CN101100673A

CN101100673A - Mycobacterium tuberculosis recombination fusion protein and application thereof

Info

Publication number: CN101100673A
Application number: CNA2007101181184A
Authority: CN
Inventors: 张小刚
Original assignee: BEIJING MODERN GOLD BIOTECH Co Ltd
Current assignee: BEIJING MODERN GOLD BIOTECH Co Ltd
Priority date: 2007-06-29
Filing date: 2007-06-29
Publication date: 2008-01-09

Abstract

A mycobacterium tuberculosis recombinant fused protein, inspecting reagent kit for preparing mono-antibody and multi-body and use in protein chip are disclosed. It has better specificity and sensitivity and can be used for TB infection clinical diagnosis.

Description

A kind of mycobacterium tuberculosis recombinant fusion protein and application thereof

Technical field

The present invention relates to the genetically engineered field, relate to a kind of mycobacterium tuberculosis recombinant fusion protein and application thereof particularly.

Background technology

Tuberculosis is that (Mycobacterium tuberculosis, TB) human diseases due to the infection is the main type of mycobacterial disease, mainly passes through respiratory infectious by Mycobacterium tuberculosis.Since Germany scientist Rrobert Koch in 1882 found TB, the whole world had 200,000,000 people to die from TB approximately, and the epidemic situation development is on the rise.Estimate that according to WHO existing patient TB 2,000 ten thousand in the whole world also will have 9,000 ten thousand people morbidity as not controlling 10 years from now on.China has 3.3 hundred million tubercle bacillus affection persons now, and pulmonary tuberculosis patient more than 600 ten thousand wherein has serious communicable patient 1,500,000, dies from 250,000 people that reach lungy every year.Therefore, prevention lungy, early diagnosis and treatment in time are the problems of showing great attention to.MTB has H37Rv and two kinds of reference cultures of H37Ra, and the former is an attenuation mutant for the virulent strain latter, and they all derive from people's lung H37 strain isolated in 1934.Different with some clinical separation strains is, H37Rv to medicaments insensitive, be beneficial to genetically engineered operation and in the TB animal model, kept complete virulence, thereby this bacterial strain be widely used in the relevant biological medicine research of TB (MTb H37Rv project at Sanger Institute, NCBI).Diagnosis of tuberculosis method commonly used at present has the chest x-ray perspective and mainly relies on the microscope direct smear of patient's sputum, hydrothorax, bronchovesicular liquid to check (AFP) and culture method, and molecular biology and Serological testing, the many antigens based on high specific of these methods are set up.

The invention provides a kind of tuberculosis recombination fusion protein of producing with gene engineering method as antigen, to compare specificity stronger with antigen commonly used, with its immunodiagnosis kit as antigen prepd, that the detection that can be tuberculosis infection provides is more special, instrument accurately.

Summary of the invention

(1) technical problem that will solve

The purpose of this invention is to provide a kind of mycobacterium tuberculosis recombinant fusion protein, and the application of this mycobacterium tuberculosis recombinant fusion protein in preparation monoclonal antibody, many anti-, detection kit and protein chip is provided.

(2) technical scheme

The invention provides a kind of fusion gene of the mycobacterium tuberculosis recombinant fusion protein of encoding, its nucleotide sequence is shown in SEQ ID NO:1.

The present invention also provides a kind of mycobacterium tuberculosis recombinant fusion protein, and this recombination fusion protein is encoded by described fusion gene, and its aminoacid sequence is shown in SEQ ID NO:2.

The invention provides a kind of expression vector pET-28b-38Kd-16Kd of mycobacterium tuberculosis recombinant fusion protein, this expression vector is that described fusion gene is inserted into the recombinant plasmid that obtains on the plasmid pET-28b, and its plasmid map as shown in Figure 1.

The present invention provides a kind of engineering strain of expressing mycobacterium tuberculosis recombinant fusion protein again, and this project bacterial strain contains expression vector pET-28b-38Kd-16Kd, and its host bacterium is intestinal bacteria.

The present invention also provides a kind of mycobacterium tuberculosis antibody IgG enzyme-linked immunologic detecting kit, it comprises TB antigen and ELIAS secondary antibody, wherein TB antigen is by being to be made by aforesaid mycobacterium tuberculosis recombinant fusion protein, antigen coated amount is 1.0-8.0 μ g/ hole, and the ELIAS secondary antibody working concentration is 2.0-16.0mg/mL.Preferably, antigen coated amount is 2.0 μ g/ holes, and the ELIAS secondary antibody working concentration is 4.0mg/mL.

The invention provides a kind of mycobacterium tuberculosis antibody IgG diagnostic kit, it comprises TB antigen, colloid gold label TB antigen and nature controlling line bag by the anti-TB antibody of rabbit, and wherein said TB antigen and colloid gold label TB antigen all are to be made by aforesaid mycobacterium tuberculosis recombinant fusion protein.

Mycobacterium tuberculosis antibody IgG diagnostic kit of the present invention, antigen specking concentration is 0.25-2.0mg/mL, the working concentration of gold labelled antigen staining fluid is OD value 50.0-100.0, antigen specking amount is 0.5-1.75 μ L/cm, gold labelled antigen specking amount is 0.5-1.75 μ L/cm, the anti-TB antibody sandwich of nature controlling line concentration is 0.5-2.0mg/mL, reaction film off-period is 45-75 minute, the reaction film drying conditions is under the relative humidity 25%-30% dry 30-75 minute, gold labelled antigen pad drying conditions is under the relative humidity 25%-30% dry 3-5 hour, and the sample detection reaction time is 15 ℃～30 ℃ reactions 10-30 minute down.

Preferably, antigen specking concentration is 1.0mg/mL, the working concentration of gold labelled antigen staining fluid is an OD value 80.0, antigen specking amount is 1.0 μ L/cm, gold labelled antigen specking amount is 1.0 μ L/cm, the anti-TB antibody sandwich of nature controlling line concentration is 1.0mg/mL, reaction film off-period is 60 minutes, the reaction film drying conditions descended dry 60 minutes for relative humidity 25%-30%, gold labelled antigen pad drying conditions descended dry 4 hours for relative humidity 25%-30%, the sample detection reaction time is 15 ℃～30 ℃ reacted 25-30 minute down, and sample detection reaction time lengthening was 10 minutes when temperature was lower than 15 ℃.

The invention also discloses described mycobacterium tuberculosis recombinant fusion protein in preparation monoclonal antibody, many anti-application that reaches in the protein chip.

(3) beneficial effect

Adopt the diagnostic kit of mycobacterium tuberculosis recombinant fusion protein preparation provided by the invention, compare, have advantages such as high specificity, sensitivity height, well satisfied the needs of TB infection clinical diagnosis with the similar test kit on the market.

Description of drawings

Fig. 1 is the structure schema of expression plasmid pET-28b-38Kd-16Kd;

Fig. 2 is that expression plasmid pET-28b-38Kd-16Kd enzyme is cut the product electrophorogram, and wherein 1 represents DNAMarker, and 2,3,4 represent three positive bacterias after enzyme is cut respectively, the recombinant plasmid before 5 expression enzymes are cut;

Fig. 3 is a mycobacterium tuberculosis recombinant fusion protein purifying electrophorogram, the supernatant of 1 expression after the lysis wherein, the precipitation after the 2 expression lysises, the TB albumen of 3 expression purifying;

Fig. 4 is mycobacterium tuberculosis recombinant fusion protein Western Blot evaluation figure, and wherein preceding bacterial protein is induced in 1 expression, and the back bacterial protein is induced in 2 expressions.

Embodiment

Following examples are used to illustrate the present invention, but are not used for limiting protection scope of the present invention.

The preparation of embodiment 1 mycobacterium tuberculosis recombinant fusion protein

1.1 gene fusion

By Computer Analysis TB H37Rv genom sequence, selecting the dna sequence dna of its strong antigen epi-position 38kDa albumen (GENEBANK locus:YP_177770) and 16kDa (GENEBANK locus:NP_214765) is template, and design of amplification primers is:

The 38kD amplimer:

38-16a：atcgCATATGtgtggctcgaaaccaccgagc 61.9％ Tm：72.59

38-16b：GATTGTTCATACCACCACCACCGCTGGAAATCGTCGCGATCGC 53％Tm：86

The 16kD amplimer:

38-16c：ggtggtggtggt ATGAACAATCTCGCATTG 50％ Tm：76

38-16d：atcgCTC GAGCTACTTCGTGATGGCGATGC 57％ Tm：74

50mL amplification system: ddH ₂O 31.5mL, 10 * buffer 5.0mL, 4 * dNTP 4.0mL, the upstream and downstream primer mixes liquid 4.0mL, DNA1.5mL, Taqplus 0.2mL (1U).

Get the thalline of Mycobacterium tuberculosis H37RV, add 100mL Proteinase K (10mg/mL), put 56 ℃ of water-bath digestion 4 hours,, carry out pcr amplification with above-mentioned primer with conventional phenol/chloroform method purifying.Wherein, 38Kd upstream primer and 16Kd downstream primer have increased Nde I and Xho I restriction enzyme site respectively.

Cloned sequence is modified, product cuts behind the agarose gel electrophoresis purifying, the blob of viscose that will contain the DNA band (leads to-Beijing TAKARA company name of product: TAKARA MiniBEST Plasmid purification) illustrate and reclaim DNA by DNA fast purifying test kit available from the six directions.And then be template with being connected pcr amplification 38kDa and 16kDa fusion gene with 38kDa and 16kDa gene fragment, middlely connect with 4 Gly (ggtggtggtggt).

Plasmid DNA and 38Kd-16Kd all cut through restriction endonuclease, the 50mL system: 10 * buffer 5.0mL, and DNA 12mL, Xho I and each 15U of Nde I, ddH2O mends to 50mL; 37 ℃ of water-bath 6h.The 50mL enzyme is cut product and is separated through agarose gel electrophoresis, cutting DNA band agar block, and press the explanation of DNA fast purifying test kit and reclaim DNA.

With the fusion gene fragment cloning to pET-28b plasmid (having Xho I and Nde I restriction enzyme site), 20mL linked system: ddH available from magnificent biotech firm ₂O15.0mL, 10 * buffer2.0mL, PET-28b2.0mL, Pab1.0mL, T ₄Dna ligase 20U.Plasmid self connects contrast, 20mL ligation system: ddH ₂O16.0mL, 10 * buffer2.0mL, PET-28b2.0mL, T4DNA ligase enzyme 20U.By behind the above-mentioned application of sample, mixing, centrifugal slightly, 14 ℃ of-16 ℃ of connections are spent the night.Transformed E .coli is coated with flat board (the LB solid medium that contains 15 mcg/ml kantlex) and chooses the order-checking of clone's upgrading grain, determines the clone that sequence is correct.The enzyme of recombinant plasmid is cut (NdeI/XhoI) electrophorogram as shown in Figure 2.

1.2 product order-checking

Sequencing primer is: the universal primer of S38-16 (GCTGGAAATCGTCGCGATCAA) and T7 promoter and T7 terminator.The mensuration synthetic and recombinant plasmid sequence pET-28b-38Kd-16Kd of all amplimers and sequencing primer all provides service by the big genome company of China.The nucleotide sequence that records the purpose fusion gene is shown in SEQ ID NO:1.

1.3 the expression of target protein, purifying

Plasmid (pET-28b-38Kd-16Kd) with the correct clone of checking, transformed into escherichia coli BL21 (DE3, available from magnificent biotech firm) the host bacterium, target protein is expressed in inclusion body: BL21 (DE3) the host bacterium that will contain the 38-16k gene is cultivated OD 0.6, with final concentration 1mM IPTG abduction delivering, collect thalline, ultrasonication, high speed centrifugation, collecting precipitation after 4 hours.The precipitation of collecting is carried out purifying with Ni post (the chelating sephrose fast flow of Pharmcia company), use following eluant solution: 300mM imidazoles, 20mM Tris, 500Mm NaCl, 8M Urea.38kDa and 16kDa fusion gene expressing protein be totally 512 amino acid, and aminoacid sequence is shown in SEQ ID NO:2.

1.4 fusion rotein calibrating

1.4.1 the mensuration of purity and molecular weight: through SDS-PAGE electrophoresis detection (albumen applied sample amount 10 μ g), be single district band, thin layer scanning identifies that purity is 95.4%.Molecular weight is about 54kD, and detected result is seen accompanying drawing 3.

1.4.2 concentration determination: measure through Folin-phenol method, as the standard reference product, antigen protein concentration is 3.5 ± 0.12mg/mL with bovine serum albumin.

1.4.3 determination of activity: measure with indirect ELISA method.Package amount 2.0 μ g/ holes use inner quality controlled serum to measure the OD value, the results are shown in Table 1.

Table 1 antigenic activity measurement result

Antigen antibody reaction: adopt protein blot technology (Westem Blot), with anti-people's tuberculosis IgG antibody positive human serum test TB fused antigen, visible positive reaction, SDS-PAGE also confirms that antigenic molecular weight is 54KD.The results are shown in accompanying drawing 4.

1.4.4 fusion rotein stability is measured:

The stability of protein concn is measured, and divides the stability of measuring the protein concn of the tuberculosis antigen solution of preserving for three times, the results are shown in Table 2.

The concentration determination of table 2. tuberculoprotein

Antigen	Lot number	Determination of protein concentration (mg/mL)
		Determination of protein concentration (mg/mL)			The 1st time (3 months)	The 2nd time (6 months)	The 1st time (12 months)
		rTBA	04-1	1.02	The 1st time (3 months)	The 2nd time (6 months)	The 1st time (12 months)	1.00	1.01
rTBA	04-2	rTBA	04-1	1.02	1.10	1.04	1.03	1.00	1.01
rTBA	04-2	rTBA	04-3	1.00	1.10	1.04	1.03	1.01	1.00

Test result shows that the protein concn of the tuberculosis antigen solution of-85 ℃ of preservations is highly stable.

The active stability of tuberculosis antigen is measured, and divides the tuberculosis antigen of three specking-85 ℃ preservations and makes colloidal gold kit, carries out measurement result with enterprise's Quality Control reference product and sees Table 3.

The result of appraisal of table 3 tuberculosis antibody enterprise Quality Control reference product

Sample	For the first time	For the second time	For the third time
Sample	For the first time	For the second time	For the third time	N1	-	-	-
N2	-	-	-	N1	-	-	-
N2	-	-	-	P1	+	+	+
P2	+	+	+	P1	+	+	+
P2	+	+	+	P3	+	+	+
P4	+	+	+	P3	+	+	+
P4	+	+	+	P5	+	+	+

Measurement result shows that the immunocompetence of the tuberculosis antigen of-85 ℃ of preservations is stable.

Annotate: the used sample of the present invention is provided by entire PLA tuberculosis research centre.Make by tuberculosis patient serum tuberculosis antibody IgG male the infecteds of clinical definites such as clinical bacteriology inspection and Clinical X line and negative serum, blood plasma.30 samples, the wherein negative reference material (N) of 15 anchorage people tuberculosis antibody IgG; The positive reference material (P) of 15 anchorage people tuberculosis antibody IgG.

Embodiment 2 euzymelinked immunosorbent assay (ELISA) (ELISA) detect the foundation of mycobacterium tuberculosis antibody IgG

Adopt indirect ELISA method to detect mycobacterium tuberculosis antibody IgG, can be used for the calibrating of TB antigenic activity and the auxiliary diagnosis that TB infects.For determining antigen coated amount and ELIAS secondary antibody working concentration, be specimen with positive and negative reference material, adopt the square formation volumetry to select best antigen coated amount and corresponding ELIAS secondary antibody working concentration, see the following form 4.

The selection of the sharp corresponding ELIAS secondary antibody working concentration of the best antigen coated amount of table 4

ELIAS secondary antibody IgG concentration (mg/ml)	Bag is by reorganization TB antigen amount (μ g/ hole)	Reference material
		Reference material				P1	P2	P3	N1
		2.0	0.5	0.101	0.309	P1	P2	P3	N1	0.025	0.017
1.0	0.122		0.5	0.101	0.309	0.337	0.025	0.019		0.025	0.017
1.0	0.122		2.0	0.323	0.892	0.337	0.025	0.019	0.091	0.021
4.0	0.405		2.0	0.323	0.892	0.978	0.099	0.020	0.091	0.021
4.0	0.405		4.0	0.5	0.411	0.978	0.099	0.020	0.988	0.092	0.015
1.0	0.817	1.098		0.5	0.411	0.103	0.014		0.988	0.092	0.015
1.0	0.817	1.098		2.0	0.825	0.103	0.014	1.245	0.396	0.022
4.0	0.867	1.352		2.0	0.825	0.409	0.026	1.245	0.396	0.022
4.0	0.867	1.352		8.0	0.5	0.409	0.026	0.402	0.305	0.110	0.089
1.0	0.573	0.348	0.112		0.5	0.090		0.402	0.305	0.110	0.089
1.0	0.573	0.348	0.112		2.0	0.090	0.712	1.261	0.399	0.098
4.0	1.359	1.271	0.863		2.0	0.141	0.712	1.261	0.399	0.098
4.0	1.359	1.271	0.863		16.0	0.141	0.5	0.890	1.343	0.426	0.098
1.0	1.003	1.351	0.614	0.108			0.5	0.890	1.343	0.426	0.098
1.0	1.003	1.351	0.614	0.108		2.0	1.291	1.355	0.859	0.134
4.0	1.406	1.401	0.928	0.201		2.0	1.291	1.355	0.859	0.134

Annotate: with positive and negative reference material is specimen, and any a positive appears in negative reference material promptly to be judged and false positive results occurs, promptly represents with " ± " in table; Any a feminine gender appears in positive reference material promptly to be judged and false negative result occurs, promptly represents with " ± " in table.

According to test result, in antigen coated amount is 2.0 μ g/ holes, when the ELIAS secondary antibody working concentration is 4mg/ml, detected result the best, so by microwell plate and 4mg/ml ELIAS secondary antibody IgG, set up mycobacterium tuberculosis antibody IgG enzyme linked immunosorbent detection method (indirect ELISA) with TB recombinant antigen 2.0 μ g/ holes bag.

The preparation of embodiment 3 mycobacterium tuberculosis antibody IgG diagnostic kits (colloidal gold method) and performance calibrating

2.1 test kit is formed and preparation

Test kit of the present invention as antigen, adopts dual-antigen sandwich method with mycobacterium tuberculosis (TB) specific fusion protein of purifying.Add serum to be checked during use, as containing anti-TB specific antibody in the sample, then combine with golden mark TB antigen earlier, moving ahead combines the formation mixture again and presents purple-red colour with the corresponding TB antigen on film surface.As nonreactive TB specific antibody in the sample, then have only the nature controlling line color, its colour intensity directly and the amount of the anti-TB specific antibody IgG that exists in the sample proportional.

The main moiety of test kit is a test panel, comprises sample application zone, the antigen coated film of gold mark district, antigen coated detection zone, Quality Control district and absorbent pad district.

2.1.1 the nature controlling line bag is by the anti-TB antibody of rabbit: (available from Beijing Sai Dike biotech company, protein concentration is 4.0 ± 0.15mg/mL, immune agar double diffusion tires 〉=and 1: 16).

2.1.2 colloid gold label TB antigen: Radioactive colloidal gold diameter 30nm colloid gold particle, stoste optical density(OD) OD is not less than 10.0.

2.1.3 condition optimizing

2.1.3.1 determining of antigen and the antigen coated concentration of gold mark: adopt the square formation titration to select best antigen coated concentration and corresponding golden labelled antigen working concentration, see the following form 5.

The selection of best antigen of table 5 and corresponding golden labelled antigen working concentration

Labelled antigen concentration (OD value)	Antigen concentration (mg/mL)
	Antigen concentration (mg/mL)							2.00	1.5	1.25	1.00	0.75	0.50	0.25
	50.0 60.0 70.0 80.0 90.0 100.0	-/+ -/+ -/+ +/+ +/+ +/+	-/+ -/+ -/+ -/+ -/+ +/+	-/+ -/+ -/+ -/+ -/+ -/+	-/- -/+ -/+ -/+ -/+ -/+	-/- -/- -/+ -/+ -/+ -/+	-/- -/- -/- -/- -/- -/+	2.00	1.5	1.25	1.00	0.75	0.50	0.25	-/- -/- -/- -/- -/- -/-

Annotate: with positive and negative serum Quality Control reference product is specimen, and any a positive appears in negative reference material promptly to be judged and false positive results occurs, promptly represents with "+/ " in table; Any a feminine gender appears in positive reference material promptly to be judged and false negative result occurs, promptly represents with "/" in table.

According to test result, be that 1.0 μ L/cm and golden labelled antigen specking amount are under the condition of 1.0 μ L/cm in antigen specking amount, selected best antigen specking concentration is 1.0mg/mL, the working concentration of golden labelled antigen staining fluid is an OD value 80.0.

2.1.3.2 determining of best antigen specking amount: determining that best antigen specking concentration is that 1.0mg/mL and best golden labelled antigen specking concentration are on the basis of OD value 80.0, adopting the square formation titration to select best antigen specking amount (seeing Table 6)

Determining of the best antigen specking of table 6 amount

Sample NO	Antigen specking amount (μ L/cm)
	Antigen specking amount (μ L/cm)						1.75	1.5	1.25	1.00	0.75	0.50
	N1 N2 N3 P1 P2 P4 P5	- - ± + + + +	- - - + + + +	- - - + + + +	- + + + +	-- -- - + + + +	1.75	1.5	1.25	1.00	0.75	0.50	- - - + - - +

According to test result, selected best antigen specking amount is 1.0 μ L/cm.

2.1.3.3 determining of best golden labelled antigen specking amount; Determining that best antigen specking concentration is 1.0mg/mL, the specking amount is that 1.0 μ L/cm and best golden labelled antigen specking concentration are on the basis of OD value 80.0, adopts the square formation titration to select best golden labelled antigen specking amount (seeing Table 7).

Determining of the best golden labelled antigen specking amount of table 7

Sample NO	Gold labelled antigen specking amount (μ L/cm)
	Gold labelled antigen specking amount (μ L/cm)						1.75	1.5	1.25	1.00	0.75	0.50
	N1 N2 N3 P1 P2 P4	- - - + + +	- - - + + +	- - -- + + +	- - - + + +	- - - + + +	1.75	1.5	1.25	1.00	0.75	0.50	- - + + -

According to test result, selected best golden labelled antigen specking amount is 1.0 μ L/cm.

2.1.3.4 the selection of the anti-TB antibody sandwich of nature controlling line concentration

Anti-TB antibody sandwich amount is 1 μ L/cm.The experimental result that the anti-TB bag of nature controlling line is selected by concentration sees Table 8.

The anti-TB bag of table 8 nature controlling line is by the selection of concentration

Bag is by anti-TB antibody concentration (mg/mL)			Anti-TB negative reaction serum
Bag is by anti-TB antibody concentration (mg/mL)			Anti-TB negative reaction serum	The test result test result	Reacted 5 minutes	0.5	-
1.0	+					0.5	-
1.0	+	1.5	+
2.0	++	1.5	+
2.0	++	Reacted 10 minutes	0.5			+
1.0	++		0.5			+
1.0	++		1.5		+++
2.0	+++		1.5		+++
2.0	+++		Reacted 15 minutes		0.5	+
1.0	+++				0.5	+
1.0	+++	1.5			+++
2.0	+++	1.5			+++
2.0	+++	Reacted 20 minutes			0.5	++
1.0	+++				0.5	++
1.0	+++		1.5		+++
2.0	+++		1.5		+++
2.0	+++		Reacted 25 minutes		0.5	++
1.0	+++				0.5	++
1.0	+++	1.5			+++
2.0	+++	1.5			+++
2.0	+++	Reacted 30 minutes			0.5	++
1.0	+++				0.5	++
1.0	+++		1.5		+++
2.0	+++		1.5		+++

-: control line does not appear; +: control line is clear; +++: control line line is clear thick.

Table 8 shows that used gold mark antigen has reactive preferably in the anti-TB antibody of rabbit and this test.1.0mg/mL the anti-TB of concentration bag can be shown the contrast effect basically preferably, continues to improve antibody concentration and fails obviously to improve response intensity.Thereby the concentration of selecting the anti-TB of 1.0mg/mL as the nature controlling line bag by concentration.

2.1.3.5 the selection of reaction film off-period

The nitrocellulose filter bag by TB antigen and anti-TB antibody after, can reduce nonspecific reaction effectively through confining liquid sealing.Selection experimental result to reaction film off-period sees Table 9.

The selection experimental result of table 9 reaction film off-period (37 ℃)

Reaction times	15 minutes	30 minutes	45 minutes	60 minutes	75 minutes
Reaction times	15 minutes	30 minutes	45 minutes	60 minutes	75 minutes	Negative serum	×	×	-	-	-
Positive serum	×	×	++	++	++	Negative serum	×	×	-	-	-

-: negative reaction; ±: probable positive; ++ positive reaction; *: the reaction film blurred background

Table 9 shows that off-period, difference had certain influence to correct reflection experimental result.Off-period, too short meeting caused the reaction film blurred background, influenced interpretation as a result.This result of experiment shows sealing 45 minutes-75 minutes, and sealing effect is better, helps to improve the accuracy of experimental result.Selecting sealing was production control condition in 60 minutes.

2.1.3.6 the selection of reaction film drying conditions

The experimental result that table 10 reaction film drying conditions is selected

The drying conditions that reaction film suits is not only relevant with the sensitivity of reagent, and more close with the stability relation of reagent.The result of table 10 shows, is under 20% environment in relative humidity, lacks the then poor stability of reagent time of drying, and time of drying, length then influenced the accuracy of reaction result.In relative humidity is 25%, 30% environment when being 45 minutes, 60 minutes, 75 minutes following time of drying, and reaction result is more approaching, and susceptibility and stability are preferably all arranged.Consider controllability in process of production, adopt relative humidity 25%-30%, 60 minutes condition of drying to be the drying conditions in producing.

2.1.3.7 the selection of golden labelled antigen pad time of drying

The experimental result of table 11 gold labelled antigen pad selection time of drying

Gold labelled antigen pad drying is under 37 ℃ of conditions.Table 11 shows that dry environment relative humidity is crossed to hang down may influence response intensity.Under relatively more suitable dry environment, 3 hours time of drying, 4 hours, 5 hours, drying effect was more approaching, and the reaction sensibility of reagent and stability are all better.So select relative humidity 25%-30% for use, be production control condition in dry 4 hours.

2.1.3.8 the selection of sample detection reaction time

The table 12 sample detection reaction time advance to select experimental result (A)

The selection experimental result (B) of table 13 sample detection reaction time

Table 12 and table 13 show, under room temperature condition usually (15 ℃～30 ℃), the anti-TB positive or strong positive reaction serum clear and definite positive reaction result can occur in 5-10 minute after reaction.When the weak positive reaction serum of anti-TB reacts at normal temperatures, need the long reaction times, can obtain clear and definite positive reaction result in the time of 25-30 minute in reaction.Anti-TB negative serum is reflected in 30 minutes under common room temperature condition (15 ℃～30 ℃), can correctly reflect substantially to measure serum character.Reaction times is long might cause false positive.Therefore, the time of judgement is as a result determined judge reaction result in the time of 25-30 minute in reaction.Consider that in particular cases the room temperature of possible real work is lower than 15 ℃, influences reaction result, take to prolong the measure in 10 minute reaction times, also can obtain satisfied result.

2.1.4 the manufacturing of test kit

1) the bag quilt of check-out console: the precut of NC film, stickup, antigen is diluted to optimum concn with pH7.2,0.02mol/L PBS damping fluid, the anti-TB antibody of Quality Control is diluted to optimum concn with pH7.2,0.02mol/L PBS damping fluid, respectively with the optimal conditions specking on the NC film, drying, sealing, drying;

Confining liquid prescription: 0.02mol/L PBS damping fluid (pH7.2 contains 0.25% skim-milk).

2) stickup of golden labelled antigen: with the golden labelled antigen solution of 0.05mol/LTris-HCl damping fluid (pH8.0) preparation, bag is pasted on bag by good check-out console by on the glass fibre mould after the drying;

3) assembling: check-out console cuts into test strip, assembles, packs.

2.1.5 detection method and interpretation of result

1) take out test panel, place on the plane operations platform, balance is to room temperature.

2) application of sample: micro sample adding appliance adds undiluted test serum 100 μ l in well.

3) observe and write down the result in 15-20 minute.The strong positive result can occur at 5 minutes, and the weak positive and negative findings need be waited for observation in 20 minutes.Positive: two red-purple lines appear in interpretation window (C and T position); Negative: red-purple lines (C position) only appear in the interpretation window; Invalid: the interpretation window does not have the red-purple lines.

2.2 test kit performance evaluation

2.2.1 detected result to 30 parts of TB reference materials

Use the test kit of the present invention's preparation, TB antibody reference material is detected, detected result sees Table 14.

Table 14 pair 30 parts of TB antibody reference material detected results

Anti-TB antibody positive reaction serum		Anti-TB negative antibody reaction serum
Anti-TB antibody positive reaction serum		Anti-TB negative antibody reaction serum		Sample	The result	Sample	The result
P1	++	N1	-	Sample	The result	Sample	The result
P1	++	N1	-	P2	++	N2	-
P3	++	N3	-	P2	++	N2	-
P3	++	N3	-	P4	+++	N4	-
P5	++	N5	-	P4	+++	N4	-
P5	++	N5	-	P6	++	N6	-
P7	++	N7	-	P6	++	N6	-
P7	++	N7	-	P8	++	N8	-
P9	+++	N9	-	P8	++	N8	-
P9	+++	N9	-	P10	++	N10	-
P11	+++	N11	-	P10	++	N10	-
P11	+++	N11	-	P12	++	N12	-
P13	+	N13	-	P12	++	N12	-
P13	+	N13	-	P14	++	N14	-
P15	+++	N15	-	P14	++	N14	-

Accuracy serum
Accuracy serum				C1	+	C1	+
C1	+	C1	+	C1	+	C1	+
C1	+	C1	+	C1	+	C1	+
C1	+	C1	+	C1	+	C1	+
C1	+	C1	+	C1	+	C1	+

-: negative reaction; +: positive reaction; ++: than strong positive reaction; +++: strong positive reaction.

From the test the result as can be seen, negative, positive coincidence rate all reaches 100%.Therefore we think that it is feasible adopting this detection system.

2.2.2 cross reaction test to antibody positive serum such as HBV, HCV, HAV and syphilis

Adopt the cross reaction of test kit of the present invention to HBV (hepatitis B), HCV (hepatitis C), HAV (hepatitis A), cancer and non-tuberculosis respiratory system patients serum, with its specificity of further evaluation, above-mentioned affirmation patient blood sample is tested, be the results are shown in following table.

The cross reaction test result of antibody positive serum such as table 15HBV, HCV, HAV and syphilis

Be subjected to the grouping of sample product	Examination test kit (golden mark method)				Be subjected to sample product source
	Examination test kit (golden mark method)					Number positive	Negative number	Add up to	Positive rate (%)
	HBV antibody positive serum	0	50	50		Number positive	Negative number	Add up to	Positive rate (%)	0.00	Entire PLA tuberculosis center
HCV antibody positive serum	HBV antibody positive serum	0	50	50	0	50	50	0.00	The same	0.00	Entire PLA tuberculosis center
HCV antibody positive serum	HAV antibody positive serum	0	40	40	0	50	50	0.00	The same	0.00	The same
Cancer patients's serum	HAV antibody positive serum	0	40	40	0	40	40	0.00	The same	0.00	The same
Cancer patients's serum	Non-tuberculosis respiratory system patients serum	0	100	100	0	40	40	0.00	The same	0.00	The same
Add up to	Non-tuberculosis respiratory system patients serum	0	100	100	0	280	28	0.00		0.00	The same

The result shows that this test kit and above-mentioned patient's blood sample no cross reaction take place.

2.2.3 the cross reaction to chaff interferences such as syphilis (RF) positive serum, blood fat, bilirubin and oxyphorases detects

The test result of chaff interferences such as table 16 pair syphilis (RF) positive serum, blood fat, bilirubin and oxyphorase

Be subjected to the grouping of sample product	Examination test kit (golden mark method)				Be subjected to sample product source
	Examination test kit (golden mark method)					Number positive	Negative number	Add up to	Positive rate (%)
	The RF positive serum	0	30	30		Number positive	Negative number	Add up to	Positive rate (%)	0.00	Entire PLA tuberculosis center
Hyperlipidemia serum	The RF positive serum	0	30	30						0.00	Entire PLA tuberculosis center
Hyperlipidemia serum		0	60	60	0.00	The same
The jaundice human serum		0	60	60	0.00	The same	1	59	60	1.67	The same
The jaundice human serum	Blood plasma behind the haemolysis	0	60	60	0.00	The same	1	59	60	1.67	The same
Add up to	Blood plasma behind the haemolysis	0	60	60	0.00	The same	1	209	210	0.48

The result shows that the cross reaction of this test kit and chaff interferences such as RF positive serum, blood fat, bilirubin and oxyphorase does not surpass the false positive rate of normal human serum sample.

2.2.4 relatively wait testing data with external like product

Make comparisons with the tuberculosis antibody quick diagnosis reagent kit of new generation that the general biological medicine of test kit of the present invention and Shanghai Australia company limited produces.215 parts of positive serums and XX negative serum are compared detection, the results are shown in following table

The compare test result of table 17 and the general tuberculosis antibody test kit of Shanghai Australia

Beijing modern times are up to gold mark detection kit result	Shanghai Australia general tuberculosis antibody test kit detected result		Add up to
				Positive	Negative
	Positive negative the total	174(A) 26(C) 200(A+C)		Positive	Negative	2(B) 228(D) 230(B+D)	176(A+B) 254(C+D) 430(A+B+C+D)

Verity and predictive value's computational analysis:

Table 18 verity and predictive value's computational analysis

Method of calculation	Calculation result
Method of calculation	Calculation result	Sensitivity=A/ (A+C) * 100%	174/(174+26)＝87.0％

Specific degree=D/ (B+D) * 100%	228/(2+228)＝99.1％
Specific degree=D/ (B+D) * 100%	228/(2+228)＝99.1％	The * 100% of false positive rate=B/B+D)	2/(2+228)＝0.8％
The * 100% of false negative rate=C/B+D)	26/(2+228)＝11.3％	The * 100% of false positive rate=B/B+D)	2/(2+228)＝0.8％
The * 100% of false negative rate=C/B+D)	26/(2+228)＝11.3％	Thick consistent=(A+D)/(A+B+C+D) * 100%	(174+228)/(174+2+26+228)＝93.4％
Adjust consistence=1/4 (A/ (A+B)+A/ (A+C)+D/ (C+D)+D/ (B+D)) * 100%	1/4(174/(174+2)+174/(174+26)+228/(26+228) +228/(2+228))＝93.6％	Thick consistent=(A+D)/(A+B+C+D) * 100%	(174+228)/(174+2+26+228)＝93.4％
		Youden index=(A/ (A+C)+D/ (B+D))-1	(174/(174+26)+228/(2+228))＝0.861
Predictive value=the A/ of positive test (A+B) * 100%	174/(174+2)＝98.8	Youden index=(A/ (A+C)+D/ (B+D))-1	(174/(174+26)+228/(2+228))＝0.861
Predictive value=the A/ of positive test (A+B) * 100%	174/(174+2)＝98.8	Predictive value=the D/ of negative test (C+D) * 100%	228/(26+228)＝89.7％

The detection coincidence rate of the general tuberculosis antibody test kit of test kit of the present invention and reference product Shanghai Australia is 93.49%.

2.2.5 clinical examination

Shenyang Hospital for Thoracics, the clinical examination result of Anhui Province's lung hospital of section and three families of Taiyuan City tuberculosis hospital is as follows:

Table 19 tuberculosis antibody IgG detected result

Unit	Be subjected to the inspection number	Phlegm bacterium (+)	Phlegm bacterium (-)	Non-tuberculosis disease	The blood donor
Unit	Be subjected to the inspection number	Phlegm bacterium (+)	Phlegm bacterium (-)	Non-tuberculosis disease	The blood donor	Taiyuan City tuberculosis hospital of Shenyang Hospital for Thoracics of Anhui Province hospital of lung section	350 350 350	100(92)* 100(83) 100(82)	100(63) 100(63) 100(51)	100(8) 100(10) 100(11)	50(2) 50(2) 50(3)

* detect positive routine number for test kit in ()

Table 20 tuberculosis antibody IgG detected result

Grouping	Anhui Province hospital of lung section (%)	Shenyang Hospital for Thoracics (%)	Taiyuan City tuberculosis hospital (%)
Grouping	Anhui Province hospital of lung section (%)	Shenyang Hospital for Thoracics (%)	Taiyuan City tuberculosis hospital (%)	The non-tuberculosis respiratory disease of tuberculosis patient group blood donor group	77.5(155/200) 11.0(11/100) 4.0(2/50)	73.0(146/200) 10.0(10/100) 4.0(2/50)	66.5(133/200) 11.0(11/100) 6.0(3/50)

Through Shenyang Hospital for Thoracics, the clinical examination result of Anhui Province hospital of lung section and three families of Taiyuan City tuberculosis hospital, test kit of the present invention (colloidal gold method) has reached the specification of quality of national regulation, and with the similar products at home and abroad not statistically significant on mass discrepancy.

Sequence table

＜110〉Beijing modern times are up to Bioisystech Co., Ltd

＜120〉a kind of mycobacterium tuberculosis recombinant fusion protein and application thereof

<130>GD0702

<160>2

<170>PatentIn version 3.3

<210>1

<211>1530

<212>DNA

＜213〉Mycobacterium tuberculosis (Mycobacterium tuberculosis)

<400>1

tgtggctcga aaccaccgag cggttcgcct gaaacgggcg ccggcgccgg tactgtcgcg 60

actacccccg cgtcgtcgcc ggtgacgttg gcggagaccg gtagcacgct gctctacccg 120

ctgttcacct gtggggtccg gcctttcacg agaggtatcc gaacgtcacg atcaccgctc 180

agggcaccgg ttctggtgcc gggatcgcgc aggccgccgc cgggacggtc aacattgggg 240

cctccgacgc ctattgtcgg aaggtgatat ggccgcgcac aaggggctga tgaacatcgc 300

gctagccatc tccgctcagc aggtcaacta caacctgccc ggagtgagcg agcacctcaa 360

gctgaacgga aaagtcctgg cgccatgtac cagggcacca tcaaaacctg ggacgacccg 420

cagatcgctg cgctcaaccc cggcgtgaac ctgcccggca ccgcggtagt tccgctgcac 480

cgctccgacg ggtccggtga caccttctgt tcacccagta cctgtccaag caagatcccg 540

agggctgggg caagtcgccc ggcttcggca ccaccgtcga cttcccggcg gtgccgggtg 600

cgctgggtga gaacggcaac ggcggcatgg tgaccgttgc gccgagacac cgggctgcgt 660

ggcctatatc ggcatcagct tcctcgacca ggccagtcaa cggggactcg gcgaggccca 720

actaggcaat agctctggca atttcttgtt gcccgacgcg caagcattca ggccgcggcg 780

gctggcttcg catcgaaaac cccggcgaac caggcgattt cgatgatcga cgggcccgcc 840

ccggacggct acccgatcat caactacgag tacgccatcg tcaacaaccg caaaaggacg 900

ccgccaccgc gcagaccttg caggcatttc tgcactgggc gatcaccgac ggcaacaagg 960

cctcgttcct cgaccaggtt catttccagc cgctgccgcc cgcggtggtg aagttgctga 1020

cgcgttgatc gcgacgattt ccagcggtgg tggtggtatg aacaatctcg cattgtggtc 1080

gcgtccggtg tgggacgttg agccctggga ccgctggcta cgtgacttct tcggccctgc 1140

cgcacgacgg actggtaccg cccggtcgcc ggagacttca cgccggccgc cgagatcgtc 1200

aaggatggcg cgacgcggtg gtccgtttgg aactgcccgg cattgacgtc gacaaggacg 1260

tcaacgtcgg cttgaccctg gccagccggt gagccgcctg gtgatccgcg gcgaacaccg 1320

cgacgagcac acgcaagcgc cggagacaaa gacggccgca ccctgcgtga gatccgctac 1380

ggatcattcc gccgccgttc cggctgcccg cgcacgtcac cagcgaggcc atcgcggctt 1440

cctatgacgc cggtgtgctg accgccgggt tgccggcgcc tacaaggccc cagccgaaac 1500

tcaggcgcag cgcatcgcca tacgaagtag 1530

<210>2

<211>512

<212>PRT

＜213〉Mycobacterium tuberculosis (Mycobacterium tube rculosis)

<220>

<221>misc_feature

<222>(349)..(349)

<223>Xaa can be any naturally occurring amino acid

<400>2

Cys Gly Ser Lys Pro Pro Ser Gly Ser Pro Glu Thr Gly Ala Gly Ala

1 5 10 15

Gly Thr Val Ala Thr Thr Pro Ala Ser Ser Pro Val Thr Leu Ala Glu

20 25 30

Thr Gly Ser Thr Leu Leu Tyr Pro Leu Phe Asn Leu Trp Gly Pro Ala

35 40 45

Phe His Glu Arg Tyr Pro Asn Val Thr Ile Thr Ala Gln Gly Thr Gly

50 55 60

Ser Gly Ala Gly Ile Ala Gln Ala Ala Ala Gly Thr Val Asn Ile Gly

65 70 75 80

Ala Ser Asp Ala Tyr Leu Ser Glu Gly Asp Met Ala Ala His Lys Gly

85 90 95

Leu Met Asn Ile Ala Leu Ala Ile Ser Ala Gln Gln Val Asn Tyr Asn

100 105 110

Leu Pro Gly Val Ser Glu His Leu Lys Leu Asn Gly Lys Val Leu Ala

115 120 125

Ala Met Tyr Gln Gly Thr Ile Lys Thr Trp Asp Asp Pro Gln Ile Ala

130 135 140

Ala Leu Asn Pro Gly Val Asn Leu Pro Gly Thr Ala Val Val Pro Leu

145 150 155 160

His Arg Ser Asp Gly Ser Gly Asp Thr Phe Leu Phe Thr Gln Tyr Leu

165 170 175

Ser Lys Gln Asp Pro Glu Gly Trp Gly Lys Ser Pro Gly Phe Gly Thr

180 185 190

Thr Val Asp Phe Pro Ala Val Pro Gly Ala Leu Gly Glu Asn Gly Asn

195 200 205

Gly Gly Met Val Thr Gly Cys Ala Glu Thr Pro Gly Cys Val Ala Tyr

210 215 220

Ile Gly Ile Ser Phe Leu Asp Gln Ala Ser Gln Arg Gly Leu Gly Glu

225 230 235 240

Ala Gln Leu Gly Asn Ser Ser Gly Asn Phe Leu Leu Pro Asp Ala Gln

245 250 255

Ser Ile Gln Ala Ala Ala Ala Gly Phe Ala Ser Lys Thr Pro Ala Asn

260 265 270

Gln Ala Ile Ser Met Ile Asp Gly Pro Ala Pro Asp Gly Tyr Pro Ile

275 280 285

Ile Asn Tyr Glu Tyr Ala Ile Val Asn Asn Arg Gln Lys Asp Ala Ala

290 295 300

Thr Ala Gln Thr Leu Gln Ala Phe Leu His Trp Ala Ile Thr Asp Gly

305 310 315 320

Asn Lys Ala Ser Phe Leu Asp Gln Val His Phe Gln Pro Leu Pro Pro

325 330 335

Ala Val Val Lys Leu Ser Asp Ala Leu Ile Ala Thr Xaa Gly Gly Gly

340 345 350

Gly Met Asn Asn Leu Ala Leu Trp Ser Arg Pro Val Trp Asp Val Glu

355 360 365

Pro Trp Asp Arg Trp Leu Arg Asp Phe Phe Gly Pro Ala Ala Thr Thr

370 375 380

Asp Trp Tyr Arg Pro Val Ala Gly Asp Phe Thr Pro Ala Ala Glu Ile

385 390 395 400

Val Lys Asp Gly Asp Asp Ala Val Val Arg Leu Glu Leu Pro Gly Ile

405 410 415

Asp Val Asp Lys Asp Val Asn Val Glu Leu Asp Pro Gly Gln Pro Val

420 425 430

Ser Arg Leu Val Ile Arg Gly Glu His Arg Asp Glu His Thr Gln Asp

435 440 445

Ala Gly Asp Lys Asp Gly Arg Thr Leu Arg Glu Ile Arg Tyr Gly Ser

450 455 460

Phe Arg Arg Ser Phe Arg Leu Pro Ala His Val Thr Ser Glu Ala ILe

465 470 475 480

Ala Ala Ser Tyr Asp Ala Gly Val Leu Thr Val Arg Val Ala Gly Ala

485 490 495

Tyr Lys Ala Pro Ala Glu Thr Gln Ala Gln Arg Ile Ala Ile Thr Lys

500 505 510

Claims

1, a kind of fusion gene of the mycobacterium tuberculosis recombinant fusion protein of encoding, its nucleotide sequence is shown in SEQ ID NO:1.

2, a kind of mycobacterium tuberculosis recombinant fusion protein is characterized in that it by the described fusion gene coding of claim 1, and its aminoacid sequence is shown in SEQ ID NO:2.

3, a kind of expression vector pET-28b-38Kd-16 Kd of mycobacterium tuberculosis recombinant fusion protein is characterized in that it is that the described gene of claim 1 is inserted into the recombinant plasmid that obtains on the plasmid pET-28b, and its plasmid map as shown in Figure 1.

4, a kind of engineering strain of expressing mycobacterium tuberculosis recombinant fusion protein is characterized in that it contains the described expression vector pET-28b-38Kd-16 of claim 3 Kd, and its host bacterium is intestinal bacteria.

5, a kind of mycobacterium tuberculosis antibody IgG enzyme-linked immunologic detecting kit, it comprises TB antigen and ELIAS secondary antibody, it is characterized in that described TB antigen is to be made by recombination fusion protein according to claim 2, wherein antigen coated amount is 1.0-8.0 μ g/ hole, and the ELIAS secondary antibody working concentration is 2.0-16.0mg/mL.

6, detection kit according to claim 5 is characterized in that antigen coated amount is 2.0 μ g/ holes, and the ELIAS secondary antibody working concentration is 4.0mg/mL.

7, a kind of mycobacterium tuberculosis antibody IgG diagnostic kit, it comprises TB antigen, colloid gold label TB antigen and nature controlling line bag by the anti-TB antibody of rabbit, it is characterized in that described TB antigen and colloid gold label TB antigen all are to be made by recombination fusion protein according to claim 2.

8, test kit according to claim 7, it is characterized in that antigen specking concentration is 0.25-2.0mg/mL, the working concentration of gold labelled antigen staining fluid is OD value 50.0-100.0, antigen specking amount is 0.5-1.75 μ L/cm, gold labelled antigen specking amount is 0.5-1.75 μ L/cm, the anti-TB antibody sandwich of nature controlling line concentration is 0.5-2.0mg/mL, reaction film off-period is 45-75 minute, the reaction film drying conditions is under the relative humidity 25%-30% dry 30-75 minute, gold labelled antigen pad drying conditions is under the relative humidity 25%-30% dry 3-5 hour, and the sample detection reaction time is 15 ℃～30 ℃ reactions 10-30 minute down.

9, test kit according to claim 8, it is characterized in that antigen specking concentration is 1.0mg/mL, the working concentration of gold labelled antigen staining fluid is an OD value 80.0, antigen specking amount is 1.0 μ L/cm, gold labelled antigen specking amount is 1.0 μ L/cm, the anti-TB antibody sandwich of nature controlling line concentration is 1.0mg/mL, reaction film off-period is 60 minutes, the reaction film drying conditions descended dry 60 minutes for relative humidity 25%-30%, gold labelled antigen pad drying conditions descended dry 4 hours for relative humidity 25%-30%, the sample detection reaction time is 15 ℃～30 ℃ reacted 25-30 minute down, and sample detection reaction time lengthening was 10 minutes when temperature was lower than 15 ℃.

10, the application of mycobacterium tuberculosis recombinant fusion protein according to claim 2 in preparation monoclonal antibody, many anti-, detection kit and protein chip.