CN102660559A - Mycobacterium tuberculosis (TB) recombinant protein and preparation method thereof - Google Patents

Abstract

The invention discloses a gen SocAB-murB of a mycobacterium tuberculosis (TB) recombinant protein and the mycobacterium tuberculosis recombinant protein SocAB-murB which is expressed by the gen SocAB-murB. The recombinant protein SocAB-murB is high in specificity, strong in immunogenicity and complete in antigenic determinant; and compared with kits of the same kind, a kit for detecting a mycobacterium tuberculosis antibody intravenous gamma globulin (IgG), which is prepared by using the mycobacterium tuberculosis recombinant protein SocAB-murB as antigen has the advantages of high specificity and sensitivity and the like and can meet the requirement of clinical diagnosis of TB infection well.

Description

A kind of mycobacterium tuberculosis recombinant protein and preparation method thereof

Technical field

The present invention relates to biological technical field, particularly relate to a kind of mycobacterium tuberculosis recombinant protein.

Background technology

White plaque is that (Mycobacterium tuberculosis, TB) human diseases due to the infection is the main type of mycobacterial disease, mainly passes through respiratory infectious by Mycobacterium tuberculosis.Since Germany scientist Rrobert Koch in 1882 found TB, the whole world had 200,000,000 people to die from TB approximately, and the epidemic situation development is on the rise.Estimate that according to WHO existing patient TB 2,000 ten thousand in the whole world also will have 9,000 ten thousand people morbidity as not controlling 10 years from now on.China has 3.3 hundred million tubercle bacillus affection persons now, and pulmonary tuberculosis patient more than 600 ten thousand wherein has serious communicable patient 1,500,000, dies from 250,000 people that reach lungy every year.Therefore, prevention lungy, early diagnosis and treatment in time are the problems of showing great attention to.MTB has H37RV and two kinds of reference cultures of H37Ra, and the former is an attenuation mutant for the virulent strain latter, and they all derive from people's lung H37 strain isolated in 1934.Different with some clinical separation strains is; H37RV to medicaments insensitive, be beneficial to genetically engineered operation and in the TB animal model, kept complete virulence; Thereby this bacterial strain be widely used in the relevant biological medicine research of TB (MTb H37RV project at Sanger Institute, NCBI).Diagnosis of tuberculosis method commonly used at present has the inspection of microscope direct smear (AFP) and the culture method of chest x-ray perspective and the main patient of dependence sputum, hydrothorax, bronchovesicular liquid; And molecular biology and Serological testing, the many antigens based on high specific of these methods are set up.

Summary of the invention

The purpose of this invention is to provide a kind of mycobacterium tuberculosis recombinant protein gene SocAB-murBA kind of mycobacterium tuberculosis recombinant protein SocAB-murB with its coding.

A kind of mycobacterium tuberculosis recombinant protein gene SocAB-murB, its nucleotide sequence is shown in SEQ ID NO:1.

A kind of mycobacterium tuberculosis recombinant protein SocAB-murB, its aminoacid sequence is shown in SEQ ID NO:2.

The expression vector pET-28b of a kind of mycobacterium tuberculosis protein SocAB-murB -SocAB-murB, it is characterized in that: inserting the gene of its base sequence shown in SEQ ID NO:1 among the pET-28b.

A kind of engineering strain of expressing mycobacterium tuberculosis protein is characterized in that: its expression vector pET-28b of the described a kind of mycobacterium tuberculosis protein of claim 3 that has been transfection -SocAB-murBE. coli bl21 (DE3).

Another object of the present invention is a kind of mycobacterium tuberculosis recombinant protein gene SocAB-murBAnd the preparing method's of the recombinant protein of coding preparation method.

A kind of mycobacterium tuberculosis recombinant protein gene SocAB-murBThe preparation method, it may further comprise the steps:

1) genome of extraction Mycobacterium tuberculosis H37RV; With it is template, uses primer:

F1：ATCGCATATG TCGATACACCATGGGGACATTTGCCCTCCA

R1：TCCGTTTCATACCACCACCACCCGTAACGCCCTGA

F2：ACGGGTGGTGGTGGTATGAAACGGAGCGGTGTCGGTTCGCTCT

R2：ATCGCTCGAG CAACATGCAGCCGATCAGCACGGGTT

Carry out first round amplification, obtain gene fragment SocABWith MurB

2) gene fragment that obtains with first round amplification SocABWith MurB, be template, use primer:

F1：ATCGCATATG TCGATACACCATGGGGACATTTGCCCTCCA

R2：ATCGCTCGAG CAACATGCAGCCGATCAGCACGGGTT

Carry out second and take turns amplification, connect gene fragment SocABWith MurB, obtain the purpose fusion gene SocAB-murB

The preparation method of a kind of mycobacterium tuberculosis recombinant protein SocAB-murB, it may further comprise the steps:

1) with the described a kind of mycobacterium tuberculosis recombinant protein gene of claim 5 SocAB-murBThe fusion gene that makes of preparation method SocAB-murB, insert among the expression vector pET-28b, obtain plasmid pET-28b -SocAB-murB

2) with plasmid pET-28b -SocAB-murB, in transfection to the e. coli bl21 (DE3), abduction delivering, purifying.

Another purpose of the present invention is that described mycobacterium tuberculosis recombinant protein SocAB-murB conduct in preparation mycobacterium tuberculosis IgG antibody assay kit detects antigenic application.

The gene of a kind of mycobacterium tuberculosis recombinant protein provided by the invention SocAB-murBAnd a kind of mycobacterium tuberculosis recombinant protein SocAB-murB that expresses; Recombinant protein SocAB-murB has high specific, strong immunogenicity and the complete antigenic determinant of trying one's best; As antigen, the detection mycobacterium tuberculosis antibody IgG test kit of preparation is compared with the similar test kit on the market with mycobacterium tuberculosis recombinant protein SocAB-murB provided by the invention; Have advantages such as high specificity, sensitivity height, well satisfied the needs of TB infection clinical diagnosis.

Description of drawings

Fig. 1 second takes turns pcr amplification product SocAB-murBGel electrophoresis figure;

Fig. 2 is expression plasmid pET-28b- SocAB-murBThe structure schema;

Fig. 3 induces back thalline 12%SDS-PAGE electrophorogram, and wherein M representes Marker, 1 expression target protein.

Embodiment

1 one kinds of mycobacterium tuberculosis recombinant proteins of embodiment gene SocAB-murBPreparation

The recombinant protein gene SocAB-murBFusion

Through Computer Analysis TB H37RV genom sequence, filter out strong antigen epi-position SocAB albumen (GenBank:HM222605.1), murB (GenBank:EU840989.1) dna sequence dna of mycobacterium tuberculosis, and design of amplification primers.

SocABAmplimer:

F1：ATCGCATATG TCGATACACCATGGGGACATTTGCCCTCCA 50.0% Tm=66.71

R1：TCCGTTTCATACCACCACCACCCGTAACGCCCTGA 57.14% Tm=64.59

MurBAmplimer:

F2：ACGGGTGGTGGTGGTATGAAACGGAGCGGTGTCGGTTCGCTCT 60.47% Tm=67.79

R2：ATCGCTCGAG CAACATGCAGCCGATCAGCACGGGTT 58.33% Tm=65.07

F1 and R1 are used for amplification SocABThe fragment of gene, F2 and R2 are used for amplification MurBThe fragment of gene; Primers F 1 and R2 have the restriction enzyme site of NdeI and XhoI respectively, primers F 2 and the complementation of R1 order, and jointly corresponding to MurB5 ' end sequence of gene fragment;

The thalline of Mycobacterium tuberculosis H37RV (available from Nat'l Pharmaceutical & Biological Products Control Institute) adds 100mL Proteinase K (10mg/mL), puts 56 ℃ of water-bath digestion 4 hours, with conventional phenol/chloroform method purifying, obtains Mycobacterium tuberculosis H37RV genome;

With Mycobacterium tuberculosis H37RV genome is template, with primers F 1 and R1 amplification SocABThe fragment of gene is with primers F 2 and R2 amplification MurBThe fragment of gene;

50 mL amplification system: ddH ₂O 31.5 mL, 10 * buffer, 5.0 mL, 4 * dNTP, 4.0 mL, the upstream and downstream primer mixes liquid 4.0 mL, DNA 1.5 mL, Taqplus 0.2 mL (1 U);

Carry out first round amplification; Product cuts behind the agarose gel electrophoresis purifying, and the blob of viscose that will contain the DNA band (leads to-Beijing TAKARA company name of product: TAKARA MiniBEST Plasmid purification) explain and reclaim DNA by DNA fast purifying test kit available from the six directions; SocABTarget DNA fragment with MurBTarget DNA fragment

Obtain with first round pcr amplification SocABTarget DNA fragment with MurBTarget DNA fragment is a template, adds primers F 1 and R2 amplification SocAB-murBTarget DNA fragment; Amplified production detects through agarose gel electrophoresis, and the result is shown in accompanying drawing 1;

Just with SocABWith MurBGene fragment is that template is with connecting pcr amplification SocAB, murBFusion gene, the centre connects with 4 Gly (ggtggtggtggt); Get the fusion gene fragment SocAB-murBTarget DNA fragment

Expression vector pET-28b- SocAB-murBStructure and evaluation

DNA and SocAB-murB all cut through restriction endonuclease, 50 mL systems: 10 x buffer, 5.0 mL, and DNA 12 mL, each 15 U of Xho I and Nde I, ddH2O mends to 50 mL; 37 ℃ of water-bath 6 h; 50 mL enzymes are cut product and are separated through agarose gel electrophoresis, cutting DNA band agar block, and with DNA fast purifying test kit recovery DNA;

With fusion gene fragment cloning to pET-28b plasmid (having Xho I and Nde I restriction enzyme site), 20 mL linked system: ddH available from magnificent biotech firm ₂O15.0 mL, 10 x buffer, 2.0 mL, PET-28b 2.0 mL, Pab 1.0 mL, T ₄Dna ligase 20 U; Plasmid self connects contrast, 20 mL ligation system: ddH ₂O 16.0 mL, 10 x buffer 2.0mL, PET-28b 2.0 mL, T4DNA ligase enzyme 20 U; By behind the above-mentioned application of sample, mixing, centrifugal slightly, 14 ℃ of-16 ℃ of connections are spent the night; Transform E. coliBe coated with flat board (the LB solid medium that contains 15 mcg/ml kantlex) and choose the order-checking of clone's upgrading grain, confirm the clone that sequence is correct, plasmid construction figure sees accompanying drawing 2.

Sequencing primer is: the universal primer of F1 and R2 and T7 promoter and T7 terminator.Synthetic and the recombinant plasmid sequence pET-28b-of all amplimers and sequencing primer SocAB-murBMensuration all service is provided by the big genome company of China.Record the purpose fusion gene SocAB-murBNucleotide sequence shown in SEQ ID NO:1.

Embodiment 2 mycobacterium tuberculosis Recombinant Protein Expression, purifying

Plasmid (pET-28b-with the correct clone of checking SocAB-murB), transformed into escherichia coli BL21 (DE3) (available from magnificent biotech firm) host bacterium, target protein is expressed in inclusion body: will contain pET-28b- SocAB-murB, BL21 (DE3) host bacterium cultivate OD 0.6, with final concentration 1mM IPTG abduction delivering, collect thalline, ultrasonication, high speed centrifugation, collecting precipitation after 4 hours.Deposition to collecting is carried out purifying with Ni post (the chelating sephrose fast flow of Pharmcia company), uses following eluant solution: 300mM imidazoles, 20mM Tris, 500Mm NaCl, 8M Urea.Nuclear mycobacterium recombinant protein SocAB-murBThe fusion gene expressed proteins is totally 477 amino acid, and aminoacid sequence is shown in SEQ ID NO:2.

Embodiment 3 mycobacterium tuberculosis recombinant proteins are identified

1, the mensuration of purity and molecular weight:Through SDS-PAGE electrophoresis detection (albumen applied sample amount 10 μ g), be single district band, thin layer scanning identifies that purity is 95.8%.Molecular weight is about 51Kd, and detected result is seen accompanying drawing 3.

, concentration determination:Measure through Folin-phenol method, as the standard reference article, antigen protein concentration is 3.2 ± 0.15mg/mL with bovine serum albumin.

, determination of activity:Measure with indirect ELISA method.Package amount 2.0 μ g/ holes use inner quality controlled serum to measure the OD value.The result sees table 1.

Table 1 mycobacterium tuberculosis recombinant fusion protein determination of activity result

Antigen antibody reaction: adopt protein blot technology (Western Blot), with anti-people's tuberculosis IgG antibody positive human serum test TB fusion rotein antigen, visible positive reaction, SDS-PAGE also confirms that antigenic molecular weight is 51KD.

, stability measures:

The stability of protein concn is measured, and divides the stability of measuring the protein concn of the tuberculosis antigen solution of preserving for three times, and the result sees table 2.

The antigenic concentration determination of table 2. mycobacterium tuberculosis recombinant fusion protein

Test result shows that the protein concn of the tuberculosis antigen solution of-85 ℃ of preservations is highly stable.

Embodiment 4 ELISAs (ELISA) detect the foundation of mycobacterium tuberculosis antibody IgG

Adopt indirect ELISA method to detect mycobacterium tuberculosis antibody IgG, can be used for the evaluation of TB antigenic activity and the auxiliary diagnosis that TB infects.Present embodiment is done antigen with the mycobacterium tuberculosis recombinant fusion protein SocAB-murB that embodiment 2 makes; For confirming antigen coated amount and ELIAS secondary antibody working concentration, be specimen with positive and negative reference article, adopt the square formation volumetry to select best antigen coated amount and corresponding ELIAS secondary antibody working concentration, see the following form 3.

The selection of best antigen coated amount of table 3 and corresponding ELIAS secondary antibody working concentration

According to test result; In antigen coated amount is 4.0 μ g/ holes; When the ELIAS secondary antibody working concentration is 4mg/ml; Detected result is best, so encapsulate microwell plate and 4mg/ml ELIAS secondary antibody IgG with TB recombinant antigen 4.0 μ g/ holes, sets up mycobacterium tuberculosis antibody IgG enzyme linked immunosorbent detection method (indirect ELISA).

The performance calibrating of embodiment 5 mycobacterium tuberculosis IgG antibody assay kits (ELISA)

The reorganization TB albumen that embodiment 1 is made encapsulates microwell plate, measures TB IgG antibody with the ELISA method.

This test kit principle and component are following:

1) test kit principle: this strain is with the antigen coated microwell plate of genetically engineered reorganization TB, and the anti-human IgG of horseradish peroxidase (HRP) mark is a tracer, and the TMB Color Appearance System is used the indirect method principle and detected the anti-TB IgG antibody in human serum or the blood plasma.

2) the main moity of test kit:

Encapsulate plate, enzyme conjugates, negative control, positive control in advance, concentrate washing lotion (20 *), substrate solution A, substrate solution B, middle solution stopping.

The calibrating of test kit performance

Specific assay: press the indirect ELISA measuring method, detect several kinds of other serum materials, the observing response specificity.The result shows, uses test kit of the present invention to detect 15 parts of negative serums (clinical definite), and coincidence rate is 100%; Detect 30 parts of Rheumatoid factors, polyclonal positive serum samples, 30 parts of antinuclear antibody positive serum samples, none positive shows that Rheumatoid factors, polyclonal etc. can not cause the false positive of test kit basically, and specificity is fine.

Sensitivity determination: press the indirect ELISA measuring method, detect the susceptibility of this test kit.Use test kit of the present invention to detect 15 parts of positive serums (clinical definite), coincidence rate is 100%.

Accuracy is measured: press the indirect ELISA measuring method, detect the accuracy of this test kit.Use this test kit that positive control, the negative control of 2 parts of anti-TB strong positive serum, 1 part of positive serum, 1 part of negative serum and test kit are carried out every plate diplopore; The detection of totally 10 plates; Result such as table 4, the repeatability of visible test kit is good, and the CV that different serum are detected all is lower than 15%.

The accuracy of table 4 test kit

Serum	Average OD	Maximum OD	Minimum OD	CV(%)
					Strong positive 1	3.768	4.022	3.035	3.1
Strong positive 2	3.089	3.576	2.365	4.2
					Positive 1	2.158	2.794	1.802	6.9
Negative	0.019	0.103	0.003	5.8
					Positive control	2.597	3.209	2.011	7.2
Negative control	0.019	0.109	0.008	5.1

Comparison test with similar products at home and abroad: test kit of the present invention and AUTOBIO DIAGNOSTICS CO., LTD's test kit detect the comparative experiments result such as the table 4 of 280 parts of serum samples.

The compare test result of table 5 and Antu, Zhengzhou tubercule bacillus IgG antibody assay kit (ELISA)

Detect total coincidence rate=(61+214)/280=98.21%, show that tentatively this test kit reaches the standard of the similar test kit in market.

< 110>Jilin University

< 120>a kind of mycobacterium tuberculosis recombinant protein and preparation method thereof

<160> 2

<210> 1

<211> 1431

<212> DNA

< 213>manual work

<400> 1

tcgatacacc atggggacat ttgccctcca tggcctcacc catcgcctac cgtcggcctc 60

gttgcagacg acggctgccc gccacccgga tgtgacgcaa ttctcaatgc ctgggcacta 120

ccgataacgc cgacctgccg cagctcgcgc atgtggacgc tgaaagcccg gaaggagcac 180

accggcatat ccggcaagcc caccgcacgg accgatcgcc atggctctac tcggtccgga 240

gattctgagc tacaagctag tgcgcggcgt ttttctcgat tgccggatcg ctgtggcgct 300

cagggcgtta cgggtggtgg tggtatgaaa cggagcggtg tcggttcgct ctttgccggt 361

gcgcatattg ccgaggcggt cccgttggcg ccgctgacca ctttgcgtgt gggcccgatc 420

gcccgacgtg tcatcacttg caccagcgcc gaacaggtgg tggctgcgct gcggcacctg 480

gattcggcgg ccaagaccgg agctgaccgc ccgctggtgt ttgctggtgg ctccaatttg 540

gtgatcgccg agaacctgac cgacctgacc gtggtgcggt tggccaatag cggcatcacc 600

atcgacggta acttggtgcg ggccgaggcc ggtgcggtct tcgatgacgt ggtggttagg 660

gccatcgaac agggtctggg cggactggaa tgcctgtctg gcatcccagg atcggccggg 720

gcgacacccg tgcagaacgt gggggcgtat ggcgcggagg tgtctgacac catcactcgg 780

gttcggcttt tggatcggtg cacgggtgag gtgcgttggg tatccgcgcg cgacctgcgc 840

ttcggctatc gcacgagcgt gctcaaacac gctgatgggc ttgcggtgcc caccgtggtc 900

ttggaggtgg agtttgcgct ggatccgtcg ggccgcagcg caccgctgcg ctacggcgag 960

ctgatcgccg cgctgaatgc gaccagcggc gagcgcgccg acccgcaagc ggtccgcgaa 1020

gcggtgctgg ccctgcgggc acgcaagggc atggtgctgg acccgaccga ccatgacacc 1080

tggagcgtgg gatcgttctt cacaaacccg gtggtcaccc aggatgttta cgaacggctg 1140

gccggtgacg cggccaccag aaaggacggt ccggtcccgc actatcccgc gcccgacggc 1200

gtcaagctgg ccgccggctg gctggtggaa cgggccggct tcggcaaggg ctatccggat 1260

gccggcgccg ccccatgccg gctttccacc aaacatgcgc tggcgctgac aaatcgtggc 1320

ggggccaccg ccgaagatgt ggtgacgctg gcgcgcgccg tgcgcgatgg ggtccatgat 1380

gtgtttggta tcacactaaa acccgaaccc gtgctgatcg gctgcatgtt g 1431

<210> 2

<211> 477

<212> PRT

< 213>manual work

<400> 2

Ser Ile His His Gly Asp Ile Cys Pro Pro Trp Pro His Pro Ser Pro

1 5 10 15

Thr Val Gly Leu Val Ala Asp Asp Gly Cys Pro Pro Pro Gly Cys Asp

20 25 30

Ala Ile Leu Asn Ala Trp Ala Leu Pro Ile Thr Pro Thr Cys Arg Ser

35 40 45

Ser Arg Met Trp Thr Leu Lys Ala Arg Lys Glu His Thr Gly Ile Ser

50 55 60

Gly Lys Pro Thr Ala Arg Thr Asp Arg His Gly Ser Thr Arg Ser Gly

65 70 75 80

Asp Ser Glu Leu Gln Ala Ser Ala Arg Arg Phe Ser Arg Leu Pro Asp

85 90 95

Arg Cys Gly Ala Gln Gly Val Thr Gly Gly Gly Gly Met Lys Arg Ser

100 105 110

Gly Val Gly Ser Leu Phe Ala Gly Ala His Ile Ala Glu Ala Val Pro

115 120 125

Leu Ala Pro Leu Thr Thr Leu Arg Val Gly Pro Ile Ala Arg Arg Val

130 135 140

Ile Thr Cys Thr Ser Ala Glu Gln Val Val Ala Ala Leu Arg His Leu

145 150 155 160

Asp Ser Ala Ala Lys Thr Gly Ala Asp Arg Pro Leu Val Phe Ala Gly

165 170 175

Gly Ser Asn Leu Val Ile Ala Glu Asn Leu Thr Asp Leu Thr Val Val

180 185 190

Arg Leu Ala Asn Ser Gly Ile Thr Ile Asp Gly Asn Leu Val Arg Ala

195 200 205

Glu Ala Gly Ala Val Phe Asp Asp Val Val Val Arg Ala Ile Glu Gln

210 215 220

Gly Leu Gly Gly Leu Glu Cys Leu Ser Gly Ile Pro Gly Ser Ala Gly

225 230 235 240

Ala Thr Pro Val Gln Asn Val Gly Ala Tyr Gly Ala Glu Val Ser Asp

245 250 255

Thr Ile Thr Arg Val Arg Leu Leu Asp Arg Cys Thr Gly Glu Val Arg

260 265 270

Trp Val Ser Ala Arg Asp Leu Arg Phe Gly Tyr Arg Thr Ser Val Leu

275 280 285

Lys His Ala Asp Gly Leu Ala Val Pro Thr Val Val Leu Glu Val Glu

290 295 300

Phe Ala Leu Asp Pro Ser Gly Arg Ser Ala Pro Leu Arg Tyr Gly Glu

305 310 315 320

Leu Ile Ala Ala Leu Asn Ala Thr Ser Gly Glu Arg Ala Asp Pro Gln

325 330 335

Ala Val Arg Glu Ala Val Leu Ala Leu Arg Ala Arg Lys Gly Met Val

340 345 350

Leu Asp Pro Thr Asp His Asp Thr Trp Ser Val Gly Ser Phe Phe Thr

355 360 365

Asn Pro Val Val Thr Gln Asp Val Tyr Glu Arg Leu Ala Gly Asp Ala

370 375 380

Ala Thr Arg Lys Asp Gly Pro Val Pro His Tyr Pro Ala Pro Asp Gly

385 390 395 400

Val Lys Leu Ala Ala Gly Trp Leu Val Glu Arg Ala Gly Phe Gly Lys

405 410 415

Gly Tyr Pro Asp Ala Gly Ala Ala Pro Cys Arg Leu Ser Thr Lys His

420 425 430

Ala Leu Ala Leu Thr Asn Arg Gly Gly Ala Thr Ala Glu Asp Val Val

435 440 445

Thr Leu Ala Arg Ala Val Arg Asp Gly Val His Asp Val Phe Gly Ile

450 455 460

Thr Leu Lys Pro Glu Pro Val Leu Ile Gly Cys Met Leu

465 470 475 477

Claims (7)

1. mycobacterium tuberculosis recombinant protein gene SocAB-murB, its nucleotide sequence is shown in SEQ ID NO:1.

2. mycobacterium tuberculosis recombinant protein SocAB-murB, its aminoacid sequence is shown in SEQ ID NO:2.

3. the expression vector pET-28b of a mycobacterium tuberculosis protein SocAB-murB -SocAB-murB, it is characterized in that: inserting the gene of its base sequence shown in SEQ ID NO:1 among the pET-28b.

4. engineering strain of expressing mycobacterium tuberculosis protein is characterized in that: its expression vector pET-28b of the described a kind of mycobacterium tuberculosis protein of claim 3 that has been transfection -SocAB-murBE. coli bl21 (DE3).

5. mycobacterium tuberculosis recombinant protein gene SocAB-murBThe preparation method, it may further comprise the steps:

1) genome of extraction Mycobacterium tuberculosis H37RV; With it is template, uses primer:

F1：ATCGCATATG TCGATACACCATGGGGACATTTGCCCTCCA

R1：TCCGTTTCATACCACCACCACCCGTAACGCCCTGA

F2：ACGGGTGGTGGTGGTATGAAACGGAGCGGTGTCGGTTCGCTCT

R2：ATCGCTCGAG CAACATGCAGCCGATCAGCACGGGTT

Carry out first round amplification, obtain gene fragment SocABWith MurB

2) gene fragment that obtains with first round amplification SocABWith MurB, be template, use primer:

F1：ATCGCATATG TCGATACACCATGGGGACATTTGCCCTCCA

R2：ATCGCTCGAG CAACATGCAGCCGATCAGCACGGGTT

Carry out second and take turns amplification, connect gene fragment SocABWith MurB, obtain the purpose fusion gene SocAB-murB

6. the preparation method of a mycobacterium tuberculosis recombinant protein SocAB-murB, it may further comprise the steps:

1) with the described a kind of mycobacterium tuberculosis recombinant protein gene of claim 5 SocAB-murBThe fusion gene that makes of preparation method SocAB-murB, insert among the expression vector pET-28b, obtain plasmid pET-28b -SocAB-murB

2) with plasmid pET-28b -SocAB-murB, in transfection to the e. coli bl21 (DE3), abduction delivering, purifying.

7. the described mycobacterium tuberculosis recombinant protein of claim 2 SocAB-murB conduct in preparation mycobacterium tuberculosis IgG antibody assay kit detects antigenic application.

Images