CN101985477A - Fusion protein for evaluating HCV NS3/4A serine proteinase inhibitor and application thereof - Google Patents

Abstract

The invention discloses fusion protein for evaluating an HCV NS3/4A serine proteinase inhibitor and application thereof. In the fusion protein, firefly luciferase is used as a reporter gene, two closely bound small molecule polypeptides are bound with firefly luciferase segments at an N end and a C end respectively, the middle segments of the closely bound small molecule polypeptides are connected by an NS3/4A serine proteinase substrate, and the fusion protein is expressed and generated after a fusion gene is inserted into an eukaryon expression vector to form an indication vector. When the indication vector is used, the activity of the serine protease can be simply, rapidly, flexibly and quantitatively indicated, and the fusion protein has a high practical application value and has an excellent application prospect in the field of medicines.

Description

Be used to estimate the fusion rotein and the application thereof of HCV NS3/4A serpin

Technical field

The invention belongs to biological field, relate to the appraisement system of HCV NS3/4A serpin, particularly relate to a kind of fusion rotein and application thereof that can be used for estimating HCV NS3/4A serine protease.

Background technology

(Hepatitis C Virus, HCV) human health in positive serious harm to hepatitis C virus.China HCV the infected has reached 6,000 ten thousand.50-80% changes chronic infection into after the HCV acute infection, and 10-20% wherein develops into liver cirrhosis, and closely related with the generation of hepatocellular carcinoma.HCV is the sub-thread positive chain RNA virus, belong to flaviviridae, about 9600 Nucleotide of total length, 3010 amino acid whose polyprotein precursors of ORF district coding, protease cracking through host and viral genes encoding own is ten functional fragments, comprises 4 structural protein (core protein C, envelope protein E1, E2 and P7) and 6 Nonstructural Proteins (NS2, NS3, NS4A, NS4B, NS5A and NS5B).

HCV NS3/4A albumen has serine protease, participate in viral protein translation post-treatment, NS4A auxiliary down can catalytic pyrolysis NS3-NS4A, the tie point of NS4A-NS4B, NS4B-NS5A and NS5A-NS5B, the maturation of HCV Nonstructural Protein is played a key effect.Therefore, suppress HCV NS3/4A serine protease, can stop the maturation of HCV Nonstructural Protein.HCV NS3/4A inhibitor can become the anti-hepatitis c virus medicine.

For many years, research at HCV NS3/4A inhibitor makes encouraging progress, but owing to lack the ideal appraisement system, the action effect of the anti-HCV of these medicines is difficult to make assessment, greatly delayed these medicines and entered clinically, thereby set up a kind of ideal and be applicable to that HCV NS3/4A protein inhibitor screening and appraisement system are extremely urgent.

Summary of the invention

The invention provides a kind of fusion rotein that is used to estimate HCV NS3/4A serine protease.

The fusion rotein that is used to estimate HCV NS3/4A serine protease provided by the present invention, be to be reporter gene with the Photinus pyralis LUC, two micromolecule polypeptides that can combine closely combine with the Photinus pyralis LUC fragment of N end and C end respectively, middle continuous by NS3/4A serine protease effect substrate, this fusion gene is inserted express generation after carrier for expression of eukaryon forms indication carrier then.

Described two micromolecule polypeptide pepA and pepB are for combining closely and not influencing the protein molecular of cell function; Described NS3/4A serine protease effect substrate is the tie point of NS3/NS4A, NS4A/4B, NS4B/NS5A, NS5A/NS5B.

Described indication carrier be expressed in the cell in vitro horizontal expression, or express in animal body by genetically modified mode.

Specifically, but the fusion gene called after ANluc-NS5A/B-BCluc that described NS3/4A serine protease effect substrate is the tie point of NS5A/NS5B is one of following nucleotide sequence:

1) dna sequence dna of SEQ ID NO:2 in the sequence table;

2) aminoacid sequence of SEQ ID NO:1 in the code sequence tabulation;

3) with sequence table in the nucleotide sequence that limits of SEQ ID NO:2 have 90% above homology and have the nucleotide sequence of evaluation HCV NS3/4A serine protease effect;

4) nucleotide sequence of the dna sequence dna hybridization that under the rigorous condition of height, can limit with the SEQ ID NO:2 in the sequence table.

The rigorous condition of described height for hybridization back with contain 0.1 * SSPE (or 0.1 * SSC), the solution of 0.1%SDS washes film under 65 ℃.

SEQ ID NO:2 in the sequence table is by 1923 based compositions, its encoding sequence is from 5 ' end the 7th bit base, coding has the protein of the amino acid residue sequence of SEQ ID NO:1 in the sequence table, from 5 ' end the 10th bit base coding pepA, Photinus pyralis LUC fragment from 5 ' end the 76th bit base coding N end, tie point from 5 ' end the 1330th bit base coding NS5A/NS5B, from 5 ' end the 1371st bit base coding pepB, from the Photinus pyralis LUC fragment of 5 ' end the 1461st bit base coding C end.

The fusion rotein of above-mentioned fusion gene ANluc-NS5A/B-BCluc coding is one of following amino acid residue sequences:

1) the SEQ ID NO:1 in the sequence table;

2) with the amino acid residue sequence of SEQ ID NO:1 in the sequence table through replacement, disappearance or the interpolation of one to ten amino-acid residue and have the protein of estimating the effect of HCV NS3/4A serine protease.

SEQ ID NO:1 in the sequence table is made up of 636 amino-acid residues, from aminoterminal the 2nd amino acids residue is pepA, from aminoterminal the 24th amino acids residue is the Photinus pyralis LUC fragment of N end, from aminoterminal the 442nd amino acids residue is the tie point of NS5A/NS5B, from aminoterminal the 455th amino acids residue is pepB, is the Photinus pyralis LUC fragment of C end from aminoterminal the 486th amino acids residue.

The indication carrier of being estimated HCV NS3/4A serine protease by above-mentioned fusion gene being used to of inserting that construction of eukaryotic expression vector forms also is that the present invention is claimed.Concrete, described indication carrier inserts carrier for expression of eukaryon PCI neo with fusion gene ANluc-NS5A/B-BNluc and forms, called after ANluc (Δ NS5A/B) BNluc, and its nucleotide sequence is shown in sequence in the sequence table 11.

Another object of the present invention provides a kind of method of the HCV of evaluation NS3/4A serine protease, and promptly described fusion rotein is in the screening of HCV NS3/4A serpin and the application in the evaluation.

Concrete, this application is under the condition that HCV NS3/4A serpin exists, the cell that contains HCV NS3/4A serine protease with the transfection of above-mentioned indication carrier, the collecting cell sample, detect the expression amount of luciferase in the cell, with this inhibiting rate of measuring HCV NS3/4A serine protease in the cell, obtain HCV NS3/4A serpin Evaluation on effect.

Available recombinant expression vector pCIneo-NS3/4A and indication carrier A Nluc (Δ NS5A/B) the BCluc cotransfection cell that contains HCV NS3/4A serine protease gene.

In described application, described cell is cell in vitro or cells in vivo.

HCV NS3/4A serpin mainly comprises RNA interfering, micromolecular compound and polypeptide.

In addition, if change the effect substrate NS5A/5B of NS3/4A serine protease the effect substrate DEVD of caspase-3 into, ANluc-DEVD-BCluc can be used to refer to apoptosis.

Specifically, being used to indicate apoptotic fusion gene is ANluc-DEVD-BCluc, and its nucleotide sequence is shown in sequence in the sequence table 9.

SEQ ID NO:9 in the sequence table is by 1893 based compositions, its encoding sequence is from 5 ' end the 7th bit base, from 5 ' end the 10th bit base coding pepA, Photinus pyralis LUC fragment from 5 ' end the 76th bit base coding N end, from 5 ' end the 1330th bit base encoding D EVD, from 5 ' end the 1341st bit base coding pepB, from the Photinus pyralis LUC fragment of 5 ' end the 1431st bit base coding C end.

Be used to indicate apoptotic indication carrier that fusion gene ANluc-DEVD-BCluc is inserted carrier for expression of eukaryon PCI neo and form, called after ANluc (DEVD) BCluc, its nucleotide sequence is shown in sequence in the sequence table 10.

Being used to indicate apoptotic method is with above-mentioned indication carrier A Nluc (DEVD) BCluc transfectional cell, the collecting cell sample, and the expression amount of luciferase in the detection cell is with this indicator cells apoptosis.

The present invention adopts branch fragment Photinus pyralis LUC strategy, two sections luciferases are combined with two micromolecule polypeptides that can combine closely respectively, and to utilize NS5A/B be the characteristic of NS3/4A serine protease effect substrate, and substrate fragment NS5A/B is inserted in the middle of two sections Photinus pyralis LUCs.Again this fusion gene is inserted carrier for expression of eukaryon pCIneo, set up expression vector ANluc (Δ NS5A/B) BCluc that can be used for indicating the NS34A serine protease.Expression vector produces fusion rotein at cell inner expression, under the situation that NS3/4A serine protease coexpression is arranged, cutting action takes place at the NS5A/B place, interaction by pepA and pepB, drive the complementary combination of luciferase of N end and C end, thereby form complete luciferase, by measuring the activity that uciferase activity just can reflect the HCVNS3/4A serine protease, as shown in Figure 1.If change NS5A/5B the effect substrate DEVD of caspase-3 into, ANluc (DEVD) BCluc can be used to refer to apoptosis.Utilize indication carrier provided by the invention, not only can be simply, fast, sensitive but also can quantitatively indicate serine protease, have higher actual application value, have broad application prospects at medical field.

Below in conjunction with specific embodiment the present invention is described in further details.

Description of drawings

Fig. 1 is the action principle synoptic diagram of indication carrier A Nluc (Δ NS5A/B) BNluc

Fig. 2 be in the huh-7 cell NS3/4A serine protease to fusion rotein ANluc-NS5A/B-BCluc enzymolysis after the active detected result of Fluc and Western Blot analyze the cutting action of NS3/4A to substrate

Fig. 3 be in the replicon cell NS3/4A serine protease to fusion rotein ANluc-NS5A/B-BCluc enzymolysis after the active detected result of Fluc and Western Blot analyze the cutting action of NS3/4A to substrate

Fig. 4 be in the mouse liver NS3/4A serine protease to fusion rotein ANluc-NS5A/B-BCluc enzymolysis after the active detected result of Fluc and Western Blot analyze the cutting action of NS3/4A to substrate

Fig. 5 is for using Interferon, rabbit and suppress that the active detected result of Fluc and Western Blot after the replicon activity are analyzed the expression of NS3/4A and to the cutting action of substrate

Fig. 6 is for after using different N S3/4A siRNA effect respectively in cell and the mouse liver, and the living body fluorescent imaging detects the expression of active result of Fluc and Western Blot analysis NS3/4A

Fig. 7 is for using drug-induced apoptosis, caspase-3 to fusion rotein ANluc-DEVD-BCluc enzymolysis after the active detected result of Fluc and Western Blot detect its cutting action

Embodiment

The detection of HCV NS3/4A serine protease and evaluation do not have a kind of very desirable and direct method at present.The present invention can obtain HCV NS3/4A serine protease by the expression amount that detects luciferase by the indication carrier of a kind of fusion rotein of design as fluoroscopic examination.

The design of fusion rotein of the present invention, the main employing divided fragment Photinus pyralis LUC strategy, two sections luciferases are combined with two micromolecule polypeptides that can combine closely respectively, and to utilize NS5A/B be the characteristic of NS3/4A serine protease effect substrate, and substrate fragment NS5A/B is inserted in the middle of two sections Photinus pyralis LUCs.Again this fusion gene is inserted carrier for expression of eukaryon pCIneo, foundation can be used for indicating expression vector ANluc (Δ NS5A/B) BCluc of NS34A serine protease.ANluc (Δ NS5A/B) BCluc expression vector produces fusion rotein at cell inner expression, under the situation that NS3/4A serine protease coexpression is arranged, cutting action takes place at the NS5A/B place, interaction by pepA and pepB, drive the complementary combination of luciferase of N end and C end, thereby form complete luciferase, by measuring the activity that uciferase activity just can reflect HCV NS3/4A serine protease.

Describe design of the present invention in detail with specific embodiment below.

Should be appreciated that following examples are not construed as limiting the invention, based on design philosophy of the present invention, NS3/4A serine protease effect substrate NS5A/5B can be replaced by the tie point of NS3-NS4A, NS4A-4B, NS4B-NS5A and NS5A-NS5B.If change NS5A/5B the effect substrate DEVD of caspase-3 into, this system can also be used to the indicator cells apoptosis.Method therefor is ordinary method if no special instructions among the following embodiment, and the primer is synthetic by AudioCodes, and used enzyme preparation and recovery test kit are all available from TaKaRa company.

The structure of embodiment 1, indication carrier A Nluc (Δ NS5A/B) BCluc

According to Fluc (Genebank number: the segmental primer of cDNA sequences Design pcr amplification said gene gi|13195703), primer sequence is as follows:

PA：5- CTCGAGATGAACGAAGCATATGTACATGACGGTCCTGTACGCTCACTGAACAGCGGCCGCAG-3

PB：5- GTCGACAAGGCACGAAAGGAAGCAGAACTGGCAGCAGCAACTGCAGAACAGAGCGGCCGCAG-3

The primer of amplification N-luc (the Photinus pyralis LUC fragment of N end):

The PC:(upstream primer)

5-CTCACTGAACAGCGGCCGCAGAAGTATAGCAACAGAAGACGCCAAAAACATAAAGA-3

PD: downstream primer 5-ATCCTTGTCAATCAAGGCGTTGGTCG-3

The primer of amplification C-luc (the Photinus pyralis LUC fragment of C end):

The PE:(upstream primer)

5-CTGCAGAACAGAGCGGCCGCAGACCAGCATGCAAAATACCAGGTTATGTAAACAATCCGGAA-3

The PF:(downstream primer) 5- CCCGGGTTACAATTTGGACTTTCCGCCCT-3

The primer of amplification NS5A/B:

PG:(primer-1) 5 '-AGCAGACGACGTCCTCACTAGCCTCCTCGCCTCCTCCTCCATCCTTGT-3 '

PH:(primer-2) 5 '-GTCGACTCCTCCTCCGTAGGACATCGAGCAGCAGACGACGTCCTCACTA-3 '

With the plasmid that contains firefly luciferase gene is template, use respectively primer to PC/PD and primer to PE/PF, pcr amplification N-luc and C-luc.The PCR system is as follows: 10 * PCR damping fluid, 5 μ l, each 1 μ l of upstream and downstream primer, dNTP1 μ l, template 0.5 μ l, Pyrobest high-fidelity DNA polymerase 0.25 μ l, deionization distilled water 42.25 μ l, cumulative volume 50 μ l.The PCR reaction conditions is respectively: 94 ℃ of 5min, 94 ℃ of 30s → 55 ℃ 30s → 72 ℃ of 1min (30cycle), 72 ℃ of 5min:94 ℃ of 5min, 94 ℃ of 30s → 55 ℃ 30s → 72 ℃ of 1min (30cycle), 72 ℃ of 5min.N-luc that amplifies and C-luc fragment connect into T carrier pGEM-T (available from Promega) respectively, are contained the recombinant vectors of N-luc and C-luc respectively, called after pGEM-T-Nluc and pGEM-T-Cluc.

PGEM-T-Nluc and pGEM-T-Cluc with above-mentioned structure is template respectively, use respectively primer to PA/PG and primer to PB/PF, pcr amplification pepANluc-NS5A/B-1 and pepBCluc.The pepANluc-NS5A/B-1 fragment that amplifies connects into the T carrier, and linked system is the same.

PGEM-T-pepANluc-NS5A/B-1 plasmid with above-mentioned structure is a template, uses primer to PA/PH, pcr amplification pepANluc-NS5A/B.

The building process of indication carrier A Nluc (Δ NS5A/B) BCluc: pepBCluc that pcr amplification is obtained and pepANluc-NS5A/B gene are respectively through Xho I/Sal I and Sal I/Sma I double digestion, reclaim the back and insert the carrier pCIneo (available from Promega) that handles through XhoI/Sma I double digestion, obtain carrier A Nluc (Δ NS5A/B) BCluc.

Indication carrier A Nluc (Δ NS5A/B) the BCluc sequence that present embodiment obtains is seen sequence 11 in the sequence table, wherein the ANluc-NS5A/B-BCluc gene is shown in SEQ ID NO:2 in the sequence table, by 1293 based compositions, its encoding sequence is from 5 ' end the 1097th bit base, coding has the protein of the amino acid residue sequence of SEQ ID NO:1 in the sequence table, from 5 ' end the 1100th bit base coding pepA, Photinus pyralis LUC fragment from 5 ' end the 1166th bit base coding N end, tie point from 5 ' end the 2420th bit base coding NS5A/NS5B, from 5 ' end the 2461st bit base coding pepB, from the Photinus pyralis LUC fragment of 5 ' end the 2551st bit base coding C end.

In the concrete operations, enzyme is cut and connected: all restriction enzymes are Takana company product, the digestion time of restriction enzyme and the concentration of enzyme-to-substrate determine flexibly according to the activity unit of enzyme, choose and obtain the required damping fluid of high reactivity, whether enzymolysis time has the asterisk vigor according to the consumption of enzymic activity and enzyme-to-substrate and used enzyme determines flexibly, enzyme is cut the T4 dna ligase of the connection use Promega company of product, the volume of ligation is 10 μ l, 10 * connection damping fluid volume is 1 μ l, the volume of 3u/ μ l ligase enzyme is 1 μ l, the amount of plasmid and PCR enzymolysis product determines flexibly that according to concentration separately condition of contact is 4 ℃ of connections of spending the night.The PCR product connects test kit with using Promega pGEM-T carrier being connected of pGEM-T carrier after gel electrophoresis is reclaimed, 10 * fast connect damping fluid (T4 DNAligase) 1 μ l, pGEM-T carrier 1 μ l, the volume of 3u/ μ l ligase enzyme is 1 μ l, the amount that PCR reclaims product adds flexibly according to concentration, adding distilled water to final volume is 10 μ l, 4 ℃ of connections of spending the night.

The transformed competence colibacillus bacterium: get a pipe competence bacteria, in Bechtop, add and connect product, the add-on that connects product determines flexibly according to concentration, rotates mixing gently, ice bath 30min.Transfer to immediately in 42 ℃ of water-baths and place 1.5min, place ice bath rapidly, every pipe adds 0.5ml non-resistant LB substratum, and after 37 ℃ of shaking baths were cultivated 45min, the agarose plate of coating corresponding resistant after room temperature is dried, was put 37 ℃ of thermostat containers and is inverted overnight incubation.The amount of the converted product of coated plate and whether centrifugal concentratedly determine flexibly according to transformation efficiency.

Embodiment 2, utilize in the cell and mouse liver in cotransfection NS3/4A albumen checking indication mechanism

One, the structure of carrier pCIneo-NS3/4A and pCIneo-mNS3/4A

According to NS3/4A (Genebank number: the segmental primer of cDNA sequence gi|28921568) (referring to sequence table 12) design pcr amplification said gene, primer sequence is as follows:

The primer of amplification NS3/4A

PE (upstream primer): GCTAGCATGGCGCCTATTACGGCCTACTC

PF (downstream primer): GAATTCTGTTCGATGTAAGGGAGGTG

The primer of amplification mNS3/4A

PG (upstream primer): TGAAGGGCGCCGCGGGCGGTC

PH (downstream primer): GACCGCCCGCGGCGCCCTTCA

With plasmid FL-neo (Highly Permissive Cell Lines for Subgenomic and GenomicHepatitis C Virus RNA Replication; JOURNAL OF VIROLOGY.2002.76:13001-13014) be template, amplification NS3/4A, mNS3/4A gene (negative control), the PCR system is as follows: 10 * PCR damping fluid, 5 μ l, each 1 μ l of upstream and downstream primer, dNTP 1 μ l, template 0.5 μ l, Pyrobest high-fidelity DNA polymerase 0.25 μ l, deionization distilled water 42.25 μ l, cumulative volume 50 μ l, the PCR reaction conditions is: 94 ℃ of 5min, 94 ℃ of 30s → 55 ℃ 30s → 72 ℃ of 1min (30cycle), 72 ℃ of 5min.The NS3/4A gene segment that the clone is obtained passes through the carrier for expression of eukaryon pCIneo (available from Promega) of Nhe I/EcoR I insertion after identical double digestion is handled, and has made up carrier for expression of eukaryon pCIneo-NS3/4A and pCIneo-mNS3/4A.

Two, utilize cotransfection NS3/4A albumen checking indication mechanism in the Huh-7 cell

The Huh-7 cell culture medium is selected for use and is contained 10% foetal calf serum (HyClone company), the HEPES of 10mM, the penicillin of 25U/ml, the DMEM of the Streptomycin sulphate of 25 μ g/ml (Gibcol company), cell is with the conventional had digestive transfer culture of the Digestive system of the EDTA that contains 0.25% pancreatin and 0.02%, place 37 ℃ of incubators that contain 5%CO2 to cultivate), Lipofectamine2000 (Invetrogen life technologies) is used in transfection, the step of transfection is according to shop instruction, in brief, grow to 70% and merge when in blocks in cell, do not mix fully 1 μ g plasmid and 3 μ l liposomes are not contained the DMEM substratum dilution of serum with 50 μ l after, incubated at room 20min, cell in 24 orifice plates is given a baby a bath on the third day after its birth time with the DMEM that does not contain serum, the mixture that to hatch joins in the respective aperture then, add the DMEM that 450 μ l do not contain serum, place 37 ℃ of incubators that contain 5%CO2 to cultivate transfectional cell, add 20% foetal calf serum behind the 6h, perhaps will add complete DMEM substratum behind the cell washing.

With indication carrier A Nluc (Δ NS5A/B) BCluc respectively with carrier for expression of eukaryon pCIneo-NS3/4A and pCIneo-mNS3/4A cotransfection Huh-7 cell, collecting cell behind the 48h, use two luciferase detection kit (Promega respectively, Madison, WI USA) detects uciferase activity in the cell with the imaging of cell living body fluorescent, and the result shows referring to Fig. 2, in the Huh-7 cell of cotransfection NS3/4A serine protease, the Fluc activity will be apparently higher than control group (P＜0.05).Simultaneously, immunoblotting Western blot is (referring to Fig. 2, swimming lane 1 is the Huh-7 cell behind ANluc (Δ NS5A/B) BCluc and the pCIneo cotransfection, swimming lane 2 is the Huh-7 cell behind ANluc (Δ NS5A/B) BCluc and the pCIneo-mNS3/4A cotransfection, swimming lane 3 is the Huh-7 cell behind ANluc (Δ NS5A/B) BCluc and the pCIneo-mNS3/4A cotransfection) analyze, can see that NS3/4A to ANluc (Δ NS5A/B) BCluc cutting action has taken place.Illustrate that this indication plasmid can be used to refer to the NS3/4A serine protease.

Three, utilize the NS3/4A albumen checking indication mechanism of expressing in the replicon cell (C5B)

(Calif.), the step of all the other cultural methods and transfection is with the Huh-7 cell for Invitrogen, Carlsbad to add the G418 of 500 μ g/ml concentration during the C5B cell cultures in substratum.

Transfection is in Huh-7 and C5B cell respectively for indication carrier A Nluc (Δ NS5A/B) BCluc, and collecting cell sample behind the 48h detects the plain enzymic activity of cell fluorescence with two luciferase detection kit.The result shows that uciferase activity rises about 12 times than Huh-7 cell in the replicon cell.Western blot result shows that ANluc in containing the cell of replicon (Δ NS5A/B) BCluc produces cutting band (referring to Fig. 3).

Four, utilize the NS3/4A albumen checking indication mechanism of expressing in the mouse liver

4～6 age in week 12 of Balb/c mouse, be divided into 2 groups at random, with 10 μ g carrier for expression of eukaryon pCIneo (contrast, Control) and pCIneo-NS3/4A be mixed in the physiological saline that is equivalent to mouse body weight 10% with 10 μ g indication plasmid ANluc (Δ NS5A/B) BCluc respectively, pass through the transfection of tail vein to Balb/c mouse (available from Military Medical Science Institute's Experimental Animal Center) liver at five seconds with interior, passed through the living body fluorescent imaging technique on the the 1st, 4 day respectively at the injection back and detect uciferase activity in the mouse liver.In the mouse body of coexpression NS3/4A serine protease, the Fluc activity will be apparently higher than control group (P＜0.05), and the cutting band is arranged among the Western blot result.Illustrate that this indication plasmid can be used to refer to NS3/4A serine protease (referring to Fig. 4).

The application in drug evaluation of embodiment 3, directive system

One, the application of directive system in IFN-α inhibition HCV duplicates

The C5B cell handles (0,20,100,200 with the IFN-α of different concns, 500units/ml, Schering-Plough Corp., Kenilworth, NJ USA), uses Lipofectamine2000 will indicate plasmid ANluc (Δ NS5A/B) BCluc transfection in cell behind the 72h.Collecting cell and detect uciferase activity in the cell behind the transfection 48h.The result is referring to Fig. 5, and along with the increase of IFN-α concentration of treatment, uciferase activity reduces gradually.Western blot result shows that NS3 is suppressed gradually with the increase of IFN-α concentration of treatment, and the strong and weak expression amount with NS3/4 of cutting band has dose-dependent effect.Illustrate that this indication plasmid can be used for monitoring the restraining effect of IFN-α to NS3/4A in the replicon cell.

Two, the application of directive system in the NS3/4A inhibitor screening

Structure sequence at HCV NS3/4A has designed 3 couples of siRNA, respectively called after sh-1948 (sequence 3 and sequence 4 in the sequence table), sh-2052 (sequence 5 and sequence 6 in the sequence table) and sh-3532 (sequence 7 and sequence 8 in the sequence table).

Annealing forms hair clip type siRNA and msiRNA template oligonucleotide templates, be connected with plasmid pSilencer TM2.1-U6neo (available from Ambion company), use the Invitrogen LipofectamineTM2000 of company respectively with 3 kinds of siRNA expression plasmids and ANluc (Δ NS5A/B) BCluc, NS3/4A expression plasmid cotransfection Huh-7 cell.The result is referring to Fig. 6, and 3 kinds of siRNA have all produced certain restraining effect to the activity of NS3/4A.

In addition; with 4～6 age in week 12 of Balb/c mouse be divided into 2 groups at random; to contain 5 μ g sh-2052 and unloaded expression plasmid thereof and 5 μ g ANluc (Δ NS5A/B) BCluc respectively; 5 μ gNS3/4A expression plasmids add to the physiological saline that is equivalent to Balb/c mouse body weight 10% after mixing; pass through the transfection of tail vein to Balb/c mouse (available from Military Medical Science Institute's Experimental Animal Center) liver at five seconds with interior; detect uciferase activity at transfection 1d and the imaging of 4d living body fluorescent respectively, can see the siRNA expression plasmid has very strong restraining effect (Fig. 6) to HCV NS3/4A.The activity that not only can indicate the NS3/4A serine protease after fusion gene ANluc (Δ NS5A/B) BCluc expresses is described, in the evaluation of anti-HCV NS3/4A serine protease, has good indicative function simultaneously.

The structure of embodiment 4, indication carrier A Nluc (DEVD) BCluc and the indicative function of pair cell apoptosis thereof

One, the structure of indication ANluc (DEVD) BCluc carrier

The primer of amplification DEVD:

5-GTCGACTCCTCCTCCATCGACTTCGTCGCCTCCTCCTCCATCCTTGTCAATCAAGGC-3

The same ANluc of ANluc (DEVD) BCluc vector construction process (Δ NS5A/B) BCluc, its nucleotide sequence as in the sequence table shown in sequence in the sequence table 10, wherein being used to indicate apoptotic fusion gene is ANluc-DEVD-BCluc, its nucleotide sequence is shown in sequence in the sequence table 9, SEQ ID NO:10 in the sequence table is by 7325 based compositions, its encoding sequence is from 5 ' end the 1097th bit base, from 5 ' end the 1100th bit base coding pepA, Photinus pyralis LUC fragment from 5 ' end the 1166th bit base coding N end, from 5 ' end the 2420th bit base encoding D EVD, from 5 ' end the 2431st bit base coding pepB, from the Photinus pyralis LUC fragment of 5 ' end the 2521st bit base coding C end.

Two, cell uses drug-induced apoptosis

The Huh-7 transit cell dyes ANluc (DEVD) BCluc plasmid, transfection renilla luciferase expression plasmid pRL-TK (Promega) is as confidential reference items simultaneously, behind the transfection 24h, use different concns (0,0.8,1.5,2 μ g/ml) inducer of apoptosis is handled cell 24h, and collecting cell also detects uciferase activity, the results are shown in Figure 7, along with the apoptosis induction agent concentration raises, uciferase activity raises.Simultaneously, western result shows that the cutting band strengthens successively.Experimental result shows that this system can be used to refer to apoptosis.

Sequence table

<160>12

<210>1

<211>636

<212>PRT

＜213〉artificial sequence

<220>

<223>

<400>1

Met?Asn?Glu?Ala?Tyr?Val?His?Asp?Gly?Pro?Val?Arg?Ser?Leu?Asn?Ser

1 5 10 15

Gly?Arg?Arg?Ser?Ile?Ala?Thr?Glu?Asp?Ala?Lys?Asn?Ile?Lys?Lys?Gly

20 25 30

Pro?Ala?Pro?Phe?Tyr?Pro?Leu?Glu?Asp?Gly?Thr?Ala?Gly?Glu?Gln?Leu

35 40 45

His?Lys?Ala?Met?Lys?Arg?Tyr?Ala?Leu?Val?Pro?Gly?Thr?Ile?Ala?Phe

50 55 60

Thr?Asp?Ala?His?Ile?Glu?Val?Asn?Ile?Thr?Tyr?Ala?Glu?Tyr?Phe?Glu

65 70 75 80

Met?Ser?Val?Arg?Leu?Ala?Glu?Ala?Met?Lys?Arg?Tyr?Gly?Leu?Asn?Thr

85 90 95

Asn?His?Arg?Ile?Val?Val?Cys?Ser?Glu?Asn?Ser?Leu?Gln?Phe?Phe?Met

100 105 110

Pro?Val?Leu?Gly?Ala?Leu?Phe?Ile?Gly?Val?Ala?Val?Ala?Pro?Ala?Asn

115 120 125

Asp?Ile?Tyr?Asn?Glu?Arg?Glu?Leu?Leu?Asn?Ser?Met?Asn?Ile?Ser?Gln

130 135 140

Pro?Thr?Val?Val?Phe?Val?Ser?Lys?Lys?Gly?Leu?Gln?Lys?Ile?Leu?Asn

145 150 155 160

Val?Gln?Lys?Lys?Leu?Pro?Ile?Ile?Gln?Lys?Ile?Ile?Ile?Met?Asp?Ser

165 170 175

Lys?Thr?Asp?Tyr?Gln?Gly?Phe?Gln?Ser?Met?Tyr?Thr?Phe?Val?Thr?Ser

180 185 190

His?Leu?Pro?Pro?Gly?Phe?Asn?Glu?Tyr?Asp?Phe?Val?Pro?Glu?Ser?Phe

195 200 205

Asp?Arg?Asp?Lys?Thr?Ile?Ala?Leu?Ile?Met?Asn?Ser?Ser?Gly?Ser?Thr

210 215 220

Gly?Leu?Pro?Lys?Gly?Val?Ala?Leu?Pro?His?Arg?Thr?Ala?Cys?Val?Arg

225 230 235 240

Phe?Ser?His?Ala?Arg?Asp?Pro?Ile?Phe?Gly?Asn?Gln?Ile?Ile?Pro?Asp

245 250 255

Thr?Ala?Ile?Leu?Ser?Val?Val?Pro?Phe?His?His?Gly?Phe?Gly?Met?Phe

260 265 270

Thr?Thr?Leu?Gly?Tyr?Leu?Ile?Cys?Gly?Phe?Arg?Val?Val?Leu?Met?Tyr

275 280 285

Arg?Phe?Glu?Glu?Glu?Leu?Phe?Leu?Arg?Ser?Leu?Gln?Asp?Tyr?Lys?Ile

290 295 300

Gln?Ser?Ala?Leu?Leu?Val?Pro?Thr?Leu?Phe?Ser?Phe?Phe?Ala?Lys?Ser

305 310 315 320

Thr?Leu?Ile?Asp?Lys?Tyr?Asp?Leu?Ser?Asn?Leu?His?Glu?Ile?Ala?Ser

325 330 335

Gly?Gly?Ala?Pro?Leu?Ser?Lys?Glu?Val?Gly?Glu?Ala?Val?Ala?Lys?Arg

340 345 350

Phe?His?Leu?Pro?Gly?Ile?Arg?Gln?Gly?Tyr?Gly?Leu?Thr?Glu?Thr?Thr

355 360 365

Ser?Ala?Ile?Leu?Ile?Thr?Pro?Glu?Gly?Asp?Asp?Lys?Pro?Gly?Ala?Val

370 375 380

Gly?Lys?Val?Val?Pro?Phe?Phe?Glu?Ala?Lys?Val?Val?Asp?Leu?Asp?Thr

385 390 395 400

Gly?Lys?Thr?Leu?Gly?Val?Asn?Gln?Arg?Gly?Glu?Leu?Cys?Val?Arg?Gly

405 410 415

Pro?Met?Ile?Met?Ser?Gly?Tyr?Val?Asn?Asn?Pro?Glu?Ala?Thr?Asn?Ala

420 425 430

Leu?Ile?Asp?Lys?Asp?Gly?Gly?Gly?Gly?Glu?Glu?Ala?Ser?Glu?Asp?Val

435 440 445

Val?Cys?Cys?Ser?Met?Ser?Tyr?Gly?Gly?Gly?Val?Asp?Lys?Ala?Arg?Lys

450 455 460

Glu?Ala?Glu?Leu?Ala?Ala?Ala?Thr?Ala?Glu?Gln?Ser?Gly?Arg?Arg?Pro

465 470 475 480

Ala?Cys?Lys?Ile?Pro?Gly?Tyr?Val?Asn?Asn?Pro?Glu?Ala?Thr?Asn?Ala

485 490 495

Leu?Ile?Asp?Lys?Asp?Gly?Trp?Leu?His?Ser?Gly?Asp?Ile?Ala?Tyr?Trp

500 505 510

Asp?Glu?Asp?Glu?His?Phe?Phe?Ile?Val?Asp?Arg?Leu?Lys?Ser?Leu?Ile

515 520 525

Lys?Tyr?Lys?Gly?Tyr?Gln?Val?Ala?Pro?Ala?Glu?Leu?Glu?Ser?Ile?Leu

530 535 540

Leu?Gln?His?Pro?Asn?Ile?Phe?Asp?Ala?Gly?Val?Ala?Gly?Leu?Pro?Asp

545 550 555 560

Asp?Asp?Ala?Gly?Glu?Leu?Pro?Ala?Ala?Val?Val?Val?Leu?Glu?His?Gly

565 570 575

Lys?Thr?Met?Thr?Glu?Lys?Glu?Ile?Val?Asp?Tyr?Val?Ala?Ser?Gln?Val

580 585 590

Thr?Thr?Ala?Lys?Lys?Leu?Arg?Gly?Gly?Val?Val?Phe?Val?Asp?Glu?Val

595 600 605

Pro?Lys?Gly?Leu?Thr?Gly?Lys?Leu?Asp?Ala?Arg?Lys?Ile?Arg?Glu?Ile

610 615 620

Leu?Ile?Lys?Ala?Lys?Lys?Gly?Gly?Lys?Ser?Lys?Leu

625 630 635

<210>2

<211>1923

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>2

ctcgagatga?acgaagcata?tgtacatgac?ggtcctgtac?gctcactgaa?cagcggccgc 60

agaagtatag?caacagaaga?cgccaaaaac?ataaagaaag?gcccggcgcc?attctatcct 120

ctagaggatg?gaaccgctgg?agagcaactg?cataaggcta?tgaagagata?cgccctggtt 180

cctggaacaa?ttgcttttac?agatgcacat?atcgaggtga?acatcacgta?cgcggaatac 240

ttcgaaatgt?ccgttcggtt?ggcagaagct?atgaaacgat?atgggctgaa?tacaaatcac 300

agaatcgtcg?tatgcagtga?aaactctctt?caattcttta?tgccggtgtt?gggcgcgtta 360

tttatcggag?ttgcagttgc?gcccgcgaac?gacatttata?atgaacgtga?attgctcaac 420

agtatgaaca?tttcgcagcc?taccgtagtg?tttgtttcca?aaaaggggtt?gcaaaaaatt 480

ttgaacgtgc?aaaaaaaatt?accaataatc?cagaaaatta?ttatcatgga?ttctaaaacg 540

gattaccagg?gatttcagtc?gatgtacacg?ttcgtcacat?ctcatctacc?tcccggtttt 600

aatgaatacg?attttgtacc?agagtccttt?gatcgtgaca?aaacaattgc?actgataatg 660

aattcctctg?gatctactgg?gttacctaag?ggtgtggccc?ttccgcatag?aactgcctgc 720

gtcagattct?cgcatgccag?agatcctatt?tttggcaatc?aaatcattcc?ggatactgcg 780

attttaagtg?ttgttccatt?ccatcacggt?tttggaatgt?ttactacact?cggatatttg 840

atatgtggat?ttcgagtcgt?cttaatgtat?agatttgaag?aagagctgtt?tttacgatcc 900

cttcaggatt?acaaaattca?aagtgcgttg?ctagtaccaa?ccctattttc?attcttcgcc 960

aaaagcactc?tgattgacaa?atacgattta?tctaatttac?acgaaattgc?ttctgggggc 1020

gcacctcttt?cgaaagaagt?cggggaagcg?gttgcaaaac?gcttccatct?tccagggata 1080

cgacaaggat?atgggctcac?tgagactaca?tcagctattc?tgattacacc?cgagggggat 1140

gataaaccgg?gcgcggtcgg?taaagttgtt?ccattttttg?aagcgaaggt?tgtggatctg 1200

gataccggga?aaacgctggg?cgttaatcag?agaggcgaat?tatgtgtcag?aggacctatg 1260

attatgtccg?gttatgtaaa?caatccggaa?gcgaccaacg?ccttgattga?caaggatgga 1320

ggaggaggcg?aggaggctag?tgaggacgtc?gtctgctgct?cgatgtccta?cggaggagga 1380

gtcgacaagg?cacgaaagga?agcagaactg?gcagcagcaa?ctgcagaaca?gagcggccgc 1440

agaccagcat?gcaaaatacc?aggttatgta?aacaatccgg?aagcgaccaa?cgccttgatt 1500

gacaaggatg?gatggctaca?ttctggagac?atagcttact?gggacgaaga?cgaacacttc 1560

ttcatagttg?accgcttgaa?gtctttaatt?aaatacaaag?gatatcaggt?ggcccccgct 1620

gaattggaat?cgatattgtt?acaacacccc?aacatcttcg?acgcgggcgt?ggcaggtctt 1680

cccgacgatg?acgccggtga?acttcccgcc?gccgttgttg?ttttggagca?cggaaagacg 1740

atgacggaaa?aagagatcgt?ggattacgtc?gccagtcaag?taacaaccgc?gaaaaagttg 1800

cgcggaggag?ttgtgtttgt?ggacgaagta?ccgaaaggtc?ttaccggaaa?actcgacgca 1860

agaaaaatca?gagagatcct?cataaaggcc?aagaagggcg?gaaagtccaa?attgtaaccc 1920

ggg

1923

<210>3

<211>29

<212>RNA

＜213〉artificial sequence

<220>

<223>

<400>3

aagacagucc?aacacacgcc?accugucuc 29

<210>4

<211>29

<212>RNA

＜213〉artificial sequence

<220>

<223>

<400>4

aauggcgugu?guuggacugu?cccugucuc 29

<210>5

<211>19

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>5

ccaggaccuc?gucggcugg 19

<210>6

<211>19

<212>RNA

＜213〉artificial sequence

<220>

<223>

<400>6

ccagccgacg?agguccugg 19

<210>7

<211>19

<212>RNA

＜213〉artificial sequence

<220>

<223>

<400>7

cgagguuacu?accacacac 19

<210>8

<211>19

<212>RNA

＜213〉artificial sequence

<220>

<223>

<400>8

guguguggua?guaaccucg 19

<210>9

<211>1893

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>9

ctcgagatga?acgaagcata?tgtacatgac?ggtcctgtac?gctcactgaa?cagcggccgc 60

agaagtatag?caacagaaga?cgccaaaaac?ataaagaaag?gcccggcgcc?attctatcct 120

ctagaggatg?gaaccgctgg?agagcaactg?cataaggcta?tgaagagata?cgccctggtt 180

cctggaacaa?ttgcttttac?agatgcacat?atcgaggtga?acatcacgta?cgcggaatac 240

ttcgaaatgt?ccgttcggtt?ggcagaagct?atgaaacgat?atgggctgaa?tacaaatcac 300

agaatcgtcg?tatgcagtga?aaactctctt?caattcttta?tgccggtgtt?gggcgcgtta 360

tttatcggag?ttgcagttgc?gcccgcgaac?gacatttata?atgaacgtga?attgctcaac 420

agtatgaaca?tttcgcagcc?taccgtagtg?tttgtttcca?aaaaggggtt?gcaaaaaatt 480

ttgaacgtgc?aaaaaaaatt?accaataatc?cagaaaatta?ttatcatgga?ttctaaaacg 540

gattaccagg?gatttcagtc?gatgtacacg?ttcgtcacat?ctcatctacc?tcccggtttt 600

aatgaatacg?attttgtacc?agagtccttt?gatcgtgaca?aaacaattgc?actgataatg 660

aattcctctg?gatctactgg?gttacctaag?ggtgtggccc?ttccgcatag?aactgcctgc 720

gtcagattct?cgcatgccag?agatcctatt?tttggcaatc?aaatcattcc?ggatactgcg 780

attttaagtg?ttgttccatt?ccatcacggt?tttggaatgt?ttactacact?cggatatttg 840

atatgtggat?ttcgagtcgt?cttaatgtat?agatttgaag?aagagctgtt?tttacgatcc 900

cttcaggatt?acaaaattca?aagtgcgttg?ctagtaccaa?ccctattttc?attcttcgcc 960

aaaagcactc?tgattgacaa?atacgattta?tctaatttac?acgaaattgc?ttctgggggc 1020

gcacctcttt?cgaaagaagt?cggggaagcg?gttgcaaaac?gcttccatct?tccagggata 1080

cgacaaggat?atgggctcac?tgagactaca?tcagctattc?tgattacacc?cgagggggat 1140

gataaaccgg?gcgcggtcgg?taaagttgtt?ccattttttg?aagcgaaggt?tgtggatctg 1200

gataccggga?aaacgctggg?cgttaatcag?agaggcgaat?tatgtgtcag?aggacctatg 1260

attatgtccg?gttatgtaaa?caatccggaa?gcgaccaacg?ccttgattga?caaggatgga 1320

ggaggaggcg?acgaagtcga?tggaggagga?gtcgacaagg?cacgaaagga?agcagaactg 1380

gcagcagcaa?ctgcagaaca?gagcggccgc?agaccagcat?gcaaaatacc?aggttatgta 1440

aacaatccgg?aagcgaccaa?cgccttgatt?gacaaggatg?gatggctaca?ttctggagac 1500

atagcttact?gggacgaaga?cgaacacttc?ttcatagttg?accgcttgaa?gtctttaatt 1560

aaatacaaag?gatatcaggt?ggcccccgct?gaattggaat?cgatattgtt?acaacacccc 1620

aacatcttcg?acgcgggcgt?ggcaggtctt?cccgacgatg?acgccggtga?acttcccgcc 1680

gccgttgttg?ttttggagca?cggaaagacg?atgacggaaa?aagagatcgt?ggattacgtc 1740

gccagtcaag?taacaaccgc?gaaaaagttg?cgcggaggag?ttgtgtttgt?ggacgaagta 1800

ccgaaaggtc?ttaccggaaa?actcgacgca?agaaaaatca?gagagatcct?cataaaggcc 1860

aagaagggcg?gaaagtccaa?attgtaaccc?ggg 1893

<210>10

<211>7325

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>10

tcaatattgg?ccattagcca?tattattcat?tggttatata?gcataaatca?atattggcta 60

ttggccattg?catacgttgt?atctatatca?taatatgtac?atttatattg?gctcatgtcc 120

aatatgaccg?ccatgttggc?attgattatt?gactagttat?taatagtaat?caattacggg 180

gtcattagtt?catagcccat?atatggagtt?ccgcgttaca?taacttacgg?taaatggccc 240

gcctggctga?ccgcccaacg?acccccgccc?attgacgtca?ataatgacgt?atgttcccat 300

agtaacgcca?atagggactt?tccattgacg?tcaatgggtg?gagtatttac?ggtaaactgc 360

ccacttggca?gtacatcaag?tgtatcatat?gccaagtccg?ccccctattg?acgtcaatga 420

cggtaaatgg?cccgcctggc?attatgccca?gtacatgacc?ttacgggact?ttcctacttg 480

gcagtacatc?tacgtattag?tcatcgctat?taccatggtg?atgcggtttt?ggcagtacac 540

caatgggcgt?ggatagcggt?ttgactcacg?gggatttcca?agtctccacc?ccattgacgt 600

caatgggagt?ttgttttggc?accaaaatca?acgggacttt?ccaaaatgtc?gtaacaactg 660

cgatcgcccg?ccccgttgac?gcaaatgggc?ggtaggcgtg?tacggtggga?ggtctatata 720

agcagagctc?gtttagtgaa?ccgtcagatc?actagaagct?ttattgcggt?agtttatcac 780

agttaaattg?ctaacgcagt?cagtgcttct?gacacaacag?tctcgaactt?aagctgcagt 840

gactctctta?aggtagcctt?gcagaagttg?gtcgtgaggc?actgggcagg?taagtatcaa 900

ggttacaaga?caggtttaag?gagaccaata?gaaactgggc?ttgtcgagac?agagaagact 960

cttgcgtttc?tgataggcac?ctattggtct?tactgacatc?cactttgcct?ttctctccac 1020

aggtgtccac?tcccagttca?attacagctc?ttaaggctag?agtacttaat?acgactcact 1080

ataggctagc?ctcgagatga?acgaagcata?tgtacatgac?ggtcctgtac?gctcactgaa 1140

cagcggccgc?agaagtatag?caacagaaga?cgccaaaaac?ataaagaaag?gcccggcgcc 1200

attctatcct?ctagaggatg?gaaccgctgg?agagcaactg?cataaggcta?tgaagagata 1260

cgccctggtt?cctggaacaa?ttgcttttac?agatgcacat?atcgaggtga?acatcacgta 1320

cgcggaatac?ttcgaaatgt?ccgttcggtt?ggcagaagct?atgaaacgat?atgggctgaa 1380

tacaaatcac?agaatcgtcg?tatgcagtga?aaactctctt?caattcttta?tgccggtgtt 1440

gggcgcgtta?tttatcggag?ttgcagttgc?gcccgcgaac?gacatttata?atgaacgtga 1500

attgctcaac?agtatgaaca?tttcgcagcc?taccgtagtg?tttgtttcca?aaaaggggtt 1560

gcaaaaaatt?ttgaacgtgc?aaaaaaaatt?accaataatc?cagaaaatta?ttatcatgga 1620

ttctaaaacg?gattaccagg?gatttcagtc?gatgtacacg?ttcgtcacat?ctcatctacc 1680

tcccggtttt?aatgaatacg?attttgtacc?agagtccttt?gatcgtgaca?aaacaattgc 1740

actgataatg?aattcctctg?gatctactgg?gttacctaag?ggtgtggccc?ttccgcatag 1800

aactgcctgc?gtcagattct?cgcatgccag?agatcctatt?tttggcaatc?aaatcattcc 1860

ggatactgcg?attttaagtg?ttgttccatt?ccatcacggt?tttggaatgt?ttactacact 1920

cggatatttg?atatgtggat?ttcgagtcgt?cttaatgtat?agatttgaag?aagagctgtt 1980

tttacgatcc?cttcaggatt?acaaaattca?aagtgcgttg?ctagtaccaa?ccctattttc 2040

attcttcgcc?aaaagcactc?tgattgacaa?atacgattta?tctaatttac?acgaaattgc 2100

ttctgggggc?gcacctcttt?cgaaagaagt?cggggaagcg?gttgcaaaac?gcttccatct 2160

tccagggata?cgacaaggat?atgggctcac?tgagactaca?tcagctattc?tgattacacc 2220

cgagggggat?gataaaccgg?gcgcggtcgg?taaagttgtt?ccattttttg?aagcgaaggt 2280

tgtggatctg?gataccggga?aaacgctggg?cgttaatcag?agaggcgaat?tatgtgtcag 2340

aggacctatg?attatgtccg?gttatgtaaa?caatccggaa?gcgaccaacg?ccttgattga 2400

caaggatgga?ggaggaggcg?acgaagtcga?tggaggagga?gtcgacaagg?cacgaaagga 2460

agcagaactg?gcagcagcaa?ctgcagaaca?gagcggccgc?agaccagcat?gcaaaatacc 2520

aggttatgta?aacaatccgg?aagcgaccaa?cgccttgatt?gacaaggatg?gatggctaca 2580

ttctggagac?atagcttact?gggacgaaga?cgaacacttc?ttcatagttg?accgcttgaa 2640

gtctttaatt?aaatacaaag?gatatcaggt?ggcccccgct?gaattggaat?cgatattgtt 2700

acaacacccc?aacatcttcg?acgcgggcgt?ggcaggtctt?cccgacgatg?acgccggtga 2760

acttcccgcc?gccgttgttg?ttttggagca?cggaaagacg?atgacggaaa?aagagatcgt 2820

ggattacgtc?gccagtcaag?taacaaccgc?gaaaaagttg?cgcggaggag?ttgtgtttgt 2880

ggacgaagta?ccgaaaggtc?ttaccggaaa?actcgacgca?agaaaaatca?gagagatcct 2940

cataaaggcc?aagaagggcg?gaaagtccaa?attgtaaccc?gggcggccgc?ttccctttag 3000

tgagggttaa?tgcttcgagc?agacatgata?agatacattg?atgagtttgg?acaaaccaca 3060

actagaatgc?agtgaaaaaa?atgctttatt?tgtgaaattt?gtgatgctat?tgctttattt 3120

gtaaccatta?taagctgcaa?taaacaagtt?aacaacaaca?attgcattca?ttttatgttt 3180

caggttcagg?gggagatgtg?ggaggttttt?taaagcaagt?aaaacctcta?caaatgtggt 3240

aaaatccgat?aaggatcgat?ccgggctggc?gtaatagcga?agaggcccgc?accgatcgcc 3300

cttcccaaca?gttgcgcagc?ctgaatggcg?aatggacgcg?ccctgtagcg?gcgcattaag 3360

cgcggcgggt?gtggtggtta?cgcgcagcgt?gaccgctaca?cttgccagcg?ccctagcgcc 3420

cgctcctttc?gctttcttcc?cttcctttct?cgccacgttc?gccggctttc?cccgtcaagc 3480

tctaaatcgg?gggctccctt?tagggttccg?atttagtgct?ttacggcacc?tcgaccccaa 3540

aaaacttgat?tagggtgatg?gttcacgtag?tgggccatcg?ccctgataga?cggtttttcg 3600

ccctttgacg?ttggagtcca?cgttctttaa?tagtggactc?ttgttccaaa?ctggaacaac 3660

actcaaccct?atctcggtct?attcttttga?tttataaggg?attttgccga?tttcggccta 3720

ttggttaaaa?aatgagctga?tttaacaaaa?atttaacgcg?aattttaaca?aaatattaac 3780

gcttacaatt?tcctgatgcg?gtattttctc?cttacgcatc?tgtgcggtat?ttcacaccgc 3840

atacgcggat?ctgcgcagca?ccatggcctg?aaataacctc?tgaaagagga?acttggttag 3900

gtaccttctg?aggcggaaag?aaccagctgt?ggaatgtgtg?tcagttaggg?tgtggaaagt 3960

ccccaggctc?cccagcaggc?agaagtatgc?aaagcatgca?tctcaattag?tcagcaacca 4020

ggtgtggaaa?gtccccaggc?tccccagcag?gcagaagtat?gcaaagcatg?catctcaatt 4080

agtcagcaac?catagtcccg?cccctaactc?cgcccatccc?gcccctaact?ccgcccagtt 4140

ccgcccattc?tccgccccat?ggctgactaa?ttttttttat?ttatgcagag?gccgaggccg 4200

cctcggcctc?tgagctattc?cagaagtagt?gaggaggctt?ttttggaggc?ctaggctttt 4260

gcaaaaagct?tgattcttct?gacacaacag?tctcgaactt?aaggctagag?ccaccatgat 4320

tgaacaagat?ggattgcacg?caggttctcc?ggccgcttgg?gtggagaggc?tattcggcta 4380

tgactgggca?caacagacaa?tcggctgctc?tgatgccgcc?gtgttccggc?tgtcagcgca 4440

ggggcgcccg?gttctttttg?tcaagaccga?cctgtccggt?gccctgaatg?aactgcagga 4500

cgaggcagcg?cggctatcgt?ggctggccac?gacgggcgtt?ccttgcgcag?ctgtgctcga 4560

cgttgtcact?gaagcgggaa?gggactggct?gctattgggc?gaagtgccgg?ggcaggatct 4620

cctgtcatct?caccttgctc?ctgccgagaa?agtatccatc?atggctgatg?caatgcggcg 4680

gctgcatacg?cttgatccgg?ctacctgccc?attcgaccac?caagcgaaac?atcgcatcga 4740

gcgagcacgt?actcggatgg?aagccggtct?tgtcgatcag?gatgatctgg?acgaagagca 4800

tcaggggctc?gcgccagccg?aactgttcgc?caggctcaag?gcgcgcatgc?ccgacggcga 4860

ggatctcgtc?gtgacccatg?gcgatgcctg?cttgccgaat?atcatggtgg?aaaatggccg 4920

cttttctgga?ttcatcgact?gtggccggct?gggtgtggcg?gaccgctatc?aggacatagc 4980

gttggctacc?cgtgatattg?ctgaagagct?tggcggcgaa?tgggctgacc?gcttcctcgt 5040

gctttacggt?atcgccgctc?ccgattcgca?gcgcatcgcc?ttctatcgcc?ttcttgacga 5100

gttcttctga?gcgggactct?ggggttcgaa?atgaccgacc?aagcgacgcc?caacctgcca 5160

tcacgatggc?cgcaataaaa?tatctttatt?ttcattacat?ctgtgtgttg?gttttttgtg 5220

tgaatcgata?gcgataagga?tccgcgtatg?gtgcactctc?agtacaatct?gctctgatgc 5280

cgcatagtta?agccagcccc?gacacccgcc?aacacccgct?gacgcgccct?gacgggcttg 5340

tctgctcccg?gcatccgctt?acagacaagc?tgtgaccgtc?tccgggagct?gcatgtgtca 5400

gaggttttca?ccgtcatcac?cgaaacgcgc?gagacgaaag?ggcctcgtga?tacgcctatt 5460

tttataggtt?aatgtcatga?taataatggt?ttcttagacg?tcaggtggca?cttttcgggg 5520

aaatgtgcgc?ggaaccccta?tttgtttatt?tttctaaata?cattcaaata?tgtatccgct 580

catgagacaa?taaccctgat?aaatgcttca?ataatattga?aaaaggaaga?gtatgagtat 5640

tcaacatttc?cgtgtcgccc?ttattccctt?ttttgcggca?ttttgccttc?ctgtttttgc 5700

tcacccagaa?acgctggtga?aagtaaaaga?tgctgaagat?cagttgggtg?cacgagtggg 5760

ttacatcgaa?ctggatctca?acagcggtaa?gatccttgag?agttttcgcc?ccgaagaacg 5820

ttttccaatg?atgagcactt?ttaaagttct?gctatgtggc?gcggtattat?cccgtattga 5880

cgccgggcaa?gagcaactcg?gtcgccgcat?acactattct?cagaatgact?tggttgagta 5940

ctcaccagtc?acagaaaagc?atcttacgga?tggcatgaca?gtaagagaat?tatgcagtgc 6000

tgccataacc?atgagtgata?acactgcggc?caacttactt?ctgacaacga?tcggaggacc 6060

gaaggagcta?accgcttttt?tgcacaacat?gggggatcat?gtaactcgcc?ttgatcgttg 6120

ggaaccggag?ctgaatgaag?ccataccaaa?cgacgagcgt?gacaccacga?tgcctgtagc 6180

aatggcaaca?acgttgcgca?aactattaac?tggcgaacta?cttactctag?cttcccggca 6240

acaattaata?gactggatgg?aggcggataa?agttgcagga?ccacttctgc?gctcggccct 6300

tccggctggc?tggtttattg?ctgataaatc?tggagccggt?gagcgtgggt?ctcgcggtat 6360

cattgcagca?ctggggccag?atggtaagcc?ctcccgtatc?gtagttatct?acacgacggg 6420

gagtcaggca?actatggatg?aacgaaatag?acagatcgct?gagataggtg?cctcactgat 6480

taagcattgg?taactgtcag?accaagttta?ctcatatata?ctttagattg?atttaaaact 6540

tcatttttaa?tttaaaagga?tctaggtgaa?gatccttttt?gataatctca?tgaccaaaat 6600

cccttaacgt?gagttttcgt?tccactgagc?gtcagacccc?gtagaaaaga?tcaaaggatc 6660

ttcttgagat?cctttttttc?tgcgcgtaat?ctgctgcttg?caaacaaaaa?aaccaccgct 6720

accagcggtg?gtttgtttgc?cggatcaaga?gctaccaact?ctttttccga?aggtaactgg 6780

cttcagcaga?gcgcagatac?caaatactgt?tcttctagtg?tagccgtagt?taggccacca 6840

cttcaagaac?tctgtagcac?cgcctacata?cctcgctctg?ctaatcctgt?taccagtggc 6900

tgctgccagt?ggcgataagt?cgtgtcttac?cgggttggac?tcaagacgat?agttaccgga 6960

taaggcgcag?cggtcgggct?gaacgggggg?ttcgtgcaca?cagcccagct?tggagcgaac 7020

gacctacacc?gaactgagat?acctacagcg?tgagctatga?gaaagcgcca?cgcttcccga 7080

agggagaaag?gcggacaggt?atccggtaag?cggcagggtc?ggaacaggag?agcgcacgag 7140

ggagcttcca?gggggaaacg?cctggtatct?ttatagtcct?gtcgggtttc?gccacctctg 7200

acttgagcgt?cgatttttgt?gatgctcgtc?aggggggcgg?agcctatgga?aaaacgccag 7260

caacgcggcc?tttttacggt?tcctggcctt?ttgctggcct?tttgctcaca?tggctcgaca 7320

gatct

7325

<210>11

<211>7355

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>11

tcaatattgg?ccattagcca?tattattcat?tggttatata?gcataaatca?atattggcta 60

ttggccattg?catacgttgt?atctatatca?taatatgtac?atttatattg?gctcatgtcc 120

aatatgaccg?ccatgttggc?attgattatt?gactagttat?taatagtaat?caattacggg 180

gtcattagtt?catagcccat?atatggagtt?ccgcgttaca?taacttacgg?taaatggccc 240

gcctggctga?ccgcccaacg?acccccgccc?attgacgtca?ataatgacgt?atgttcccat 300

agtaacgcca?atagggactt?tccattgacg?tcaatgggtg?gagtatttac?ggtaaactgc 360

ccacttggca?gtacatcaag?tgtatcatat?gccaagtccg?ccccctattg?acgtcaatga 420

cggtaaatgg?cccgcctggc?attatgccca?gtacatgacc?ttacgggact?ttcctacttg 480

gcagtacatc?tacgtattag?tcatcgctat?taccatggtg?atgcggtttt?ggcagtacac 540

caatgggcgt?ggatagcggt?ttgactcacg?gggatttcca?agtctccacc?ccattgacgt 600

caatgggagt?ttgttttggc?accaaaatca?acgggacttt?ccaaaatgtc?gtaacaactg 660

cgatcgcccg?ccccgttgac?gcaaatgggc?ggtaggcgtg?tacggtggga?ggtctatata 720

agcagagctc?gtttagtgaa?ccgtcagatc?actagaagct?ttattgcggt?agtttatcac 780

agttaaattg?ctaacgcagt?cagtgcttct?gacacaacag?tctcgaactt?aagctgcagt 840

gactctctta?aggtagcctt?gcagaagttg?gtcgtgaggc?actgggcagg?taagtatcaa 900

ggttacaaga?caggtttaag?gagaccaata?gaaactgggc?ttgtcgagac?agagaagact 960

cttgcgtttc?tgataggcac?ctattggtct?tactgacatc?cactttgcct?ttctctccac 1020

aggtgtccac?tcccagttca?attacagctc?ttaaggctag?agtacttaat?acgactcact 1080

ataggctagc?ctcgagatga?acgaagcata?tgtacatgac?ggtcctgtac?gctcactgaa 1140

cagcggccgc?agaagtatag?caacagaaga?cgccaaaaac?ataaagaaag?gcccggcgcc 1200

attctatcct?ctagaggatg?gaaccgctgg?agagcaactg?cataaggcta?tgaagagata 1260

cgccctggtt?cctggaacaa?ttgcttttac?agatgcacat?atcgaggtga?acatcacgta 1320

cgcggaatac?ttcgaaatgt?ccgttcggtt?ggcagaagct?atgaaacgat?atgggctgaa 1380

tacaaatcac?agaatcgtcg?tatgcagtga?aaactctctt?caattcttta?tgccggtgtt 1440

gggcgcgtta?tttatcggag?ttgcagttgc?gcccgcgaac?gacatttata?atgaacgtga 1500

attgctcaac?agtatgaaca?tttcgcagcc?taccgtagtg?tttgtttcca?aaaaggggtt 1560

gcaaaaaatt?ttgaacgtgc?aaaaaaaatt?accaataatc?cagaaaatta?ttatcatgga 1620

ttctaaaacg?gattaccagg?gatttcagtc?gatgtacacg?ttcgtcacat?ctcatctacc 1680

tcccggtttt?aatgaatacg?attttgtacc?agagtccttt?gatcgtgaca?aaacaattgc 1740

actgataatg?aattcctctg?gatctactgg?gttacctaag?ggtgtggccc?ttccgcatag 1800

aactgcctgc?gtcagattct?cgcatgccag?agatcctatt?tttggcaatc?aaatcattcc 1860

ggatactgcg?attttaagtg?ttgttccatt?ccatcacggt?tttggaatgt?ttactacact 1920

cggatatttg?atatgtggat?ttcgagtcgt?cttaatgtat?agatttgaag?aagagctgtt 1980

tttacgatcc?cttcaggatt?acaaaattca?aagtgcgttg?ctagtaccaa?ccctattttc 2040

attcttcgcc?aaaagcactc?tgattgacaa?atacgattta?tctaatttac?acgaaattgc 2100

ttctgggggc?gcacctcttt?cgaaagaagt?cggggaagcg?gttgcaaaac?gcttccatct 2160

tccagggata?cgacaaggat?atgggctcac?tgagactaca?tcagctattc?tgattacacc 2220

cgagggggat?gataaaccgg?gcgcggtcgg?taaagttgtt?ccattttttg?aagcgaaggt 2280

tgtggatctg?gataccggga?aaacgctggg?cgttaatcag?agaggcgaat?tatgtgtcag 2340

aggacctatg?attatgtccg?gttatgtaaa?caatccggaa?gcgaccaacg?ccttgattga 2400

caaggatgga?ggaggaggcg?aggaggctag?tgaggacgtc?gtctgctgct?cgatgtccta 2460

cggaggagga?gtcgacaagg?cacgaaagga?agcagaactg?gcagcagcaa?ctgcagaaca 2520

gagcggccgc?agaccagcat?gcaaaatacc?aggttatgta?aacaatccgg?aagcgaccaa 2580

cgccttgatt?gacaaggatg?gatggctaca?ttctggagac?atagcttact?gggacgaaga 2640

cgaacacttc?ttcatagttg?accgcttgaa?gtctttaatt?aaatacaaag?gatatcaggt 2700

ggcccccgct?gaattggaat?cgatattgtt?acaacacccc?aacatcttcg?acgcgggcgt 2760

ggcaggtctt?cccgacgatg?acgccggtga?acttcccgcc?gccgttgttg?ttttggagca 2820

cggaaagacg?atgacggaaa?aagagatcgt?ggattacgtc?gccagtcaag?taacaaccgc 2880

gaaaaagttg?cgcggaggag?ttgtgtttgt?ggacgaagta?ccgaaaggtc?ttaccggaaa 2940

actcgacgca?agaaaaatca?gagagatcct?cataaaggcc?aagaagggcg?gaaagtccaa 3000

attgtaaccc?gggcggccgc?ttccctttag?tgagggttaa?tgcttcgagc?agacatgata 3060

agatacattg?atgagtttgg?acaaaccaca?actagaatgc?agtgaaaaaa?atgctttatt 3120

tgtgaaattt?gtgatgctat?tgctttattt?gtaaccatta?taagctgcaa?taaacaagtt 3180

aacaacaaca?attgcattca?ttttatgttt?caggttcagg?gggagatgtg?ggaggttttt 3240

taaagcaagt?aaaacctcta?caaatgtggt?aaaatccgat?aaggatcgat?ccgggctggc 3300

gtaatagcga?agaggcccgc?accgatcgcc?cttcccaaca?gttgcgcagc?ctgaatggcg 3360

aatggacgcg?ccctgtagcg?gcgcattaag?cgcggcgggt?gtggtggtta?cgcgcagcgt 3420

gaccgctaca?cttgccagcg?ccctagcgcc?cgctcctttc?gctttcttcc?cttcctttct 3480

cgccacgttc?gccggctttc?cccgtcaagc?tctaaatcgg?gggctccctt?tagggttccg 3540

atttagtgct?ttacggcacc?tcgaccccaa?aaaacttgat?tagggtgatg?gttcacgtag 3600

tgggccatcg?ccctgataga?cggtttttcg?ccctttgacg?ttggagtcca?cgttctttaa 3660

tagtggactc?ttgttccaaa?ctggaacaac?actcaaccct?atctcggtct?attcttttga 3720

tttataaggg?attttgccga?tttcggccta?ttggttaaaa?aatgagctga?tttaacaaaa 3780

atttaacgcg?aattttaaca?aaatattaac?gcttacaatt?tcctgatgcg?gtattttctc 3840

cttacgcatc?tgtgcggtat?ttcacaccgc?atacgcggat?ctgcgcagca?ccatggcctg 3900

aaataacctc?tgaaagagga?acttggttag?gtaccttctg?aggcggaaag?aaccagctgt 3960

ggaatgtgtg?tcagttaggg?tgtggaaagt?ccccaggctc?cccagcaggc?agaagtatgc 4020

aaagcatgca?tctcaattag?tcagcaacca?ggtgtggaaa?gtccccaggc?tccccagcag 4080

gcagaagtat?gcaaagcatg?catctcaatt?agtcagcaac?catagtcccg?cccctaactc 4140

cgcccatccc?gcccctaact?ccgcccagtt?ccgcccattc?tccgccccat?ggctgactaa 4200

ttttttttat?ttatgcagag?gccgaggccg?cctcggcctc?tgagctattc?cagaagtagt 4260

gaggaggctt?ttttggaggc?ctaggctttt?gcaaaaagct?tgattcttct?gacacaacag 4320

tctcgaactt?aaggctagag?ccaccatgat?tgaacaagat?ggattgcacg?caggttctcc 4380

ggccgcttgg?gtggagaggc?tattcggcta?tgactgggca?caacagacaa?tcggctgctc 4440

tgatgccgcc?gtgttccggc?tgtcagcgca?ggggcgcccg?gttctttttg?tcaagaccga 4500

cctgtccggt?gccctgaatg?aactgcagga?cgaggcagcg?cggctatcgt?ggctggccac 4560

gacgggcgtt?ccttgcgcag?ctgtgctcga?cgttgtcact?gaagcgggaa?gggactggct 4620

gctattgggc?gaagtgccgg?ggcaggatct?cctgtcatct?caccttgctc?ctgccgagaa 4680

agtatccatc?atggctgatg?caatgcggcg?gctgcatacg?cttgatccgg?ctacctgccc 4740

attcgaccac?caagcgaaac?atcgcatcga?gcgagcacgt?actcggatgg?aagccggtct 4800

tgtcgatcag?gatgatctgg?acgaagagca?tcaggggctc?gcgccagccg?aactgttcgc 4860

caggctcaag?gcgcgcatgc?ccgacggcga?ggatctcgtc?gtgacccatg?gcgatgcctg 4920

cttgccgaat?atcatggtgg?aaaatggccg?cttttctgga?ttcatcgact?gtggccggct 4980

gggtgtggcg?gaccgctatc?aggacatagc?gttggctacc?cgtgatattg?ctgaagagct 5040

tggcggcgaa?tgggctgacc?gcttcctcgt?gctttacggt?atcgccgctc?ccgattcgca 5100

gcgcatcgcc?ttctatcgcc?ttcttgacga?gttcttctga?gcgggactct?ggggttcgaa 5160

atgaccgacc?aagcgacgcc?caacctgcca?tcacgatggc?cgcaataaaa?tatctttatt 5220

ttcattacat?ctgtgtgttg?gttttttgtg?tgaatcgata?gcgataagga?tccgcgtatg 5280

gtgcactctc?agtacaatct?gctctgatgc?cgcatagtta?agccagcccc?gacacccgcc 5340

aacacccgct?gacgcgccct?gacgggcttg?tctgctcccg?gcatccgctt?acagacaagc 5400

tgtgaccgtc?tccgggagct?gcatgtgtca?gaggttttca?ccgtcatcac?cgaaacgcgc 5460

gagacgaaag?ggcctcgtga?tacgcctatt?tttataggtt?aatgtcatga?taataatggt 5520

ttcttagacg?tcaggtggca?cttttcgggg?aaatgtgcgc?ggaaccccta?tttgtttatt 5580

tttctaaata?cattcaaata?tgtatccgct?catgagacaa?taaccctgat?aaatgcttca 5640

ataatattga?aaaaggaaga?gtatgagtat?tcaacatttc?cgtgtcgccc?ttattccctt 5700

ttttgcggca?ttttgccttc?ctgtttttgc?tcacccagaa?acgctggtga?aagtaaaaga 5760

tgctgaagat?cagttgggtg?cacgagtggg?ttacatcgaa?ctggatctca?acagcggtaa 5820

gatccttgag?agttttcgcc?ccgaagaacg?ttttccaatg?atgagcactt?ttaaagttct 5880

gctatgtggc?gcggtattat?cccgtattga?cgccgggcaa?gagcaactcg?gtcgccgcat 5940

acactattct?cagaatgact?tggttgagta?ctcaccagtc?acagaaaagc?atcttacgga 6000

tggcatgaca?gtaagagaat?tatgcagtgc?tgccataacc?atgagtgata?acactgcggc 6060

caacttactt?ctgacaacga?tcggaggacc?gaaggagcta?accgcttttt?tgcacaacat 6120

gggggatcat?gtaactcgcc?ttgatcgttg?ggaaccggag?ctgaatgaag?ccataccaaa 6180

cgacgagcgt?gacaccacga?tgcctgtagc?aatggcaaca?acgttgcgca?aactattaac 6240

tggcgaacta?cttactctag?cttcccggca?acaattaata?gactggatgg?aggcggataa 6300

agttgcagga?ccacttctgc?gctcggccct?tccggctggc?tggtttattg?ctgataaatc 6360

tggagccggt?gagcgtgggt?ctcgcggtat?cattgcagca?ctggggccag?atggtaagcc 6420

ctcccgtatc?gtagttatct?acacgacggg?gagtcaggca?actatggatg?aacgaaatag 6480

acagatcgct?gagataggtg?cctcactgat?taagcattgg?taactgtcag?accaagttta 6540

ctcatatata?ctttagattg?atttaaaact?tcatttttaa?tttaaaagga?tctaggtgaa 6600

gatccttttt?gataatctca?tgaccaaaat?cccttaacgt?gagttttcgt?tccactgagc 6660

gtcagacccc?gtagaaaaga?tcaaaggatc?ttcttgagat?cctttttttc?tgcgcgtaat 6720

ctgctgcttg?caaacaaaaa?aaccaccgct?accagcggtg?gtttgtttgc?cggatcaaga 6780

gctaccaact?ctttttccga?aggtaactgg?cttcagcaga?gcgcagatac?caaatactgt 6840

tcttctagtg?tagccgtagt?taggccacca?cttcaagaac?tctgtagcac?cgcctacata 6900

cctcgctctg?ctaatcctgt?taccagtggc?tgctgccagt?ggcgataagt?cgtgtcttac 6960

cgggttggac?tcaagacgat?agttaccgga?taaggcgcag?cggtcgggct?gaacgggggg 7020

ttcgtgcaca?cagcccagct?tggagcgaac?gacctacacc?gaactgagat?acctacagcg 7080

tgagctatga?gaaagcgcca?cgcttcccga?agggagaaag?gcggacaggt?atccggtaag 7140

cggcagggtc?ggaacaggag?agcgcacgag?ggagcttcca?gggggaaacg?cctggtatct 7200

ttatagtcct?gtcgggtttc?gccacctctg?acttgagcgt?cgatttttgt?gatgctcgtc 7260

aggggggcgg?agcctatgga?aaaacgccag?caacgcggcc?tttttacggt?tcctggcctt 7320

ttgctggcct?tttgctcaca?tggctcgaca?gatct 7355

<210>12

<211>1308

<212>DNA

<213>HCV?NS3/4A

<400>12

atggcgccta?ttacggccta?ctcccaacag?acgcgaggcc?tacttggctg?catcatcact 60

agcctcacag?gccgggacag?gaaccaggtc?gagggggagg?tccaagtggt?ctccaccgca 120

acacaatctt?tcctggcgac?ctgcgtcaat?ggcgtgtgtt?ggactgtcta?tcatggtgcc 180

ggctcaaaga?cccttgccgg?cccaaagggc?ccaatcaccc?aaatgtacac?caatgtggac 240

caggacctcg?tcggctggca?agcgcccccc?ggggcgcgtt?ccttgacacc?atgcacctgc 300

ggcagctcgg?acctttactt?ggtcacgagg?catgccgatg?tcattccggt?gcgccggcgg 360

ggcgacagca?gggggagcct?actctccccc?aggcccgtct?cctacttgaa?gggctcttcg 420

ggcggtccac?tgctctgccc?ctcggggcac?gctgtgggca?tctttcgggc?tgccgtgtgc 480

acccgagggg?ttgcgaaggc?ggtggacttt?gtacccgtcg?agtctatgga?aaccactatg 540

cggtccccgg?tcttcacgga?caactcgtcc?cctccggccg?taccgcagac?attccaggtg 600

gcccatctac?acgcccctac?tggtagcggc?aagagcacta?aggtgccggc?tgcgtatgca 660

gcccaagggt?ataaggtgct?tgtcctgaac?ccgtccgtcg?ccgccaccct?aggtttcggg 720

gcgtatatgt?ctaaggcaca?tggtatcgac?cctaacatca?gaaccggggt?aaggaccatc 780

accacgggtg?cccccatcac?gtactccacc?tatggcaagt?ttcttgccga?cggtggttgc 840

tctgggggcg?cctatgacat?cataatatgt?gatgagtgcc?actcaactga?ctcgaccact 900

atcctgggca?tcggcacagt?cctggaccaa?gcggagacgg?ctggagcgcg?actcgtcgtg 960

ctcgccaccg?ctacgcctcc?gggatcggtc?accgtgccac?atccaaacat?cgaggaggtg 1020

gctctgtcca?gcactggaga?aatccccttt?tatggcaaag?ccatccccat?cgagaccatc 1080

aaggggggga?ggcacctcat?tttctgccat?tccaagaaga?aatgtgatga?gctcgccgcg 1140

aagctgtccg?gcctcggact?caatgctgta?gcatattacc?ggggccttga?tgtatccgtc 1200

ataccaacta?gcggagacgt?cattgtcgta?gcaacggacg?ctctaatgac?gggctttacc 1260

ggcgatttcg?actcagtgat?cgactgcaat?acatgtgtca?cccagaca 1308

Claims (10)

1. be used to estimate the fusion rotein of HCV NS3/4A serine protease, be to be reporter gene with the Photinus pyralis LUC, two micromolecule polypeptides that can combine closely combine with the Photinus pyralis LUC fragment of N end and C end respectively, middle being linked to each other by NS3/4A serine protease effect substrate forms fusion gene, produces expressing behind this fusion gene insertion carrier for expression of eukaryon formation indication carrier then.

2. fusion rotein according to claim 1 is characterized in that: described two micromolecule polypeptides are for combining closely and not influencing the protein molecular of cell function; Described NS3/4A serine protease effect substrate is the tie point of NS3/NS4A, NS4A/4B, NS4B/NS5A, NS5A/NS5B; Described indication carrier be expressed in the cell in vitro horizontal expression, or express in animal body by genetically modified mode.

3. fusion rotein according to claim 1 is characterized in that: the fusion gene that described NS3/4A serine protease effect substrate is the tie point of NS5A/NS5B is ANluc-NS5A/B-BCluc, is one of following nucleotide sequence:

1) dna sequence dna of SEQ ID NO:2 in the sequence table;

2) dna sequence dna of SEQ ID NO:1 in the code sequence tabulation;

3) with sequence table in the nucleotide sequence that limits of SEQ ID NO:2 have 90% above homology and have the nucleotide sequence of evaluation HCV NS3/4A serine protease effect;

4) nucleotide sequence of the dna sequence dna hybridization that under the rigorous condition of height, can limit with the SEQ ID NO:2 in the sequence table.

4. fusion rotein according to claim 3 is characterized in that: described fusion rotein is one of following amino acid residue sequences:

1) the SEQ ID NO:1 in the sequence table;

2) with the amino acid residue sequence of SEQ ID NO:1 in the sequence table through replacement, disappearance or the interpolation of one to ten amino-acid residue and have the protein of estimating the effect of HCV NS3/4A serine protease.

5. insert the indication carrier that is used to estimate HCV NS3/4A serine protease that construction of eukaryotic expression vector forms by the described fusion gene of claim 1.

6. indication carrier according to claim 5, it is characterized in that: described indication carrier is that the described fusion gene ANluc-NS5A/B-BNluc of claim 4 is inserted ANluc (Δ NS5A/B) BNluc that carrier for expression of eukaryon PCI neo forms, and its nucleotide sequence is shown in sequence in the sequence table 11.

7. the application of the described fusion rotein of claim 1-4 in HCV NS3/4A serine protease detects and estimates.

8. application according to claim 7, it is characterized in that: be a kind of screening of HCV NS3/4A serpin and the method for evaluation, be under the condition that HCV NS3/4A serpin exists, the cell that contains HCV NS3/4A serine protease with claim 6 or 7 described indication carrier transfections, the collecting cell sample, detect the expression amount of luciferase in the cell, obtain the inhibiting rate of HCV NS3/4A serine protease in the cell with this, and then obtain HCV NS3/4A serpin Evaluation on effect.

9. application according to claim 8 is characterized in that: with recombinant expression vector pCIneo-NS3/4A that contains HCV NS3/4A serine protease gene and indication carrier A Nluc (Δ NS5A/B) BCluc cotransfection cell.

10. be used to indicate apoptotic fusion gene, be ANluc-DEVD-BCluc, its nucleotide sequence is shown in sequence in the sequence table 9; Being used to indicate apoptotic indication carrier, is that described fusion gene ANluc-DEVD-BCluc is inserted ANluc (DEVD) BCluc that carrier for expression of eukaryon PCI neo forms, and its nucleotide sequence is shown in sequence in the sequence table 10; Being used to indicate apoptotic method, is described indication carrier A Nluc (DEVD) BCluc transfectional cell, the collecting cell sample, and the expression amount of luciferase in the detection cell is with this indicator cells apoptosis.

Images