virus infection.EV71 infects and mainly can cause children's fash, be called as hand foot mouth disease (hand-foot-mouth disease, HFMD).Yet the EV71 acute infection also can cause serious nervous system disease and high mortality ratio.Especially children below five years old can follow neural complication after being infected by EV71; Comprise aseptic meningitis, brain stem and/or cerebellum encephalitis; And acute unable limb paralysis, myocarditis and acute deadly hemorrhagic wet lung (Brown, B.A., M.S.Oberste; J.P.Alexander; Jr., M.L.Kennett, and M.A.Pallansch.Molecular epidemiology and evolution of enterovirus 71 strainsisolated from 1970 to 1998.J.Virol.1999.73:9969-9975.).
EV71 belongs to Picornaviridae, and enterovirus genus is a kind of non-coating, single positive chain RNA virus, geneome RNA comprise about 7400 Nucleotide (nucleotide, nt).(open reading frame, ORF) three parts constitute its genome structure by 5 '-UTR, 3 '-UTR, opening code-reading frame.Wherein ORF is divided into P1, P2, three parts of P3, in the process of translation, through the cutting action of EV712A, 3C proteolytic enzyme; P1 four structural protein of encoding, VP1-VP4, P2 3 Nonstructural Proteins (2A, 2B, 2C) of encoding; P3 coding 4 Nonstructural Proteins (3A, 3B, 3C, 3D) (Lin; J.Y, et al..Viral and host proteins involved in picornavirus life cycle.J.Biomed.Sci.2009,16:103.).The main cleavage site of EV713C proteolytic enzyme is the amino acid whose tie point of Gln-Gly (Q/G) ((Weng KF in virus self or the host cell; Li ML; Hung C T; Shih SR.Enterovirus 71 3C protease cleaves a novel target CstF-64 and inhibits cellular polyadenylation.PLoS Pathog.2009,5 (9): 1-13.).
The method of observing and detect EV71 at present is except traditional virus culture identification method; Mainly be RT-PCR and immunological method; But equal more complicated is gone up in these method operations, and can't observe directly changing conditions, the especially EV71 infection conditions in vivo of virus in the cell or tissue; Lack the ideal appraisement system; Make the action effect of the anti-EV71 of medicine be difficult to make assessment, delayed the research and development and the screening of medicine greatly, thereby it is extremely urgent to set up the screening and assessment system of the anti-EV71 medicine of a kind of ideal.
The objective of the invention is deficiency, the method for observing and detect the EV71 infection conditions through chemoluminescence is provided, can observe and detect the infection of EV71 fast, effectively, easily, good platform is provided for screening anti-EV71 medicine to prior art.
Summary of the invention
The objective of the invention is to through of the cutting of EV713C proteolytic enzyme substrate; N section and the C section of Fluc in the recombination fusion protein are combined closely; Make it luminous under the specific substrate effect; Thereby the levels of replication of monitoring EV71, and then a kind of fusion rotein that is used to screen and estimate anti-EV71 medicine is provided.
Peptide A (pepA) and peptide B (pepB) are two sections, and high-affinity bonded polypeptide (Thormeyer D can take place; Ammerpohl O; Larsson O; Et al.Characterization of lacZ complementation deletions using membrane receptor dimerization.Biotechniques2003,34 (2): 346-350,352-355.).N section (Nluc) and C section (Cluc) with Fluc among the present invention combine with pepA and pepB respectively; Middle with the cleavage site connection of EV713C proteolytic enzyme in CstF-64 albumen; This moment Fluc activity owing to Nluc be suppressed (Weng KF separating of Cluc; Li ML; Hung CT, Shih SR.Enterovirus 71 3C protease cleaves a novel target CstF-64 and inhibits cellular polyadenylation.PLoS Pathog.2009,5 (9): e1000593.).When cleavage site by 3C proteolytic enzyme cutting, high-affinity takes place with pepB and combines in pepA, thereby lures that Nluc combines the activity of recovery Fluc also luminous with Cluc into.
A kind of fusion rotein that is used to screen and estimate anti-enterovirns type 71 medicine of the present invention, it is characterized in that described fusion rotein contain following (a) or (b) shown in aminoacid sequence:
(a) aminoacid sequence shown in the SEQ ID No:1; Or
(b) aminoacid sequence shown in the SEQ ID No.1 is perhaps added the aminoacid sequence that still has the effect of evaluation EV713C protease activity through replacement, the disappearance of one to ten amino-acid residue.
In the present invention, preferred, the aminoacid sequence of described fusion rotein is shown in SEQ ID No:1.
The present invention also provides the nucleotide sequence of the described fusion rotein of encoding, it is characterized in that described nucleotide sequence contain following (a) and (b) or (c) shown in nucleotide sequence:
(a) nucleotide sequence shown in the SEQ ID No.2; Or
(b) nucleotide sequence of the aminoacid sequence shown in the coding SEQ ID No:1; Or
(c) has the nucleotide sequence that 90% above homology and its encoded protein matter have the effect of evaluation EV713C protease activity with the nucleotide sequence shown in the SEQ ID No.2.
In the present invention, preferred, described nucleotide sequence is shown in SEQ ID No.2.
Further, the present invention also provides a kind of recombinant expression vector, it is characterized in that containing above arbitrary described nucleotide sequence.
In the present invention, preferred, described recombinant expression vector is two fluorescence report carriers, and it is made up by following method and obtains:
(1) nucleotide sequence of the N section of the plain enzyme of coding fluorescence and C section is connected with one of nucleotide sequence of encode two micromolecule polypeptide pepA that can combine closely and pepB respectively; Two fragments that obtain are linked to each other by the nucleotide fragments of coding EV713C albumen zymolyte, obtain fusion gene;
(2) this fusion gene is inserted among the carrier for expression of eukaryon pCDNA3.1 (+), set up the expression vector that can be used for indicating the EV713C protease activity;
(3) N end and C are held the green fluorescent protein (EGFP) that has cytomegalovirus (CMV) promotor and vacuolating virus of monkey 40 poly-A tails (SV40 polyA tail) respectively; Be called the CMV-EGFP-SV40 fragment; In the carrier for expression of eukaryon that reverse inserting step (2) obtains, obtain described pair of fluorescence report carrier.
Preferred, described pair of fluorescence report carrier is pANluc (△ Q/G) BCluc-EGFP, and its nucleotide sequence is shown in SEQ ID No.4.
Further, the present invention also provides a kind of host bacterium, it is characterized in that containing above arbitrary described recombinant expression vector.
Further again, the invention provides the reagent of the level that described fusion rotein infects at preparation indication 3C protease activity, indication EV71 or in screening with estimate the application in the anti-enterovirns type 71 medicine.
Described nucleotides sequence is listed in the reagent of the level for preparing indication 3C protease activity, indication EV71 infection or is screening and estimating the application in the anti-enterovirns type 71 medicine.
For achieving the above object, the present invention has adopted following technical measures:
(1) carrier for expression of eukaryon of construction of fusion protein ANluc (△ Q/G) BCluc-EGFP gene;
(2) observing fusion rotein ANluc (△ Q/G) BCluc-EGFP can effectively express in cell;
(3) cotransfection expressed fusion protein ANluc (△ Q/G) BCluc-EGFP and the proteic carrier for expression of eukaryon of EGFP-3C in cell;
(4) activity of luciferase in detection expressed fusion protein ANluc (△ Q/G) BCluc-EGFP and the proteic cell of EGFP-3C;
(5) infect EV71 in the cell of expressed fusion protein ANluc (△ Q/G) BCluc-EGFP;
(6) detect the activity that infects luciferase behind the EV71 in the cell of expressed fusion protein ANluc (△ Q/G) BCluc-EGFP.
The present invention has successfully made up two micromolecule polypeptide pepA that can combine closely and pepB have been combined middle carrier for expression of eukaryon by the continuous fusion gene of EV713C albumen zymolyte respectively with Fluc N end and C end fragment.With this carrier transfection to EV71 permissive cell (vero cell), further infect EV71 after, under the FLuc substrate-function, can detect the expression of luciferase, and then a kind of fusion rotein that is used to screen and estimate anti-EV71 medicine is provided.
The present invention still belongs to initiative; Adopt segmented Photinus pyralis LUC strategy; The N section of the plain enzyme of coding fluorescence is connected with the nucleotide sequence of pepB with two micromolecule polypeptide pepA that can combine closely respectively with the nucleotide sequence of C section; Middle nucleotide fragments by coding EV713C albumen zymolyte links to each other; Obtain fusion gene, then this fusion gene is inserted carrier for expression of eukaryon pCDNA3.1 (+), set up expression vector pANluc (△ Q/G) BCluc that can be used for indicating the EV713C protease activity.In addition N end and C are held the green fluorescent protein (EGFP) that has cytomegalovirus (CMV) promotor and vacuolating virus of monkey 40 poly-A tails (SV40polyAtail) respectively; To call the CMV-EGFP-SV40 fragment in the following text; The reverse insertion in the above-mentioned carrier for expression of eukaryon; Can in cell, express ANluc (△ Q/G) BCluc and EGFP, form two fluorescence report carrier (indication carrier) pANluc (△ Q/G) BCluc-EGFP.Thereby the expression that can indicate fusion rotein ANluc (△ Q/G) BCluc through the expression of observing green fluorescence.Expression vector produces fusion rotein at cell inner expression, under the situation that EV713C proteolytic enzyme coexpression is arranged, cutting action takes place at △ Q/G place; Interaction through pepA and pepB; Drive complementary combination of luciferase of N end and C end, form complete luciferase, just can reflect the EV713C protease activities through measuring luciferase; As shown in Figure 1, duplicate situation thereby estimate EV71.Indication carrier provided by the invention, not only can be simply, fast, sensitive but also can quantitatively indicate the EV713C protease activity, represent the levels of replication of EV71.Under the condition that anti-EV71 medicine exists; Utilize the transfection of above-mentioned indication carrier to contain the cell of EV71, the collecting cell sample detects the expression amount of luciferase in the cell; Measure the inhibiting rate that EV71 duplicates and expresses in the cell with this; Obtain EV71 is suppressed Evaluation on effect, have higher actual application value, have broad application prospects at medical field.
Said two micromolecule polypeptide pepA and pepB are for combining closely and not influencing the protein molecular of cell function; Said 3C albumen zymolyte is the tie point of Q/G.
Said indication carrier can be at the cell in vitro horizontal expression, or expresses in animal body through genetically modified mode.
Specifically, but the fusion gene called after ANluc-Q/G-BCluc of the tie point that said 3C albumen zymolyte is Q/G contains one of following nucleotide sequence:
1) nucleotide sequence shown in the SEQ ID No.2 in the sequence table;
2) nucleotide sequence of the aminoacid sequence shown in the SEQ ID No.1 in the code sequence tabulation;
3) with sequence table in the nucleotide sequence that limits of SEQ ID No.2 have the nucleotide sequence that 90% above homology and its encoded protein still have the effect of evaluation EV713C protease activity.
SEQ ID No.2 in the sequence table is by 1866 based compositions; Its encoding sequence is for beginning the protein of the amino acid residue sequence of SEQ ID No.1 in the code sequence tabulation from 5 ' end the 1st bit base; From 5 ' end the 1st bit base coding pepA, from the Photinus pyralis LUC fragment of 5 ' end the 64th bit base coding N end, from 5 ' end the 1321st bit base coding Q/G cleavage site; From 5 ' end the 1351st bit base coding pepB, from 5 ' end the 1414th bit base coding C end Photinus pyralis LUC fragment.
The fusion rotein of above-mentioned fusion gene ANluc-Q/G-BCluc coding, contain following amino acid residue sequences it
1) the SEQ ID No.1 in the sequence table;
2) with the amino acid residue sequence of SEQ ID No.1 in the sequence table through replacement, the disappearance of one to ten amino-acid residue or add and have the protein of estimating the effect of EV713C protease activity.
SEQ ID No.1 in the sequence table is made up of 621 amino-acid residues; From aminoterminal the 1st amino acids residue is pepA; From aminoterminal the 22nd amino acids residue is the Photinus pyralis LUC fragment of N end; From aminoterminal the 440th amino acids residue is that Q/G is cut into a little, is pepB from aminoterminal the 453rd amino acids residue, is the Photinus pyralis LUC fragment of C end from aminoterminal the 472nd amino acids residue.
The reverse CMV-EGFP-SV40 fragment of inserting in the said indication carrier is shown in the SEQ ID No.3 in the sequence table.SEQ ID No.3 in the sequence table is played encoding sequence and is the CVM promotor that begins to encode from 5 ' end the 1st bit base by 1557 based compositions, from 5 ' end the 597th bit base coding EGFP fragment, from 5 ' end the 1470th bit base coding SV40 poly A tract.
The indication carrier of being estimated the EV713C protease activity by above-mentioned fusion gene being used to of inserting that construction of eukaryotic expression vector forms also is that the present invention is claimed.Concrete, said indication carrier inserts carrier for expression of eukaryon pCDNA3.1 (+)-EGFP with fusion gene ANluc-Q/G-BCluc and forms, called after pANluc (△ Q/G) BCluc-EGFP, and its nucleotide sequence is shown in sequence SEQ ID No.4 in the sequence table.
Use fusion rotein indication mechanism of the present invention evaluation and screen anti-EV71 medicine and have the following advantages:
1) can be in eukaryotic cell expressing green fluorescent protein, be convenient to expression efficiency at external direct viewing, control indication carrier;
2) show effectively and easily that through observing uciferase activity EV71 is in external or intravital infection conditions;
3) under the situation that has anti-EV71 medicine to exist, screen and estimate the effect of anti-EV71 medicine through the variation of uciferase activity, simple to operate, observe directly perceived, convenient;
4) expressing luciferase not in the eukaryotic cell, therefore when observing and detecting the indication carrier, the influence of no non-specific and autofluorescence.
Description of drawings
Fig. 1 is ANluc-Q/G-BCluc fusion rotein mechanism of action figure;
Fig. 2 is indication carrier A Nluc (Q/G) BCluc-EGFP construction strategy;
Fig. 3 is the cutting action of IVIS systematic observation EV713C albumen to fusion rotein;
Fig. 4 is the cutting action of IVIS systematic observation EV71 to fusion rotein;
Fig. 5 is the restraining effect that IVIS systematic observation IFN-α and GW5074 duplicate EV71;
Fig. 6 is the indicative function that IVIS systematic observation indication carrier infects EV71 in vivo.
Embodiment
The screening of anti-EV71 medicine and evaluation do not have a kind of very desirable and direct method at present.The present invention can obtain EV71 through the expression amount that detects luciferase and duplicate situation through the indication carrier of a kind of fusion rotein of design as fluoroscopic examination, under the situation that anti-EV71 medicine exists, can be applicable to screening and estimates anti-EV71 medicine.
The design of fusion rotein of the present invention; The main burst end Photinus pyralis LUC strategy that adopts; Two sections luciferases are combined with two the micromolecule polypeptide pepA and pepB that can combine closely respectively; And to utilize Q/G be the characteristic of 3C albumen zymolyte, and substrate fragment Q/G is inserted in the middle of two sections Photinus pyralis LUCs.Again this fusion gene is inserted carrier for expression of eukaryon pCDNA3.1 (+), foundation can be used for indicating expression vector ANluc (△ Q/G) BCluc of 3C protease activity.ANluc (△ Q/G) BCluc expression vector produces fusion rotein at cell inner expression, under the situation that 3C proteolytic enzyme coexpression is arranged, cutting action takes place at the Q/G place; Interaction through pepA and pepB; Drive luciferase N end and the complementary combination of C end, thereby form complete luciferase, just through measuring the situation of duplicating (like Fig. 1) that uciferase activity can reflect EV71; Under the situation that has anti-EV71 medicine to exist, can be used for screening and estimate anti-EV71 medicine.The reverse EGFP fragment of inserting can be indicated its transfection efficiency in cell through the expression of observing green fluorescence in carrier for expression of eukaryon simultaneously.
Through experiment and combination embodiment the present invention is further specified below, it should be understood that these embodiment only are used for the purpose of illustration, never limit protection scope of the present invention.
The structure of (1.1pCDNA3.1+)-EGFP plasmid platform
At first with plasmid pEGFP-N1 (available from Clontech company; The U.S.) MCS removes structure plasmid pEGFP-N1 ' in; CMV-EGFP-SV40 fragment then increases; And this fragment oppositely inserted the MCS of pCDNA3.1 (+) (available from Invitrogen company, the U.S.), carrier construction plasmid pCDNA3.1 (+)-EGFP.
According to EGFP (Genebank number: the primer sequence of cDNA sequences Design pcr amplification EGFP gene fragment GI1377911) is following:
P1 (upstream primer): 5 '-ATATATGCTAGCATGGTGAGCAAGGGCGAGGA-3 '
P2 (downstream primer): 5 '-ATATAGCGGCCGCTTACTTGTACAGCTCGTCCA-3 '
The segmental primer sequence of amplification CMV-EGFP-SV40 is following:
P3 (upstream primer):
5’-GCGCGCTCGAGTAGTTATTAATAGTAATCAATTACGGGGTC-3’
P4 (downstream primer): 5 '-GCCGGGAATTCGCAGTGAAAAAAATGCTTTATTTGTG-3 '
With pEGFP-N1 is template, uses primer P1/P2 amplification EGFP fragment.Archaeal dna polymerase is primeSTAR DNA Polymerase (available from Japanese TaKaRa).
PCR reacts as follows: 95 ℃ of 10min, and 95 ℃ of 45s, 60 ℃ of 50s, 72 ℃ of 45s totally 30 circulations, 72 ℃ are fully extended 5min again.
Glue reclaims purifying EGFP fragment, through restriction enzyme Nhe I and Not I double digestion, is connected with same plasmid pEGFP-N1 through Nhe I and Not I double digestion, obtains vector plasmid pEGFP-N1 '.
Using primer P3/P4, is template with pEGFP-N1 ', amplification CMV-EGFP-SV40 fragment, and archaeal dna polymerase is primeSTAR DNA Polymerase (available from Japanese TaKaRa).
PCR reacts as follows: 95 ℃ of 10min, and 95 ℃ of 45s, 60 ℃ of 50s, 72 ℃ of 45s totally 30 circulations, 72 ℃ are fully extended 5min again.
After glue reclaims CMV-EGFP-SV40 fragment (sequence such as SEQ ID No.3) the process Xho I and EcoR I double digestion behind the purifying; With plasmid pCDNA3.1 (+) through Xho I and EcoR I double digestion; Utilize T4DNALigase to connect, obtain vector plasmid pCDNA3.1 (+)-EGFP.
1.2 the structure of indication carrier pANluc (△ Q/G) BCluc-EGFP
The preparation of (1.2.1pANluc △ Q/G) BCluc gene fragment
According to Fluc (Genebank number: cDNA sequences Design pcr amplification GI76364278) has N end Photinus pyralis LUC fragment (pepANluc-Q/G) primer of pepA and EV713C protease cracking substrate, and sequence is following:
P5 (upstream primer):
5’-CCCAAGCTTATGAACGAAGCATATGTACATGACGGTCCTGTACGCTCACTGAACAGCGGCCGCAGAGGAGGAGAAGATGCCAAAAACATT-3’
P6 (downstream primer):
5’-GCTTCCTTTCGTGCCTTGCCTCCTCCACCCTGAATACTTGCTCCTTGCATTACTGCGCCTCCTCCGCCGTCCTTGTCGATGAGAGCG-3’
The C that amplification has pepB holds Photinus pyralis LUC fragment (pepBCluc) primer sequence following:
P7 (upstream primer):
5’-GTATTCAGGGTGGAGGAGGCAAGGCACGAAAGGAAGCAGAACTGGCAGCAGCAACTGCAGAACAGAGCGGCCGCAGATACGTTAACAACCCCGA-3’
P8 (downstream primer):
5’-TATAGGATCCTTACACGGCGATCTTGCCGCCCTTCTTGGCCTT-3’
With the plasmid pGL4.17 that contains firefly luciferase gene (available from Promega company; The U.S.) be template; Use above-mentioned primer PCR amplification pepANluc-Q/G, pepBCluc gene fragment, archaeal dna polymerase is primeSTAR DNA Polymerase (available from Japanese TaKaRa).
PCR reacts as follows: 95 ℃ of 10min, and 95 ℃ of 45s, 60 ℃ of 50s, 72 ℃ of 45s totally 30 circulations, 72 ℃ are fully extended 5min again.
Glue reclaims purifying pepANluc-Q/G, pepBCluc gene fragment; Two fragments with behind the purifying are template; With primer P5/P8 overlap pcr amplification ANluc-Q/G-BCluc gene fragment, archaeal dna polymerase is primeSTAR DNA Polymerase (available from Japanese TaKaRa).
Overlap PCR reacts as follows: 95 ℃ of 10min.95 ℃ of 45s, 60 ℃ of 50s, 72 ℃ of 45s, totally 10 circulations, the back adds upstream and downstream primer (P5 and P8) to the PCR mixed solution, 95 ℃ of 10min, 95 ℃ of 45s, 60 ℃ of 50s, 72 ℃ of 45s, totally 20 circulations, 72 ℃ are fully extended 5min again.
Glue reclaims purifying ANluc-Q/G-BCluc fragment, through Hind III and BamH I double digestion, reclaims the back and is connected with carrier pCDNA3.1 (+)-EGFP of BamH I double digestion with Hind III, obtains indicating carrier pANluc (△ Q/G) BCluc-EGFP.
Indication carrier pANluc (△ Q/G) the BCluc-EGFP sequence that present embodiment obtains is seen SEQNo.4 in the sequence table; Wherein the ANluc-Q/G-BCluc genes encoding has the protein of the aminoacid sequence shown in the SEQ No.1 in the sequence table; From 5 ' end the 1st bit base coding pepA; Photinus pyralis LUC fragment from 5 ' end the 22nd bit base coding N end; From the cleavage site Q/G of 5 ' end the 440th bit base coding 3C, from 5 ' end the 453rd bit base coding pepB, from the Photinus pyralis LUC fragment of 5 ' end the 472nd bit base coding C end.
In the concrete operations; All available from Japanese TaKaRa company, the double digestion reaction conditions is 37 ℃ of 4h for all restriction enzymes and ligase enzyme, and the T4DNA ligase enzyme of Japanese TaKaRa company is used in the connection that enzyme is cut product; By purpose fragment and the mass ratio of the carrier 5:1 separately system that connects; Behind the mixing, 4 ℃ of connections of spending the night, ligase enzyme is T4DNA Ligase.PCR and enzyme are cut product and are reclaimed test kit all available from TransGene company through running gel, operation with reference reagent specification sheets.
1. the structure of carrier pEGFP-3C
1.1pEGFP-C1 the structure of plasmid platform
With pcDNA3.1 (+) (available from American I nvitrogen) as basic plasmid skeleton; Amplify 3 ' end from pEGFP-N1 plasmid (available from American I nvitrogen) and have the EGFP nucleic acid fragment that flexibly connects; Green fluorescent protein EGFP gene fragment is inserted pcDNA3.1 (+) plasmid, make up pEGFP-C1 plasmid platform.
(Genebank number: cDNA sequences Design pcr amplification 3 ' GI1377911) is held to have and is flexibly connected (5 ' GGTGGAGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCG3 ') according to EGFP
The primer sequence of EGFP gene fragment following:
P9 (upstream primer): 5 '-ATATATAGCTAGCATGGTGAGCAAGGGCGAGGAGCT-3 '
P10 (downstream primer):
5’-GCTTTAAGCTTCGATCCGCCACCGCCAGAGCCACCTCCGCCTGAACCGCCTCCACCCTTGTACAGCTCGTCCATGCCG-3’
With the pEGFP-N1 plasmid is template, uses primer P9, P10 amplification 3 ' end to have the EGFP fragment that flexibly connects.The PCR reaction conditions is: 95 ℃ of 10min, and 95 ℃ of 45s, 60 ℃ of 50s, 72 ℃ of 45s, totally 30 circulations, 72 ℃ are fully extended 5min again.Archaeal dna polymerase is primeSTAR DNA Polymerase (available from Japanese TaKaRa).Glue reclaims the EGFP fragment and carries out Nhe I/Hind III double digestion, and is connected with same vector plasmid pCDNA3.1 (+) through Nhe I/HindIII double digestion, obtains platform plasmid pEGFP-C1.
1.1.2pEGFP-3C structure
The EV713C protein coding gene is inserted pEGFP-C1 flexibly connect segmental 3 ' end, be configured to vector plasmid pEGFP-3C.According to EV713C (Genebank number: the primer sequence of cDNA sequences Design pcr amplification EV713C GI226510739) is following:
P11 (upstream primer): 5 '-ACAAGGGAAGCTTGGCCCTAGCCTTGATTTTGCTCT-3 '
P12 (downstream primer): 5 '-GCGCGCTCTAGATTGTTCACTAGCAAAGTAACTC-3 '
With plasmid pEV71 (Yao Xin, etc.Enterovirns type 71 Beijing strain isolated whole genome sequence is analyzed.China's epidemiology magazine.2009，30（7）：729-732。) be template, use primer P11/P12 amplification 3C gene fragment, the PCR reaction conditions is: 95 ℃ of 10min, 95 ℃ of 45s, 60 ℃ of 50s, 72 ℃ of 45s totally 30 circulations, 72 ℃ are fully extended 5min again.With glue reclaim 3C gene fragment that purifying obtains through Hind III/Xba I with handle through identical double digestion after the pEGFP-C1 connection, obtain the carrier for expression of eukaryon pEGFP-3C of EV713C.
1.1.3pEGFP-m3C structure
Is Serine with the 147th amino acid among the EV713C from cysteine mutation; Make it lose nicking activity (Weng KF; Li ML; Hung C T, Shih S R.Enterovirus713C protease cleaves a novel targetCstF-64 and inhibits cellular polyadenylation.PLoS Pathog.2009,5 (9): e1000593.); And the 3C protein coding gene (m3C) after will suddenling change inserts pEGFP-C1 and flexibly connects segmental 3 ' end, is configured to vector plasmid pEGFP-m3C.The primer sequence of 3C encoding sox upper semisection of wherein increasing is following:
P11 (upstream primer): 5 '-ACAAGGGAAGCTTGGCCCTAGCCTTGATTTTGCTCT-3 '
P13 (downstream primer): 5 '-TCACCACTCCTCCCGACTGTCCT-3 '
The primer sequence of amplification 3C encoding sox lower semisection is following:
P14 (upstream primer): 5 '-CTAAAGCAGGACAGTCGGGAGGA-3 '
P12 (downstream primer): 5 '-GCGCGCTCTAGATTGTTCACTAGCAAAGTAACTC-3 '
With plasmid pEV71 is template, uses primer P11/P13 amplification 3C gene upper semisection, and the PCR reaction conditions is: 95 ℃ of 10min, and 95 ℃ of 45s, 60 ℃ of 50s, 72 ℃ of 45s totally 30 circulations, 72 ℃ are fully extended 5min again.Use primer P14/P12 amplification 3C gene lower semisection, the PCR reaction conditions is: 95 ℃ of 10min, and 95 ℃ of 45s, 60 ℃ of 50s, 72 ℃ of 45s totally 30 circulations, 72 ℃ are fully extended 5min again.Application primer P11/P12 is combined into complete m3C gene fragment with the upper semisection and the lower semisection of 3C gene, and the PCR reaction conditions is: 95 ℃ of 10min, and 95 ℃ of 45s, 60 ℃ of 50s, 72 ℃ of 45s totally 30 circulations, 72 ℃ are fully extended 5min again.
With glue reclaim m3C gene fragment that purifying obtains through Hind III/Xba I with handle through identical double digestion after the pEGFP-C1 connection, obtain the carrier for expression of eukaryon pEGFP-m3C of EV713C.
2. utilize transfection pEGFP-3C checking indication mechanism in the cell
2.1 eukaryotic cell transfection experiment
With African green monkey kidney cell Vero cell (available from U.S. ATCC) with 5 * 10
4The density in individual/hole is laid in 24 orifice plates, places 37 ℃, 5%CO
2Cell culture incubator in cultivate.When cell growth area is the 85%-90% of orifice plate floorage; With 0.8 μ g pEGFP-C1, pEGFP-3C and pEGFP-m3C respectively with 0.8 μ gpANluc (△ Q/G) BCluc-EGFP cotransfection to the Vero cell; Used transfection reagent is Lipofectamine2000 (available from American I nvitrogen), transfection operation with reference reagent specification sheets.
2.2 detect the luciferase expression level after cultivating 24h
Test-results is seen Fig. 3, and is visible from test-results, and the result finds cotransfection pEGFP-3C and pANluc (△ Q/G) BCluc-EGFP group, and the Fluc activity will be apparently higher than control group and m3C.Explain that this indication mechanism can be used for indicating the 3C protease activity.Method and the primer P11/P12 that uses RT-PCR amplification 3C encoding sox the cell RNA after transfection all can be found the rna expression of 3C in the cell of found transfection pEGFP-3C and pEGFP-m3C.
3. utilize the effect of infecting EV71 checking fusion rotein in the cell
With African green monkey kidney cell Vero cell (available from U.S. ATCC) with 5 * 10
4The density in individual/hole is laid in 24 orifice plates, places 37 ℃, 5%CO
2Cell culture incubator in cultivate.When cell growth area is the 85%-90% of orifice plate floorage; With 24h behind 0.8 μ g indication carrier pANluc (△ Q/G) BCluc-EGFP transfection to the Vero cell; Be respectively 1,0.1,0.01,0.001 and 0 the EV71 international standard strain (foundation of enterovirns type 71 (EV71) ICR suckling mouse animal model with MOI; Liu Juan etc., " military medicine " o. 11th in 2011, existing this EV71 strain is kept at Harbin Medical University.) attacking the Vero cell, application cell living body fluorescent imaging system detects uciferase activity in the cell behind the 5h.The result is as shown in Figure 4, and the activity that infects Fluc in the Vero cell of EV71 is apparently higher than infected group not, and the activity of Fluc is with the successively decreasing and reduce of EV71 infective dose simultaneously, explains that this indication mechanism can be used for the level of indicating EV71 to infect.
4. detect the restraining effect that IFN-α and GW5074 duplicate EV71
With African green monkey kidney cell Vero cell (available from U.S. ATCC) with 5 * 10
4The density in individual/hole is laid in 24 orifice plates, places 37 ℃, the cell culture incubator of 5%CO2 to cultivate.When cell growth area is the 85%-90% of orifice plate floorage; With 24h behind 0.8 μ g indication carrier pANluc (△ Q/G) BCluc-EGFP transfection to the Vero cell; Attack the Vero cell with the EV71 of MOI=1, behind the 1h respectively application concentration be 0,20,100,200, IFN-α and the GW5074 effect of 500IU/mL and 0,2.5,5,10,20 μ M.The imaging of application cell living body fluorescent detects uciferase activity in the cell behind the 4h.The result is as shown in Figure 5, and along with increasing of drug level, the activity of Fluc decreases in the cell, explain that IFN-α and GW5074 all have restraining effect for duplicating of EV71, and this indication mechanism can be used for the screening of anti-EV71 medicine.
5. the indicative function that the checking fusion rotein duplicates for EV71 in the body
One day ICR mouse of birth is divided into infected group and control group, and wherein the infected group mouse intracranial is injected 20 μ L1 * 10
7The EV71 of pfu/mL, control group intracranial injection 20 μ L PBS.Infect back 24h, to infected group and the equal intracranial injection 20 μ g indication of control group plasmid.Infected back 2 days and 6 days; Use the living body fluorescent imaging system respectively and observe infected group and control group infection site luciferase expression situation; Find that infected group mouse head Fluc activity all raises than control group; Observe infected group mouse body weight simultaneously and obviously alleviate and occur the tangible EV71 nervous symptoms due to infecting simultaneously,, explain that this indication mechanism can be used for EV71 infection level in the indication body like phenomenons (Fig. 6) such as back acroparalysia and fash.
The above is merely the preferred embodiments of the present invention, only is illustrative for the purpose of the present invention, and nonrestrictive; Those of ordinary skills understand, and in spirit that claim of the present invention limited and scope, can carry out many changes to it, revise, even equivalence change, but all will fall in protection scope of the present invention.
Claims (10)
1. fusion rotein that is used to screen and estimate anti-enterovirns type 71 medicine, it is characterized in that described fusion rotein contain following (a) or (b) shown in aminoacid sequence:
(a) aminoacid sequence shown in the SEQ ID No:1; Or
(b) aminoacid sequence shown in the SEQ ID No.1 is perhaps added the aminoacid sequence that still has the effect of evaluation EV713C protease activity through replacement, the disappearance of one to ten amino-acid residue.
2. fusion rotein as claimed in claim 1, the aminoacid sequence that it is characterized in that described fusion rotein is shown in SEQ ID No:1.
3. the nucleotide sequence of coding claim 1 or 2 described fusion roteins, it is characterized in that described nucleotide sequence contain following (a) and (b) or (c) shown in nucleotide sequence:
(a) nucleotide sequence shown in the SEQ ID No.2; Or
(b) nucleotide sequence of the aminoacid sequence shown in the coding SEQ ID No:1; Or
(c) has the nucleotide sequence that 90% above homology and its encoded protein matter have the effect of evaluation EV713C protease activity with the nucleotide sequence shown in the SEQ ID No.2.
4. nucleotide sequence as claimed in claim 3 is characterized in that described nucleotide sequence is shown in SEQ IDNo.2.
5. a recombinant expression vector is characterized in that containing claim 3 or 4 described nucleotide sequences.
6. recombinant expression vector as claimed in claim 5 is characterized in that described recombinant expression vector is two fluorescence report carriers, and it is made up by following method and obtains:
(1) nucleotide sequence of the N section of the plain enzyme of coding fluorescence and C section is connected with one of nucleotide sequence of encode two micromolecule polypeptide pepA that can combine closely and pepB respectively; Two fragments that obtain are linked to each other by the nucleotide fragments of coding EV713C albumen zymolyte, obtain fusion gene;
(2) this fusion gene is inserted among the carrier for expression of eukaryon pCDNA3.1 (+), set up the expression vector that can be used for indicating the EV713C protease activity;
(3) N end and C are held the green fluorescent protein (EGFP) that has cytomegalovirus (CMV) promotor and vacuolating virus of monkey 40 poly-A tails (SV40polyA tail) respectively; Be called the CMV-EGFP-SV40 fragment; In the carrier for expression of eukaryon that reverse inserting step (2) obtains, obtain described pair of fluorescence report carrier.
7. recombinant expression vector as claimed in claim 6 is characterized in that described pair of fluorescence report carrier is pANluc (△ Q/G) BCluc-EGFP, and its nucleotide sequence is shown in SEQ ID No.4.
8. a host bacterium is characterized in that containing each described recombinant expression vector of claim 5-7.
9. the reagent of the level that infects at preparation indication 3C protease activity, indication EV71 of claim 1 or 2 described fusion roteins or in screening with estimate the application in the anti-enterovirns type 71 medicine.
10. claim 3 or 4 described nucleotides sequences are listed in the reagent of the level for preparing indication 3C protease activity, indication EV71 infection or are screening and estimating the application in the anti-enterovirns type 71 medicine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012102554953A CN102766607A (en) | 2012-07-23 | 2012-07-23 | Fusion protein for screening and evaluating anti-enterovirus 71 medicine and application of fusion protein |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012102554953A CN102766607A (en) | 2012-07-23 | 2012-07-23 | Fusion protein for screening and evaluating anti-enterovirus 71 medicine and application of fusion protein |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102766607A true CN102766607A (en) | 2012-11-07 |
Family
ID=47094184
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012102554953A Pending CN102766607A (en) | 2012-07-23 | 2012-07-23 | Fusion protein for screening and evaluating anti-enterovirus 71 medicine and application of fusion protein |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102766607A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105067574A (en) * | 2015-06-18 | 2015-11-18 | 山东省医学科学院基础医学研究所 | EV71 3C protease action target point detection kit and EV71 3C protease action target point detection method |
| CN105255995A (en) * | 2015-11-23 | 2016-01-20 | 江苏康缘药业股份有限公司 | Hand-foot-and-mouth disease resistant drug activity detection method and kit |
| CN106916795A (en) * | 2015-12-24 | 2017-07-04 | 中国科学院深圳先进技术研究院 | A kind of adjustable luciferase segmentation fusion protein, its preparation method and application |
| CN111875709A (en) * | 2020-06-30 | 2020-11-03 | 中山大学 | Fusion protein and application thereof in constructing system for screening coronavirus 3CL protease inhibitor |
| CN112094822A (en) * | 2019-06-02 | 2020-12-18 | 复旦大学 | Infectious cDNA clone based on EV71 strain and application thereof |
| CN117106851A (en) * | 2023-10-20 | 2023-11-24 | 浙江迪福润丝生物科技有限公司 | Screening method for EV71 protease inhibitor and inhibition effect evaluation method |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050144661A1 (en) * | 2003-08-06 | 2005-06-30 | David Piwnica-Worms | Imaging regulated protein-protein interactions in cells and living animals by enhanced luciferase protein fragment complementation |
| CN101985477A (en) * | 2009-12-29 | 2011-03-16 | 中国人民解放军军事医学科学院野战输血研究所 | Fusion protein for evaluating HCV NS3/4A serine proteinase inhibitor and application thereof |
-
2012
- 2012-07-23 CN CN2012102554953A patent/CN102766607A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050144661A1 (en) * | 2003-08-06 | 2005-06-30 | David Piwnica-Worms | Imaging regulated protein-protein interactions in cells and living animals by enhanced luciferase protein fragment complementation |
| CN101985477A (en) * | 2009-12-29 | 2011-03-16 | 中国人民解放军军事医学科学院野战输血研究所 | Fusion protein for evaluating HCV NS3/4A serine proteinase inhibitor and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| D. THORMEYER, ET AL.: "Characterization of lacZ Complementation Deletions Using Membrane Receptor Dimerization", 《BIOTECHNIQUES》 * |
| JULIA M. COPPOLA, ET AL.: "Non-invasive imaging of apoptosis and its application in cancer therapeutics", 《CLIN CANCER RES.》 * |
| KUO-FENG WENG, ET AL.: "Enterovirus 71 3C Protease Cleaves a Novel Target CstF-64 and Inhibits Cellular Polyadenylation", 《PLOS PATHOGENS》 * |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105067574A (en) * | 2015-06-18 | 2015-11-18 | 山东省医学科学院基础医学研究所 | EV71 3C protease action target point detection kit and EV71 3C protease action target point detection method |
| CN105067574B (en) * | 2015-06-18 | 2017-11-14 | 山东省医学科学院基础医学研究所 | EV71 HRV 3CP action target spot detection kits and detection method |
| CN105255995A (en) * | 2015-11-23 | 2016-01-20 | 江苏康缘药业股份有限公司 | Hand-foot-and-mouth disease resistant drug activity detection method and kit |
| CN105255995B (en) * | 2015-11-23 | 2019-02-05 | 江苏康缘药业股份有限公司 | A kind of anti-hand-foot-and-mouth-disease pharmaceutical activity detection method and its kit |
| CN106916795A (en) * | 2015-12-24 | 2017-07-04 | 中国科学院深圳先进技术研究院 | A kind of adjustable luciferase segmentation fusion protein, its preparation method and application |
| CN112094822A (en) * | 2019-06-02 | 2020-12-18 | 复旦大学 | Infectious cDNA clone based on EV71 strain and application thereof |
| CN111875709A (en) * | 2020-06-30 | 2020-11-03 | 中山大学 | Fusion protein and application thereof in constructing system for screening coronavirus 3CL protease inhibitor |
| CN111875709B (en) * | 2020-06-30 | 2022-04-01 | 中山大学 | Fusion protein and application thereof in constructing system for screening coronavirus 3CL protease inhibitor |
| CN117106851A (en) * | 2023-10-20 | 2023-11-24 | 浙江迪福润丝生物科技有限公司 | Screening method for EV71 protease inhibitor and inhibition effect evaluation method |
| CN117106851B (en) * | 2023-10-20 | 2024-02-06 | 浙江迪福润丝生物科技有限公司 | Screening method for EV71 protease inhibitor and inhibition effect evaluation method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102766607A (en) | Fusion protein for screening and evaluating anti-enterovirus 71 medicine and application of fusion protein | |
| Shang et al. | A naturally occurring recombinant enterovirus expresses a torovirus deubiquitinase | |
| Scheel et al. | Productive homologous and non-homologous recombination of hepatitis C virus in cell culture | |
| Tekes et al. | Genome organization and reverse genetic analysis of a type I feline coronavirus | |
| Phuektes et al. | Mapping genetic determinants of the cell-culture growth phenotype of enterovirus 71 | |
| CN112353939B (en) | Application of GTPBP4 protein as immunosuppressant and construction of cell line for knocking down or over expressing GTPBP4 | |
| CN104911152A (en) | Recombination infectious haematopoietic necrosis virus (rIHNV HLJ-09) strain and construction method and application thereof | |
| Song et al. | Evolution of poliovirus defective interfering particles expressing Gaussia luciferase | |
| CN110468155A (en) | It is a kind of for saving the system, method and application of chitling road A type coronavirus | |
| CN106636001B (en) | Construction method and application of recombinant enterovirus phenotype mixing system | |
| Liu et al. | An optimized circular polymerase extension reaction-based method for functional analysis of SARS-CoV-2 | |
| Symes et al. | Novel assay to quantify recombination in a calicivirus | |
| Dalmann et al. | Autonomously replicating RNAs of Bungowannah pestivirus: ERNS is not essential for the generation of infectious particles | |
| Tzeng et al. | Rubella virus capsid protein modulation of viral genomic and subgenomic RNA synthesis | |
| CN1882690B (en) | Nucleic acid and gene originating in novel hcv strain and replicon-replicating cell using the gene | |
| CN115786280A (en) | Recombinant GI type Japanese encephalitis virus stably expressing red fluorescent protein mCherry and construction method and application thereof | |
| Zhou et al. | Establishment of an efficient and flexible genetic manipulation platform based on a fosmid library for rapid generation of recombinant pseudorabies virus | |
| CN101356280A (en) | Growth of wild-type hepatitis a virus in cell culture | |
| CN110791526B (en) | Mutant foot-and-mouth disease virus infectious clone and preparation method and application thereof | |
| CN106754758A (en) | A kind of construction method of the restructuring enterovirus phenotype hybrid system of factor-containing adjuvant and its application | |
| Liang et al. | A replicon trans-packaging system reveals the requirement of nonstructural proteins for the assembly of bovine viral diarrhea virus (BVDV) virion | |
| CN103305478B (en) | The living imaging tracing system of vaccinia virus and application thereof | |
| CN111235114A (en) | EV71 replication-defective virus and preparation method and application thereof | |
| CN117110269B (en) | Screening method of JEV protease inhibitor and inhibition effect evaluation method | |
| Zhao et al. | Successful establishment of a reverse genetic system for QX-type infectious bronchitis virus and technical improvement of the rescue procedure |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20121107 |