CN114350698B - Human recombinant arginase I production strain and construction method thereof - Google Patents

Abstract

The invention discloses a human recombinant arginase I producing strain and a construction method thereof. The method comprises the following steps: (1) The pHT304 plasmid is subjected to double digestion treatment by NdeI and HincII, and a Pg3 promoter sequence is integrated on the pHT304 plasmid subjected to double digestion treatment, so that a plasmid pHT304-Pg3 is obtained; then SphI and SacI are used for carrying out double digestion treatment on plasmid pHT304-Pg3, and arg1 genes are integrated on the plasmid pHT304-Pg3 subjected to the double digestion treatment, so as to obtain a recombinant expression vector; (2) The obtained recombinant expression vector is guided into bacillus subtilis to construct and obtain the human recombinant arginase I production strain. The invention constructs the recombinant arginase I producing strain by adopting the bacillus subtilis system for the first time, and remarkably improves the expression quantity and activity of the recombinant arginase I.

Description

Human recombinant arginase I production strain and construction method thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a human recombinant arginase I production strain and a construction method thereof.

Background

Arginase (L-Arginase), also known as L-arginine urea hydrolase, catalyzes the production of ornithine and urea from L-arginine. Arginase is widely distributed in different organisms, such as mammals, reptiles, invertebrates, plants, fungi and bacteria, etc. In mammals, two different gene coding sequences of arginase are currently found, wherein: arginase I (Arginase I) is mainly located in the cytoplasm of mammalian liver organs, and functions in the last step of the urea cycle; arginase II (Arginase II) is a mitochondrial enzyme present in large amounts in body tissues outside the urea cycle and has the main function of regulating the arginine/ornithine concentration in balanced cells.

At present, most arginase in domestic and foreign markets is derived from animal organs, and Bach et al extract and purify arginase from bovine livers. However, in recent years, the existence of pathogenic microorganisms such as prions causes hidden danger of zoonosis, so that the pharmaceutical enzymes of animal origin are greatly limited when being applied to human bodies.

In view of the above, the expression of the human arginase gene by genetic engineering is the preferred strategy for its application in biomedical fields. Human arginase I achieved prokaryotic expression in 1990, but was limited by the level of development of the expression system at that time, and the ability of the promoters employed by researchers to control transcription was to be improved, both at the level of expression and under non-inducible conditions. In 2006, the university of Nanjing discloses an attempt to express human arginase I in Pichia pastoris engineering bacteria, but the expressed protein is not secreted outside yeast cells, and the expression level is low. Full-length cDNA of human arginase I obtained by the university of double denier Li Yipeng and the like is cloned to a prokaryotic high expression vector in 2015, and the human liver arginase I is expressed by an automatic induction system, wherein the yield of the recombinant human arginase I is 48.5 mg/liter of bacterial liquid, and the purity of the recombinant human arginase I exceeds 95%.

The expression system for expressing the human arginase I by utilizing the genetic engineering is concentrated on an escherichia coli expression system and a pichia pastoris expression system, but no report on the production of the human recombinant arginase I based on a bacillus subtilis expression system is yet seen.

Disclosure of Invention

Aiming at the prior art, the invention aims to provide a human recombinant arginase I producing strain and a construction method thereof. The invention constructs the recombinant arginase I producing strain by adopting the bacillus subtilis system for the first time, and remarkably improves the expression quantity and activity of the recombinant arginase I.

In order to achieve the above purpose, the invention adopts the following technical scheme:

in a first aspect of the present invention, there is provided a method for constructing a human recombinant arginase I producer, comprising the steps of:

(1) The pHT304 plasmid is subjected to double digestion treatment by NdeI and HincII, and a Pg3 promoter sequence is integrated on the pHT304 plasmid subjected to double digestion treatment, so that a plasmid pHT304-Pg3 is obtained; then SphI and SacI are used for carrying out double digestion treatment on plasmid pHT304-Pg3, and arg1 genes are integrated on the plasmid pHT304-Pg3 after the double digestion treatment, so as to obtain a recombinant expression vector (pHT 304-Pg3-arg 1);

(2) The obtained recombinant expression vector is guided into bacillus subtilis to construct and obtain the human recombinant arginase I production strain.

Preferably, in the step (1), the arg1 gene is subjected to optimization modification, firstly aspartic acid at 158 th position of human recombinant arginase I is mutated into glutamic acid, the coding nucleotide sequence is obtained again based on the amino acid sequence of the mutated human recombinant arginase I, and codon optimization is performed; then a signal peptide sequence is added to the optimized nucleotide sequence, and thrombin cleavage sites and 10His tails are inserted. The nucleotide sequence of the arg1 gene after the final optimization and transformation treatment is shown as SEQ ID NO. 7.

Preferably, in the step (1), the nucleotide sequence of the Pg3 promoter is shown as SEQ ID NO. 1.

Preferably, in the step (1), the nucleotide sequence of the plasmid pHT304-Pg3 is shown as SEQ ID NO. 2.

Preferably, in step (1), the nucleotide sequence of the recombinant expression vector (pHT 304-Pg3-arg 1) is shown in SEQ ID NO. 8.

In a second aspect of the invention, there is provided a human recombinant arginase I producing bacterium constructed by the method described above.

In a third aspect of the present invention, there is provided the use of the above-described human recombinant arginase I-producing bacterium as described in (1) or (2):

(1) Fermenting to produce human recombinant arginase I;

(2) And fermenting to produce ornithine.

The invention has the beneficial effects that:

(1) In order to realize the in vitro expression of the human recombinant arginase I, the invention screens and inspects the existing expression system, and the result shows that the bacillus subtilis expression system is also a prokaryotic expression system, but compared with a prokaryotic expression system such as escherichia coli, the bacillus subtilis is used for expressing the human recombinant arginase I, which is more beneficial to folding and modification of proteins.

(2) Based on a bacillus subtilis expression system, the pHT304 plasmid is selected as a basic plasmid, and is modified, the Pg3 promoter is integrated into the pHT304 plasmid, and the Pg3 promoter starts to express only after adding IPTG, so that after replacing the promoter, the strain grows fast in early stage and takes short time to enter a stable period, and the expression quantity of the recombinant arginase I of a human is improved.

(3) The invention also carries out site-directed mutagenesis treatment on the human recombinant arginase I, so that the activity of the mutated human recombinant arginase I is obviously improved; the nucleotide sequence of the mutated human recombinant arginase I is subjected to a series of optimization treatments such as codon optimization treatment, addition of signal peptide, thrombin cleavage site, histidine tail and the like, so that the expression quantity of the human recombinant arginase I is improved, and the subsequent purification treatment is convenient.

Drawings

Fig. 1: the structure of plasmid pHT304-Pg3 is schematically shown.

Fig. 2: schematic representation of the three-dimensional structure of human arginase I.

Fig. 3: root Mean Square Deviation (RMSD) profile of the protein backbone of wild-type Arginase I (W-Arginase 1) versus mutant Arginase I ((R-Arginase 1).

Fig. 4: effect of presence of DMSO at different concentrations on initial rate of arginase I catalytic reaction before and after mutation.

Fig. 5: codon relative fitness before arg1 gene optimization.

Fig. 6: codon relative fitness after arg1 gene optimization.

Fig. 7: the structure of the recombinant expression vector (pHT 304-Pg3-arg 1) constructed by the invention is schematically shown.

Fig. 8: electrophoresis verification of the recombinant expression vector (pHT 304-Pg3-arg 1) constructed by the invention.

Fig. 9: the colony PCR verification of the human recombinant arginase I production bacteria constructed by the invention.

Fig. 10: the western blot verification of the human recombinant arginase I production bacteria constructed by the invention; in the figure, the right lane is Marker.

Detailed Description

It should be noted that the following detailed description is illustrative and is intended to provide further explanation of the present application. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

In order to enable those skilled in the art to more clearly understand the technical solutions of the present application, the technical solutions of the present application will be described in detail below with reference to specific embodiments.

The test materials used in the examples and comparative examples of the present invention are conventional in the art and are commercially available. Wherein:

the Bacillus subtilis used in this example and comparative example was BS168 Bacillus subtilis, available from North Biotech Co., ltd.

The construction method of the recombinant arginase I production strain of the present invention adopts the conventional genetic engineering technology, and is a method which can be repeatedly implemented by a person skilled in the art, so that the recombinant arginase I production strain does not need to be biologically preserved.

Example 1: plasmid modification

The pHT304 plasmid (purchased from Youbao organism) is used as a basic plasmid for transformation, and is specifically as follows:

the pHT304 plasmid was subjected to double digestion with NdeI and HincII, and then the Pg3 promoter (sequence shown in SEQ ID NO. 1) was integrated into the double digested pHT304 plasmid, to construct plasmid pHT304-Pg3 (FIG. 1).

The plasmid pHT304-Pg3 is constructed to be single ampicillin resistance and has lactose operon, and the nucleotide sequence of the plasmid pHT304-Pg3 is shown as SEQ ID NO. 2.

The aim of the invention for modifying pHT304 plasmid is: firstly, the length of the vector is reduced, and the expression stability of the vector in bacillus subtilis is improved; secondly, integrating the Pg3 promoter into the pHT304 plasmid, wherein the Pg3 promoter starts to express only after adding IPTG, so that after integrating the Pg3 promoter, the strain grows quickly in earlier stage and needs short time for entering a stabilization period, thereby shortening the expression time of the human recombinant arginase I and improving the expression quantity of the human recombinant arginase I; thirdly, the influence on the growth of bacillus subtilis after the induction expression is reduced.

Example 2: optimization and modification of arg1 gene

The inventor obtains the amino acid sequence of the human arginase I from the existing database as shown in SEQ ID NO. 3; the nucleotide sequence of the coding gene arg1 is shown in SEQ ID NO. 4.

In order to further improve the activity of the human recombinant arginase I, the inventor adopts a molecular dynamics simulation method to carry out structural optimization on the human recombinant arginase I, and mutates aspartic acid at 158 th position of the human recombinant arginase I into glutamic acid, wherein the amino acid sequence of the mutated human recombinant arginase I is shown as SEQ ID NO. 5.

The three-dimensional structure of human arginase I is shown in FIG. 2, aspartic acid (D) at 158 is outwards projected, after mutation to glutamic acid (E), the aspartic acid (D) does not outwards project, and the included angle between P and V is also reduced, so that the whole structure is more compact.

The Root Mean Square Deviation (RMSD) curve of the protein backbone of wild-type Arginase I (W-Arginase 1) versus mutant Arginase I (R-Arginase 1) was simulated for 50ns as shown in FIG. 3. The results show that the two are close to the equilibrium state after 15ns and are basically balanced after 25ns, the RMSD value is between 0.13 and 0.15, and the point mutation has little effect on the integral structure of arginase I.

The results of measuring the effect on the initial rate of arginase I catalytic reaction before and after mutation in the presence of DMSO at various concentrations are shown in FIG. 4, wherein the activity of mutant arginase I increases 10.2-fold and the activity of wild-type arginase I increases 4.7-fold when the DMSO concentration is 30%.

The above results indicate that: the mutation of aspartic acid at 158 th position of human recombinant arginase I into glutamic acid can obviously improve the catalytic activity of arginase I.

In order to make the arg1 gene more suitable for use in a bacillus subtilis expression system, the present invention further provides codon optimization of the nucleotide sequence of the arg1 gene encoding mutated human recombinant arginase I. The codon relative fitness before optimization is shown in FIG. 5; the relative fitness of the codon after optimization is shown in FIG. 6.

Furthermore, in order to improve the secretory expression of the human recombinant arginase I in bacillus subtilis, the invention adds a section of signal peptide on the basis of the nucleotide sequence of the arg1 gene after codon optimization, and the signal peptide is specifically as follows:

ATGAAAAGATTTTTGTCCACTTTGTTGATTGGAATGATGCTGGTTACATGTGCCT CGCCGGCATTTGCC。(SEQ ID NO.6)

in order to facilitate the separation and purification of the expressed human recombinant arginase I, the thrombin cleavage site and the 10His sequence are further added in the nucleotide sequence.

The nucleotide sequence of the arg1 gene after final optimization and transformation is shown as SEQ ID NO. 7.

Example 3: construction of recombinant expression vectors

The modified plasmid pHT304-Pg3 in example 1 was subjected to double cleavage with SphI and SacI, and the final optimized modified arg1 gene (arg1Δ158, the nucleotide sequence of which is shown as SEQ ID NO. 7) in example 2 was integrated into the double-cleaved plasmid pHT304-Pg3 to obtain a recombinant expression vector (pHT 304-Pg3-arg 1); a schematic structure of the recombinant expression vector is shown in FIG. 7.

The constructed recombinant expression vector was subjected to electrophoretic verification, and the result is shown in FIG. 8. The results show that: the arg1 gene (shown in SEQ ID NO. 7) has been successfully integrated into plasmid pHT304-Pg 3. The nucleotide sequence of the constructed recombinant expression vector (pHT 304-Pg3-arg 1) is shown as SEQ ID NO.8 through sequencing verification.

Example 4: construction of human recombinant arginase I producing bacterium

The recombinant expression vector constructed in example 3 (pHT 304-Pg3-arg 1) was introduced into BS168 Bacillus subtilis to obtain a transformant. Transformants were inoculated on AMP plates (LB plates containing 100. Mu.g/ml AMP), and single colonies capable of growing in the AMP plates were picked up as positive transformants.

Colony PCR verification and western blot verification are carried out on the positive transformant, the colony PCR verification result is shown in FIG. 9, and the western blot verification result is shown in FIG. 10. The results show that: the recombinant expression vector constructed in example 3 has been successfully introduced into a recipient bacterium.

This demonstrates that: this example has been successful in constructing stable human recombinant arginase I-producing bacteria.

Comparative example 1:

integrating the arg1 gene shown in SEQ ID NO.4 into a plasmid pHT304 by a conventional genetic engineering means, and constructing to obtain a recombinant expression vector; and then, introducing the constructed recombinant expression vector into BS168 bacillus subtilis to construct the human recombinant arginase I producing strain A.

Comparative example 2:

integrating the arg1 gene shown in SEQ ID NO.4 into a plasmid pHT304-Pg3 (constructed according to the method of example 1) by conventional genetic engineering means, and constructing to obtain a recombinant expression vector; and then, introducing the constructed recombinant expression vector into BS168 bacillus subtilis to construct and obtain the human recombinant arginase I producing strain B.

Comparative example 3:

integrating the arg1 gene shown in SEQ ID NO.7 into a plasmid pHT304 by a conventional genetic engineering means, and constructing to obtain a recombinant expression vector; and then, introducing the constructed recombinant expression vector into BS168 bacillus subtilis to construct the human recombinant arginase I producing strain C.

Test example:

1. fermenting and culturing to produce human recombinant arginase I:

the human recombinant arginase I-producing bacteria constructed in example 4 and comparative examples 1-3 are inoculated into a fermentation medium with the same composition, and the composition of the fermentation medium is as follows: 12g/L peptone, 10g/L glycerol, 8g/L yeast extract, 3g/L sodium chloride, 2.5g/L ammonium sulfate, 4g/L dipotassium phosphate trihydrate, 0.3g/L ferric ammonium citrate, 2.1g/L citric acid, 0.5g/L magnesium sulfate heptahydrate and 100ppm ampicillin.

Fermenting under the same condition at the initial temperature of 33deg.C and pH of 7.0 until the OD of the fermentation broth is diluted 100 times ₆₀₀ When the value is 0.5, the temperature is reduced to 22 ℃, IPTG is added into the system, the final concentration of the IPTG in the system is 0.2mmol/L, and the induction culture is carried out for 24 hours.

Monitoring the glycerol content of the system in the culture process, and starting to add the feed when the glycerol content of the system is less than or equal to 1.0g/L, wherein the glycerol content in the system is kept at 0.5-1g/L by feeding the feed; the feed contains 400g/L of glycerol, 30g/L of peptone and 100g/L of yeast extract.

After the culture is finished, the bacteria-breaking treatment is carried out under the same conditions, the centrifugation is carried out, and the supernatant fluid is separated.

2. Yield and enzyme activity detection of human recombinant arginase I:

the concentration and enzyme activity of the human recombinant arginase I in the supernatant obtained after different human recombinant arginase I production bacteria are cultured under the same conditions are detected, and the specific detection method is as follows:

(1) The concentration of the human recombinant arginase I in the supernatant is determined by a human arginase ELISA kitHuman Arginase 1ELISA Kit,CODE:ELH-ARG 1-1), and the detection method is described in the specification of the kit.

(2) The enzymatic activity of human recombinant arginase I was tested by detecting the amount of urea: urea forms a unique red complex with oPA, NED, the shade of color being directly proportional to arginase activity. 50. Mu.L of the reaction system in which 25. Mu.L of the enzyme and 5. Mu.L of the substrate were arginine plus Mn ²⁺ (arginine and Mn) ²⁺ The volume ratio is 1:1), the other 20 mu L is a substance affecting the enzyme activity, the reaction is carried out for 2 hours at 37 ℃, 200 mu L of cold stop chromogenic solution (0.6 mol/L sulfuric acid, 50mmol/L boric acid, 1.6mmol/L oPA,0.8mmol/L NED) is added, the reaction is carried out for 20 minutes at room temperature, and the absorbance at 520nm is measured by an enzyme-labeling instrument.

Definition of enzyme Activity Unit (U) the amount of enzyme required to produce 1. Mu. Mol of urea per minute at 37℃is defined as one activity unit.

The activity unit of an enzyme is proportional to the reaction rate, so the activity of an enzyme can be characterized by the reaction rate at a given concentration of enzyme and substrate.

The results are shown in Table 1.

Table 1:

producing strain	Yield of human recombinant arginase I	Enzyme activity of human recombinant arginase I
			Production bacterium constructed in example 4	43.3g/L	48.7U/ml
Production bacterium A constructed in comparative example 1	3.5g/L	12.5U/ml
			Production bacterium B constructed in comparative example 2	20.6g/L	12.0U/ml
Production bacterium C constructed in comparative example 3	5.8g/L	48.2U/ml

The foregoing description is only of the preferred embodiments of the present application and is not intended to limit the same, but rather, various modifications and variations may be made by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application should be included in the protection scope of the present application.

SEQUENCE LISTING

<110> New Tay City, jiahe Biotech Co., ltd

<120> human recombinant arginase I producing strain and method for constructing same

<130> 2021

<160> 8

<170> PatentIn version 3.5

<210> 1

<211> 366

<212> DNA

<213> Pg3 promoter

<400> 1

atatgagcac tctttccact atccctacag tgttatggct tgaacaatca cgaaacaata 60

attggtacgt acgatctttc agccgactca aacatcaaat cttacaaatg tagtctttga 120

aagtattaca tatgtaagat ttaaatgcaa ccgttttttc ggaaggaaat gatgacctcg 180

tttccaccgg aattagcttg gtaccagcta ttgtaacata atcggtacgg gggtgaaaaa 240

gctaacggaa aagggagcgg aaaagaatga tgtaagcgtg aaaaattttt tatcttatca 300

cttgacattg gaagggagat tctttataat aagaatgtgg aattgtgagc ggataacaat 360

ttcaac 366

<210> 2

<211> 3461

<212> DNA

<213> plasmid pHT304-Pg3

<400> 2

ccatcctcca aagttggaga gtgagtttta tgtcgcaaat attaatgttt ctggtgaacc 60

ttatcaaatt ttcgttgatt taatagaaac atagcggtaa aattagcagt aacttaatag 120

aacggaaatg aaaaaagcca ctctcatatg agcactcttt ccactatccc tacagtgtta 180

tggcttgaac aatcacgaaa caataattgg tacgtacgat ctttcagccg actcaaacat 240

caaatcttac aaatgtagtc tttgaaagta ttacatatgt aagatttaaa tgcaaccgtt 300

ttttcggaag gaaatgatga cctcgtttcc accggaatta gcttggtacc agctattgta 360

acataatcgg tacgggggtg aaaaagctaa cggaaaaggg agcggaaaag aatgatgtaa 420

gcgtgaaaaa ttttttatct tatcacttga cattggaagg gagattcttt ataataagaa 480

tgtggaattg tgagcggata acaatttcaa ctcaactgtt tactaaaaat cagtttcatc 540

aagcaatgaa acacgccaaa gtaaacaatt taagtaccat tacttatgag caagtattgt 600

ctatttttaa tagttatcta ttatttaacg ggaggaaata attctatgag tcgctttttt 660

aaatttggaa agttacacgt tactaaaggg aatggagata aattattaga tatactactg 720

acagcttcca agaaggtaaa gaggtcccta gcgcctacgg ggaatttgta tcgggattga 780

aaaaggaaga gtatgagtat tcaacatttc cgtgtcgccc ttattccctt ttttgcggca 840

ttttgccttc ctgtttttgc tcacccagaa acgctggtga aagtaaaaga tgctgaagat 900

cagttgggtg cacgagtggg ttacatcgaa ctggatctca acagcggtaa gatccttgag 960

agttttcgcc ccgaagaacg ttttccaatg atgagcactt ttaaagttct gctatgtggc 1020

gcggtattat cccgtattga cgccgggcaa gagcaactcg gtcgccgcat acactattct 1080

cagaatgact tggttgagta ctcaccagtc acagaaaagc atcttacgga tggcatgaca 1140

gtaagagaat tatgcagtgc tgccataacc atgagtgata acactgcggc caacttactt 1200

ctgacaacga tcggaggacc gaaggagcta accgcttttt tgcacaacat gggggatcat 1260

gtaactcgcc ttgatcgttg ggaaccggag ctgaatgaag ccataccaaa cgacgagcgt 1320

gacaccacga tgcctgtagc aatggcaaca acgttgcgca aactattaac tggcgaacta 1380

cttactctag cttcccggca acaattaata gactggatgg aggcggataa agttgcagga 1440

ccacttctgc gctcggccct tccggctggc tggtttattg ctgataaatc tggagccggt 1500

gagcgtgggt ctcgcggtat cattgcagca ctggggccag atggtaagcc ctcccgtatc 1560

gtagttatct acacgacggg gagtcaggca actatggatg aacgaaatag acagatcgct 1620

gagataggtg cctcactgat taagcattgg taactgtcag accaagttta ctcatatata 1680

ctttagattg atttaaaact tcatttttaa tttaaaagga tctaggtgaa gatccttttt 1740

gataatctca tgaccaaaat cccttaacgt gagttttcgt tccactgagc gtcagacccc 1800

gtagaaaaga tcaaaggatc ttcttgagat cctttttttc tgcgcgtaat ctgctgcttg 1860

caaacaaaaa aaccaccgct accagcggtg gtttgtttgc cggatcaaga gctaccaact 1920

ctttttccga aggtaactgg cttcagcaga gcgcagatac caaatactgt ccttctagtg 1980

tagccgtagt taggccacca cttcaagaac tctgtagcac cgcctacata cctcgctctg 2040

ctaatcctgt taccagtggc tgctgccagt ggcgataagt cgtgtcttac cgggttggac 2100

tcaagacgat agttaccgga taaggcgcag cggtcgggct gaacgggggg ttcgtgcaca 2160

cagcccagct tggagcgaac gacctacacc gaactgagat acctacagcg tgagctatga 2220

gaaagcgcca cgcttcccga agggagaaag gcggacaggt atccggtaag cggcagggtc 2280

ggaacaggag agcgcacgag ggagcttcca gggggaaacg cctggtatct ttatagtcct 2340

gtcgggtttc gccacctctg acttgagcgt cgatttttgt gatgctcgtc aggggggcgg 2400

agcctatgga aaaacgccag caacgcggcc tttttacggt tcctggcctt ttgctggcct 2460

tttgctcaca tgttctttcc tgcgttatcc cctgattctg tggataaccg tattaccgcc 2520

tttgagtgag ctgataccgc tcgccgcagc cgaacgaccg agcgcagcga gtcagtgagc 2580

gaggaagcgg aagagcgccc aatacgcaaa ccgcctctcc ccgcgcgttg gccgattcat 2640

taatgcagct ggcacgacag gtttcccgac tggaaagcgg gcagtgagcg caacgcaatt 2700

aatgtgagtt agctcactca ttaggcaccc caggctttac actttatgct tccggctcgt 2760

atgttgtgtg gaattgtgag cggataacaa tttcacacag gaaacagcta tgaccatgat 2820

tacgccaagc ttgcatgcct gcaggtcgac tctagaggat ccccgggtac cgagctcgaa 2880

ttcactggcc gtcgttttac aacgtcgtga ctgggaaaac cctggcgtta cccaacttaa 2940

tcgccttgca gcacatcccc ctttcgccag ctggcgtaat agcgaagagg cccgcaccga 3000

tcgcccttcc caacagttgc gcagcctgaa tggcgaatgg cgcctgatgc ggtattttct 3060

ccttacgcat ctgtgcggta tttcacaccg catatggtgc actctcagta caatctgctc 3120

tgatgccgca tagttaagcc agccccgaca cccgccaaca cccgctgacg cgccctgacg 3180

ggcttgtctg ctcccggcat ccgcttacag acaagctgtg accgtctccg ggagctgcat 3240

gtgtcagagg ttttcaccgt catcaccgaa acgcgcgaga cgaaagggcc tcgtgatacg 3300

cctattttta taggttaatg tcatgataat aatggtttct tagacgtcag gtggcacttt 3360

tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 3420

tccgctcatg agacaataac cctgataaat gcttcaataa t 3461

<210> 3

<211> 322

<212> PRT

<213> human arginase I

<400> 3

Met Ser Ala Lys Ser Arg Thr Ile Gly Ile Ile Gly Ala Pro Phe Ser

1 5 10 15

Lys Gly Gln Pro Arg Gly Gly Val Glu Glu Gly Pro Thr Val Leu Arg

20 25 30

Lys Ala Gly Leu Leu Glu Lys Leu Lys Glu Gln Glu Cys Asp Val Lys

35 40 45

Asp Tyr Gly Asp Leu Pro Phe Ala Asp Ile Pro Asn Asp Ser Pro Phe

50 55 60

Gln Ile Val Lys Asn Pro Arg Ser Val Gly Lys Ala Ser Glu Gln Leu

65 70 75 80

Ala Gly Lys Val Ala Glu Val Lys Lys Asn Gly Arg Ile Ser Leu Val

85 90 95

Leu Gly Gly Asp His Ser Leu Ala Ile Gly Ser Ile Ser Gly His Ala

100 105 110

Arg Val His Pro Asp Leu Gly Val Ile Trp Val Asp Ala His Thr Asp

115 120 125

Ile Asn Thr Pro Leu Thr Thr Thr Ser Gly Asn Leu His Gly Gln Pro

130 135 140

Val Ser Phe Leu Leu Lys Glu Leu Lys Gly Lys Ile Pro Asp Val Pro

145 150 155 160

Gly Phe Ser Trp Val Thr Pro Cys Ile Ser Ala Lys Asp Ile Val Tyr

165 170 175

Ile Gly Leu Arg Asp Val Asp Pro Gly Glu His Tyr Ile Leu Lys Thr

180 185 190

Leu Gly Ile Lys Tyr Phe Ser Met Thr Glu Val Asp Arg Leu Gly Ile

195 200 205

Gly Lys Val Met Glu Glu Thr Leu Ser Tyr Leu Leu Gly Arg Lys Lys

210 215 220

Arg Pro Ile His Leu Ser Phe Asp Val Asp Gly Leu Asp Pro Ser Phe

225 230 235 240

Thr Pro Ala Thr Gly Thr Pro Val Val Gly Gly Leu Thr Tyr Arg Glu

245 250 255

Gly Leu Tyr Ile Thr Glu Glu Ile Tyr Lys Thr Gly Leu Leu Ser Gly

260 265 270

Leu Asp Ile Met Glu Val Asn Pro Ser Leu Gly Lys Thr Pro Glu Glu

275 280 285

Val Thr Arg Thr Val Asn Thr Ala Val Ala Ile Thr Leu Ala Cys Phe

290 295 300

Gly Leu Ala Arg Glu Gly Asn His Lys Pro Ile Asp Tyr Leu Asn Pro

305 310 315 320

Pro Lys

<210> 4

<211> 969

<212> DNA

<213> human arginase I

<400> 4

atgagcgcca agtccagaac catagggatt attggagctc ctttctcaaa gggacagcca 60

cgaggagggg tggaagaagg ccctacagta ttgagaaagg ctggtctgct tgagaaactt 120

aaagaacaag agtgtgatgt gaaggattat ggggacctgc cctttgctga catccctaat 180

gacagtccct ttcaaattgt gaagaatcca aggtctgtgg gaaaagcaag cgagcagctg 240

gctggcaagg tggcagaagt caagaagaac ggaagaatca gcctggtgct gggcggagac 300

cacagtttgg caattggaag catctctggc catgccaggg tccaccctga tcttggagtc 360

atctgggtgg atgctcacac tgatatcaac actccactga caaccacaag tggaaacttg 420

catggacaac ctgtatcttt cctcctgaag gaactaaaag gaaagattcc cgatgtgcca 480

ggattctcct gggtgactcc ctgtatatct gccaaggata ttgtgtatat tggcttgaga 540

gacgtggacc ctggggaaca ctacattttg aaaactctag gcattaaata cttttcaatg 600

actgaagtgg acagactagg aattggcaag gtgatggaag aaacactcag ctatctacta 660

ggaagaaaga aaaggccaat tcatctaagt tttgatgttg acggactgga cccatctttc 720

acaccagcta ctggcacacc agtcgtggga ggtctgacat acagagaagg tctctacatc 780

acagaagaaa tctacaaaac agggctactc tcaggattag atataatgga agtgaaccca 840

tccctgggga agacaccaga agaagtaact cgaacagtga acacagcagt tgcaataacc 900

ttggcttgtt tcggacttgc tcgggagggt aatcacaagc ctattgacta ccttaaccca 960

cctaagtaa 969

<210> 5

<211> 322

<212> PRT

<213> human recombinant arginase I

<400> 5

Met Ser Ala Lys Ser Arg Thr Ile Gly Ile Ile Gly Ala Pro Phe Ser

1 5 10 15

Lys Gly Gln Pro Arg Gly Gly Val Glu Glu Gly Pro Thr Val Leu Arg

20 25 30

Lys Ala Gly Leu Leu Glu Lys Leu Lys Glu Gln Glu Cys Asp Val Lys

35 40 45

Asp Tyr Gly Asp Leu Pro Phe Ala Asp Ile Pro Asn Asp Ser Pro Phe

50 55 60

Gln Ile Val Lys Asn Pro Arg Ser Val Gly Lys Ala Ser Glu Gln Leu

65 70 75 80

Ala Gly Lys Val Ala Glu Val Lys Lys Asn Gly Arg Ile Ser Leu Val

85 90 95

Leu Gly Gly Asp His Ser Leu Ala Ile Gly Ser Ile Ser Gly His Ala

100 105 110

Arg Val His Pro Asp Leu Gly Val Ile Trp Val Asp Ala His Thr Asp

115 120 125

Ile Asn Thr Pro Leu Thr Thr Thr Ser Gly Asn Leu His Gly Gln Pro

130 135 140

Val Ser Phe Leu Leu Lys Glu Leu Lys Gly Lys Ile Pro Glu Val Pro

145 150 155 160

Gly Phe Ser Trp Val Thr Pro Cys Ile Ser Ala Lys Asp Ile Val Tyr

165 170 175

Ile Gly Leu Arg Asp Val Asp Pro Gly Glu His Tyr Ile Leu Lys Thr

180 185 190

Leu Gly Ile Lys Tyr Phe Ser Met Thr Glu Val Asp Arg Leu Gly Ile

195 200 205

Gly Lys Val Met Glu Glu Thr Leu Ser Tyr Leu Leu Gly Arg Lys Lys

210 215 220

Arg Pro Ile His Leu Ser Phe Asp Val Asp Gly Leu Asp Pro Ser Phe

225 230 235 240

Thr Pro Ala Thr Gly Thr Pro Val Val Gly Gly Leu Thr Tyr Arg Glu

245 250 255

Gly Leu Tyr Ile Thr Glu Glu Ile Tyr Lys Thr Gly Leu Leu Ser Gly

260 265 270

Leu Asp Ile Met Glu Val Asn Pro Ser Leu Gly Lys Thr Pro Glu Glu

275 280 285

Val Thr Arg Thr Val Asn Thr Ala Val Ala Ile Thr Leu Ala Cys Phe

290 295 300

Gly Leu Ala Arg Glu Gly Asn His Lys Pro Ile Asp Tyr Leu Asn Pro

305 310 315 320

Pro Lys

<210> 6

<211> 69

<212> DNA

<213> Signal peptide

<400> 6

atgaaaagat ttttgtccac tttgttgatt ggaatgatgc tggttacatg tgcctcgccg 60

gcatttgcc 69

<210> 7

<211> 1101

<212> DNA

<213> optimized and engineered arg1 Gene

<400> 7

gcatatgaaa agatttttgt ccactttgtt gattggaatg atgctggtta catgtgcctc 60

gccggcattt gccggccgcg gcatgtctgc taaatctcgt acaatcggca tcatcggcgc 120

tcctttctct aaaggccaac ctcgtggcgg cgttgaagaa ggccctacag ttcttcgtaa 180

agctggcctt cttgaaaaac ttaaagaaca agaatgcgat gttaaagatt acggcgatct 240

tcctttcgct gatatcccta acgattctcc tttccaaatc gttaaaaacc ctcgttctgt 300

tggcaaagct tctgaacaac ttgctggcaa agttgctgaa gttaaaaaaa acggccgtat 360

ctctcttgtt cttggcggcg atcattctct tgctatcggc tctatctctg gccatgctcg 420

tgttcatcct gatcttggcg ttatctgggt tgatgctcat acagatatca acacacctct 480

tacaacaaca tctggcaacc ttcatggcca acctgtttct ttccttctta aagaacttaa 540

aggcaaagga cctgaagttc ctggcttctc ttgggttaca ccttgcatct ctgctaaaga 600

tatcgtttac atcggccttc gtgatgttga tcctggcgaa cattacatcc ttaaaacact 660

tggcatcaaa tacttctcta tgacagaagt tgatcgtctt ggcatcggca aagttatgga 720

agaaacactt tcttaccttc ttggccgtaa aaaacgtcct atccatcttt ctttcgatgt 780

tgatggcctt gatccttctt tcacacctgc tacaggcaca cctgttgttg gcggccttac 840

ataccgtgaa ggcctttaca tcacagaaga aatctacaaa acaggccttc tttctggcct 900

tgatatcatg gaagttaacc cttctcttgg caaaacacct gaagaagtta cacgtacagt 960

taacacagct gttgctatca cacttgcttg cttcggcctt gctcgtgaag gcaaccataa 1020

acctatcgat taccttaacc ctcctaaagg ccgcggccat catcatcatc atcatcatca 1080

tcatcattaa taataagtac c 1101

<210> 8

<211> 4525

<212> DNA

<213> recombinant expression vector (pHT 304-Pg3-arg 1)

<400> 8

ccatcctcca aagttggaga gtgagtttta tgtcgcaaat attaatgttt ctggtgaacc 60

ttatcaaatt ttcgttgatt taatagaaac atagcggtaa aattagcagt aacttaatag 120

aacggaaatg aaaaaagcca ctctcatatg agcactcttt ccactatccc tacagtgtta 180

tggcttgaac aatcacgaaa caataattgg tacgtacgat ctttcagccg actcaaacat 240

caaatcttac aaatgtagtc tttgaaagta ttacatatgt aagatttaaa tgcaaccgtt 300

ttttcggaag gaaatgatga cctcgtttcc accggaatta gcttggtacc agctattgta 360

acataatcgg tacgggggtg aaaaagctaa cggaaaaggg agcggaaaag aatgatgtaa 420

gcgtgaaaaa ttttttatct tatcacttga cattggaagg gagattcttt ataataagaa 480

tgtggaattg tgagcggata acaatttcaa ctcaactgtt tactaaaaat cagtttcatc 540

aagcaatgaa acacgccaaa gtaaacaatt taagtaccat tacttatgag caagtattgt 600

ctatttttaa tagttatcta ttatttaacg ggaggaaata attctatgag tcgctttttt 660

aaatttggaa agttacacgt tactaaaggg aatggagata aattattaga tatactactg 720

acagcttcca agaaggtaaa gaggtcccta gcgcctacgg ggaatttgta tcgggattga 780

aaaaggaaga gtatgagtat tcaacatttc cgtgtcgccc ttattccctt ttttgcggca 840

ttttgccttc ctgtttttgc tcacccagaa acgctggtga aagtaaaaga tgctgaagat 900

cagttgggtg cacgagtggg ttacatcgaa ctggatctca acagcggtaa gatccttgag 960

agttttcgcc ccgaagaacg ttttccaatg atgagcactt ttaaagttct gctatgtggc 1020

gcggtattat cccgtattga cgccgggcaa gagcaactcg gtcgccgcat acactattct 1080

cagaatgact tggttgagta ctcaccagtc acagaaaagc atcttacgga tggcatgaca 1140

gtaagagaat tatgcagtgc tgccataacc atgagtgata acactgcggc caacttactt 1200

ctgacaacga tcggaggacc gaaggagcta accgcttttt tgcacaacat gggggatcat 1260

gtaactcgcc ttgatcgttg ggaaccggag ctgaatgaag ccataccaaa cgacgagcgt 1320

gacaccacga tgcctgtagc aatggcaaca acgttgcgca aactattaac tggcgaacta 1380

cttactctag cttcccggca acaattaata gactggatgg aggcggataa agttgcagga 1440

ccacttctgc gctcggccct tccggctggc tggtttattg ctgataaatc tggagccggt 1500

gagcgtgggt ctcgcggtat cattgcagca ctggggccag atggtaagcc ctcccgtatc 1560

gtagttatct acacgacggg gagtcaggca actatggatg aacgaaatag acagatcgct 1620

gagataggtg cctcactgat taagcattgg taactgtcag accaagttta ctcatatata 1680

ctttagattg atttaaaact tcatttttaa tttaaaagga tctaggtgaa gatccttttt 1740

gataatctca tgaccaaaat cccttaacgt gagttttcgt tccactgagc gtcagacccc 1800

gtagaaaaga tcaaaggatc ttcttgagat cctttttttc tgcgcgtaat ctgctgcttg 1860

caaacaaaaa aaccaccgct accagcggtg gtttgtttgc cggatcaaga gctaccaact 1920

ctttttccga aggtaactgg cttcagcaga gcgcagatac caaatactgt ccttctagtg 1980

tagccgtagt taggccacca cttcaagaac tctgtagcac cgcctacata cctcgctctg 2040

ctaatcctgt taccagtggc tgctgccagt ggcgataagt cgtgtcttac cgggttggac 2100

tcaagacgat agttaccgga taaggcgcag cggtcgggct gaacgggggg ttcgtgcaca 2160

cagcccagct tggagcgaac gacctacacc gaactgagat acctacagcg tgagctatga 2220

gaaagcgcca cgcttcccga agggagaaag gcggacaggt atccggtaag cggcagggtc 2280

ggaacaggag agcgcacgag ggagcttcca gggggaaacg cctggtatct ttatagtcct 2340

gtcgggtttc gccacctctg acttgagcgt cgatttttgt gatgctcgtc aggggggcgg 2400

agcctatgga aaaacgccag caacgcggcc tttttacggt tcctggcctt ttgctggcct 2460

tttgctcaca tgttctttcc tgcgttatcc cctgattctg tggataaccg tattaccgcc 2520

tttgagtgag ctgataccgc tcgccgcagc cgaacgaccg agcgcagcga gtcagtgagc 2580

gaggaagcgg aagagcgccc aatacgcaaa ccgcctctcc ccgcgcgttg gccgattcat 2640

taatgcagct ggcacgacag gtttcccgac tggaaagcgg gcagtgagcg caacgcaatt 2700

aatgtgagtt agctcactca ttaggcaccc caggctttac actttatgct tccggctcgt 2760

atgttgtgtg gaattgtgag cggataacaa tttcacacag gaaacagcta tgaccatgat 2820

tacgccaagc ttgcatatga aaagattttt gtccactttg ttgattggaa tgatgctggt 2880

tacatgtgcc tcgccggcat ttgccggccg cggcgatgtc tgctaaatct cgtacaatcg 2940

gcatcatcgg cgctcctttc tctaaaggcc aacctcgtgg cggcgttgaa gaaggcccta 3000

cagttcttcg taaagctggc cttcttgaaa aacttaaaga acaagaatgc gatgttaaag 3060

attacggcga tcttcctttc gctgatatcc ctaacgattc tcctttccaa atcgttaaaa 3120

accctcgttc tgttggcaaa gcttctgaac aacttgctgg caaagttgct gaagttaaaa 3180

aaaacggccg tatctctctt gttcttggcg gcgatcattc tcttgctatc ggctctatct 3240

ctggccatgc tcgtgttcat cctgatcttg gcgttatctg ggttgatgct catacagata 3300

tcaacacacc tcttacaaca acatctggca accttcatgg ccaacctgtt tctttccttc 3360

ttaaagaact taaaggcaaa ggacctgaag ttcctggctt ctcttgggtt acaccttgca 3420

tctctgctaa agatatcgtt tacatcggcc ttcgtgatgt tgatcctggc gaacattaca 3480

tccttaaaac acttggcatc aaatacttct ctatgacaga agttgatcgt cttggcatcg 3540

gcaaagttat ggaagaaaca ctttcttacc ttcttggccg taaaaaacgt cctatccatc 3600

tttctttcga tgttgatggc cttgatcctt ctttcacacc tgctacaggc acacctgttg 3660

ttggcggcct tacataccgt gaaggccttt acatcacaga agaaatctac aaaacaggcc 3720

ttctttctgg ccttgatatc atggaagtta acccttctct tggcaaaaca cctgaagaag 3780

ttacacgtac agttaacaca gctgttgcta tcacacttgc ttgcttcggc cttgctcgtg 3840

aaggcaacca taaacctatc gattacctta accctcctaa aggccgcggc gcatcatcat 3900

catcatcatc atcatcatca ttaataataa gtaccgagct cgaattcact ggccgtcgtt 3960

ttacaacgtc gtgactggga aaaccctggc gttacccaac ttaatcgcct tgcagcacat 4020

ccccctttcg ccagctggcg taatagcgaa gaggcccgca ccgatcgccc ttcccaacag 4080

ttgcgcagcc tgaatggcga atggcgcctg atgcggtatt ttctccttac gcatctgtgc 4140

ggtatttcac accgcatatg gtgcactctc agtacaatct gctctgatgc cgcatagtta 4200

agccagcccc gacacccgcc aacacccgct gacgcgccct gacgggcttg tctgctcccg 4260

gcatccgctt acagacaagc tgtgaccgtc tccgggagct gcatgtgtca gaggttttca 4320

ccgtcatcac cgaaacgcgc gagacgaaag ggcctcgtga tacgcctatt tttataggtt 4380

aatgtcatga taataatggt ttcttagacg tcaggtggca cttttcgggg aaatgtgcgc 4440

ggaaccccta tttgtttatt tttctaaata cattcaaata tgtatccgct catgagacaa 4500

taaccctgat aaatgcttca ataat 4525

Claims (6)

1. The construction method of the human recombinant arginase I production strain is characterized by comprising the following steps of:

(1) The pHT304 plasmid is subjected to double digestion treatment by NdeI and HincII, and a Pg3 promoter sequence is integrated on the pHT304 plasmid subjected to double digestion treatment, so that a plasmid pHT304-Pg3 is obtained; then SphI and SacI are used for carrying out double enzyme digestion treatment on plasmid pHT304-Pg3, and the plasmid pHT304-Pg3 is subjected to double enzyme digestion treatmentarg1The gene is integrated on plasmid pHT304-Pg3 after double enzyme digestion treatment to obtain a recombinant expression vector;

(2) The obtained recombinant expression vector is imported into bacillus subtilis to construct and obtain human recombinant arginase I production bacteria;

in the step (1), the step of (a), arg1the nucleotide sequence of the gene is shown as 5 th-1087 th nucleotide in SEQ ID NO. 7.

2. The method according to claim 1, wherein in step (1), the nucleotide sequence of the Pg3 promoter is shown in SEQ ID No. 1.

3. The method according to claim 1, wherein in the step (1), the nucleotide sequence of the plasmid pHT304-Pg3 is shown in SEQ ID NO. 2.

4. The method according to claim 1, wherein in the step (1), the recombinant expression vector (pHT 304-Pg3- arg1) The nucleotide sequence of (2) is shown as SEQ ID NO. 8.

5. A human recombinant arginase I producing bacterium constructed by the construction method of any one of claims 1-4.

6. The use of the recombinant human arginase I producing bacterium of claim 5 for fermentative production of ornithine.