CN101838660A - Mycobacterium tuberculosis recombinant fusion protein and application thereof - Google Patents
Mycobacterium tuberculosis recombinant fusion protein and application thereof Download PDFInfo
- Publication number
- CN101838660A CN101838660A CN200910217951A CN200910217951A CN101838660A CN 101838660 A CN101838660 A CN 101838660A CN 200910217951 A CN200910217951 A CN 200910217951A CN 200910217951 A CN200910217951 A CN 200910217951A CN 101838660 A CN101838660 A CN 101838660A
- Authority
- CN
- China
- Prior art keywords
- mycobacterium tuberculosis
- antigen
- antibody
- arg
- recombinant fusion
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a mycobacterium tuberculosis recombinant fusion protein and application thereof. The mycobacterium tuberculosis recombinant fusion protein is constructed by using a PCR method and using H37RV as a template according to three strong antigen epitopes of mycobacterium tuberculosis. Compared with a common antigen, the mycobacterium tuberculosis recombinant fusion protein has stronger specificity, and is used as an antigen to prepare a mycobacterium tuberculosis antibody IgG enzyme-linked immunosorbent assay kit and a mycobacterium tuberculosis antibody IgG colloidal gold kit; compared with similar kits on the market, the two kits have the advantages of strong specificity, high sensitivity and the like, provide more specific and accurate tools for testing tuberculosis infections and well meet requirements on clinical diagnoses of mycobacterium tuberculosis infections; and the mycobacterium tuberculosis recombinant fusion protein can also be used for preparing mono-antibody, multi-antibody, vaccine and protein chips.
Description
Technical field
The present invention relates to the genetically engineered field, relate to a kind of mycobacterium tuberculosis recombinant fusion protein and application thereof particularly.
Background technology
Tuberculosis is that (Mycobacterium tuberculosis, TB) human diseases due to the infection is the main type of mycobacterial disease, mainly passes through respiratory infectious by Mycobacterium tuberculosis.Since Germany scientist Rrobert Koch in 1882 found TB, the whole world had 200,000,000 people to die from TB approximately, and the epidemic situation development is on the rise.Estimate that according to WHO existing patient TB 2,000 ten thousand in the whole world also will have 9,000 ten thousand people morbidity as not controlling 10 years from now on.China has 3.3 hundred million tubercle bacillus affection persons now, and pulmonary tuberculosis patient more than 600 ten thousand wherein has serious communicable patient 1,500,000, dies from 250,000 people that reach lungy every year.Therefore, prevention lungy, early diagnosis and treatment in time are the problems of showing great attention to.MTB has H37RV and two kinds of reference cultures of H37Ra, and the former is an attenuation mutant for the virulent strain latter, and they all derive from people's lung H37 strain isolated in 1934.Different with some clinical separation strains is, H37RV to medicaments insensitive, be beneficial to genetically engineered operation and in the TB animal model, kept complete virulence, thereby this bacterial strain be widely used in the relevant biological medicine research of TB (MTb H37RV project at Sanger Institute, NCBI).Diagnosis of tuberculosis method commonly used at present has the chest x-ray perspective and mainly relies on the microscope direct smear of patient's sputum, hydrothorax, bronchovesicular liquid to check (AFP) and culture method, and molecular biology and Serological testing, the many antigens based on high specific of these methods are set up.
Summary of the invention
The purpose of this invention is to provide a kind of mycobacterium tuberculosis recombinant fusion protein, its nucleotide sequence is shown in SEQ ID NO:1;
Aminoacid sequence is shown in SEQ ID NO:2;
It is from Mycobacterium tuberculosis H37RV.
A kind of mycobacterium tuberculosis recombinant fusion protein of the present invention, by following method system:
1) synthetic following primer:
38-16-11a：ATCGCATATGTGTGGCTCGAAACCACCGAGC
38-16-11b：GATTGTTCATACCACCACCACCGCTGGAAATCGTCGCGATCGC
38-16-11c：GGTGGTGGTGGTATGAACAATCTCGCATTG
38-16-11d：TCCGCAATCACCACCACCACCCTACTTCGTATGGCGATGCG
38-16-11e：GGTGGTGGTGGTGATTGCGGATCCCATGAC
38-16-11f：ATCGCTCGAGTCCCAAGCTTCCTATGCGAA
With Mycobacterium tuberculosis H37RV is that template increases, and makes gene 38Kd-16Kd-11Kd;
2) the gene insertion is reached on the carrier pET-28b, get recombinant plasmid pET-28b-38Kd-16Kd-11Kd;
3) the recombinant plasmid transfection is expressed to the e. coli bl21 (DE3), purifying.
Another object of the present invention provides a kind of mycobacterium tuberculosis antibody IgG enzyme-linked immunologic detecting kit, it comprises: TB antigen and ELIAS secondary antibody, wherein TB antigen is above-mentioned a kind of mycobacterium tuberculosis recombinant fusion protein, the antigen coated amount of TB is 1.0-8.0 μ g/ hole, and the ELIAS secondary antibody working concentration is 2.0-16.0mg/mL;
The preferred antigen coated amount of TB is 2.0 μ g/ holes, and the ELIAS secondary antibody working concentration is 4.0mg/mL.
Another object of the present invention provides a kind of mycobacterium tuberculosis antibody IgG colloidal gold kit, it comprises: TB antigen, colloid gold label TB antigen and nature controlling line bag are by the anti-TB antibody of rabbit, and wherein TB antigen is above-mentioned a kind of mycobacterium tuberculosis recombinant fusion protein;
TB antigen specking concentration is 0.25-2.0mg/mL, the working concentration of gold mark TB antigen staining fluid is OD value 50.0-100.0, TB antigen specking amount is 0.5-1.75 μ L/cm, and golden mark TB antigen specking amount is 0.5-1.75 μ L/cm, and the anti-TB antibody sandwich of nature controlling line concentration is 0.5-2.0mg/mL; Reaction film off-period is 45-75 minute, the reaction film drying conditions is under the relative humidity 25%-30% dry 30-75 minute, gold labelled antigen pad drying conditions is under the relative humidity 25%-30% dry 3-5 hour, and the sample detection reaction time is 15 ℃～30 ℃ reactions 10-30 minute down.
Preferred TB antigen specking concentration is 1.0mg/mL, and the working concentration of golden mark TB antigen staining fluid is an OD value 80.0, and TB antigen specking amount is 1.0 μ L/cm, and golden mark TB antigen specking amount is 1.0 μ L/cm, and the anti-TB antibody sandwich of nature controlling line concentration is 1.0mg/mL; Reaction film off-period is 60 minutes, the reaction film drying conditions descended dry 60 minutes for relative humidity 25%-30%, gold labelled antigen pad drying conditions descended dry 4 hours for relative humidity 25%-30%, the sample detection reaction time is 15 ℃～30 ℃ reacted 25-30 minute down, and sample detection reaction time lengthening was 10 minutes when temperature was lower than 15 ℃.
The application that another purpose of the present invention is a kind of mycobacterium tuberculosis recombinant fusion protein in preparation monoclonal antibody, many anti-, vaccines, detection kit and protein chip.
The purpose of this invention is to provide a kind of mycobacterium tuberculosis recombinant fusion protein, the application in preparation monoclonal antibody, many anti-, vaccine and protein chip.
The present invention has selected three strong antigen epi-positions of mycobacterium tuberculosis H37RV, utilize PCR method, made up a kind of mycobacterium tuberculosis recombinant fusion protein, to compare specificity stronger with antigen commonly used, and be antigen with it, mycobacterium tuberculosis antibody IgG enzyme-linked immunologic detecting kit and mycobacterium tuberculosis antibody IgG colloidal gold kit have been prepared, compare with the similar test kit on the market, has high specificity, advantages such as sensitivity height, the detection that can be tuberculosis infection provides more special, instrument has accurately satisfied the needs of m tuberculosis infection clinical diagnosis well; Also can be used for preparing monoclonal antibody, many anti-, vaccine and protein chip.
Description of drawings
Fig. 1 is the structure schema of expression plasmid pET-28b-38Kd-16Kd-11Kd.
Fig. 2 is that expression plasmid pET-28b-38Kd-16Kd enzyme is cut the product electrophorogram, and wherein 1 represents DNA Marker, and 2,3,4 represent three positive bacterias after enzyme is cut respectively, the empty pET-28b plasmid before 5 expression enzymes are cut.
Fig. 3 is a mycobacterium tuberculosis recombinant fusion protein purifying electrophorogram, the supernatant of 1 expression after the lysis wherein, the precipitation after the 2 expression lysises, the TB albumen of 3 expression purifying.
Embodiment
The preparation of embodiment 1 mycobacterium tuberculosis recombinant fusion protein
1.1 gene fusion
By Computer Analysis TB H37RV genom sequence, selecting the dna sequence dna of its strong antigen epi-position 38Kda albumen (GENEBANKlocus:YP_177770), 16Kda (GENEBANK locus:NP_214765) and 11Kda (GENEBANK locus:AAL16896) is template, and design of amplification primers is:
The 38Kd amplimer:
38-16-11a：atcgCATATGtgtggctcgaaaccaccgagc?54.8％Tm：79.6
38-16-11b：GATTGTTCATACCACCACCACCGCTGGAAATCGTCGCGATC?GC?55.8％Tm：86
The 16Kd amplimer:
38-16-11c：ggtggtggtggtATGAACAATCTCGCATTG?50％Tm：76
38-16-11d：TCCGCAATCACCACCACCACCCTACTTCGTATGGCGATGCG?58.5％Tm：89
The 11Kd amplimer:
38-16-11e：ggtggtggtggtGATTGCGGATCCCATGAC?60％Tm：80.8
38-16-11f：atcgCTCGAGTCCCAAGCTTCCTATGCGAA?50％Tm：56.6
Get the thalline of Mycobacterium tuberculosis H37RV, add 100mL Proteinase K (10mg/mL), put 56 ℃ of water-bath digestion 4 hours,, carry out pcr amplification with above-mentioned primer with conventional phenol/chloroform method purifying;
50mL amplification system: ddH
2O 31.5mL, 10 * buffer 5.0mL, 4 * dNTP 4.0mL, the upstream and downstream primer mixes liquid 4.0mL, DNA 1.5mL, Taqplus 0.2mL (1U);
38-16-11a and 38-16-11b be used to the to increase fragment of 38Kd gene, 38-16-11c and 38-16-11d be used to the to increase fragment of 16Kd gene, 38-16-11e and 38-16-11f be used to the to increase fragment of 11Kd gene; Primer 38-16-11a and 38-16-11f have the restriction enzyme site of NdeI and XhoI respectively, primer 38-16-11c and 38-16-11b order are complementary, and common 5 ' end sequence corresponding to the 16Kd gene fragment, primer 38-16-11e and 38-16-11d order are complementary, and common 5 ' end sequence corresponding to the 11Kd gene fragment;
With Mycobacterium tuberculosis H37RV (available from Nat'l Pharmaceutical ﹠ Biological Products Control Institute) genome is template, fragment with primer 38-16-11a and 38-16-11b amplification 38Kd gene, with the fragment of primer 38-16-11c and 38-16-11d amplification 16Kd gene, with the fragment of primer 38-16-11e and 38-16-11f amplification 11Kd gene;
Product cuts behind the agarose gel electrophoresis purifying, and the blob of viscose that will contain the DNA band (leads to-Beijing TAKARA company name of product: TAKARA MiniBEST Plasmid purification) illustrate and reclaim DNA by DNA fast purifying test kit available from the six directions;
And then be template with being connected pcr amplification 38Kda, 16Kda and 11Kda fusion gene with 38Kda and 11Kda gene fragment, middlely connect with 4 Gly (ggtggtggtggt); Promptly 38Kd target DNA fragment and the 16Kd target DNA fragment that obtains with first round pcr amplification is template, adds primer 38-16-11a and 38-16-11d, amplification 38Kd-16Kd target DNA fragment; Take turns 38Kd-16Kd that pcr amplification obtains and be template with second, add primer 38-16-11a and 38-16-11f, amplification 38Kd-16Kd-11Kd target DNA fragment with the 11Kd target DNA fragment that first round pcr amplification obtains; Obtain complete mycobacterium tuberculosis recombinant fusion protein DNA recombinant fragment: 38Kd-16Kd-11Kd; Amplified production detects through agarose gel electrophoresis, and the result as shown in Figure 1;
Plasmid DNA and 38Kd-16Kd-11Kd all cut through restriction endonuclease, the 50mL system: 10x buffer 5.0mL, and DNA12mL, Xho I and each 15U of Nde I, ddH2O mends to 50mL; 37 ℃ of water-bath 6h.The 50mL enzyme is cut product and is separated through agarose gel electrophoresis, cutting DNA band agar block, and press the explanation of DNA fast purifying test kit and reclaim DNA;
With the fusion gene fragment cloning to pET-28b plasmid (having Xho I and Nde I restriction enzyme site), 20mL linked system: ddH available from magnificent biotech firm
2O15.0mL, 10x buffer 2.0mL, PET-28b 2.0mL, Pab 1.0mL, T4DNA ligase enzyme 20U; Plasmid self connects contrast, 20mL ligation system: ddH
2O 16.0mL, 10xbuffer 2.0mL, PET-28b 2.0mL, T4DNA ligase enzyme 20U; By behind the above-mentioned application of sample, mixing, centrifugal slightly, 14 ℃ of-16 ℃ of connections are spent the night; Transformed E .coli is coated with flat board (the LB solid medium that contains 15 mcg/ml kantlex) and chooses the order-checking of clone's upgrading grain, determines the clone that sequence is correct.The enzyme of recombinant plasmid is cut (NdeI/XhoI) electrophorogram as shown in Figure 2.
1.2 product order-checking
Sequencing primer is: the universal primer of S38-16 (GCTGGAAATCGTCGCGATCAA) and T7promoter and T7terminator.The mensuration synthetic and recombinant plasmid sequence pET-28b-38Kd-16Kd-11Kd of all amplimers and sequencing primer all provides service by the big genome company of China.The nucleotide sequence that records the purpose fusion gene is shown in SEQ ID NO:1.
1.3 the expression of mycobacterium tuberculosis recombinant fusion protein, purifying
Plasmid (pET-28b-38Kd-16Kd-11Kd) with the correct clone of checking, transformed into escherichia coli BL21 (DE3) (available from magnificent biotech firm) host bacterium, target protein is expressed in inclusion body: BL21 (DE3) the host bacterium that will contain the 38Kd-16Kd-11Kd gene is cultivated OD 0.6, with final concentration 1mM IPTG abduction delivering, collect thalline, ultrasonication, high speed centrifugation, collecting precipitation after 4 hours.The precipitation of collecting is carried out purifying with Ni post (the chelating sephrose fast flow of Pharmcia company), use following eluant solution: 300mM imidazoles, 20mM Tris, 500Mm NaCl, 8M Urea.38Kda, 16Kda and 11Kd fusion gene expressing protein be totally 619 amino acid, and aminoacid sequence is shown in SEQ ID NO:2.
1.4 mycobacterium tuberculosis recombinant fusion protein is identified
1.4.1 the mensuration of purity and molecular weight: through SDS-PAGE electrophoresis detection (albumen applied sample amount 10 μ g), be single district band, thin layer scanning identifies that purity is 95.8%.Molecular weight is about 66Kd, and detected result is seen accompanying drawing 3.
1.4.2 concentration determination: measure through Folin-phenol method, as the standard reference product, antigen protein concentration is 3.5 ± 0.12mg/mL with bovine serum albumin.
1.4.3 determination of activity: measure with indirect ELISA method.Package amount 2.0 μ g/ holes use inner quality controlled serum to measure the OD value, the results are shown in Table 1.
Table 1 mycobacterium tuberculosis recombinant fusion protein determination of activity result
Antigen antibody reaction: adopt protein blot technology (Western Blot), with anti-people's tuberculosis IgG antibody positive human serum test TB fusion rotein antigen, visible positive reaction, SDS-PAGE also confirms that antigenic molecular weight is 66KD.The results are shown in accompanying drawing 4.
1.4.4 fusion rotein stability is measured:
The stability of protein concn is measured, and divides the stability of measuring the protein concn of the tuberculosis antigen solution of preserving for three times, the results are shown in Table 2.
The antigenic concentration determination of table 2. mycobacterium tuberculosis recombinant fusion protein
Test result shows that the protein concn of the tuberculosis antigen solution of-85 ℃ of preservations is highly stable.
The active stability of mycobacterium tuberculosis recombinant fusion protein is measured, and divides the mycobacterium tuberculosis recombinant fusion protein of three specking-85 ℃ preservations and makes colloidal gold kit, carries out measurement result with enterprise's Quality Control reference product and sees Table 3.
The result of appraisal of table 3 tuberculosis antibody enterprise Quality Control reference product
Measurement result shows that the immunocompetence of the mycobacterium tuberculosis recombinant fusion protein of-85 ℃ of preservations is stable.
Annotate: the used sample of the present invention is provided by entire PLA tuberculosis research centre.Make by tuberculosis patient serum tuberculosis antibody IgG male the infecteds of clinical definites such as clinical bacteriology inspection and Clinical X line and negative serum, blood plasma.30 samples, the wherein negative reference material (N) of 15 anchorage people tuberculosis antibody IgG; The positive reference material (P) of 15 anchorage people tuberculosis antibody IgG.
Adopt indirect ELISA method to detect mycobacterium tuberculosis antibody IgG, can be used for the evaluation of TB antigenic activity and the auxiliary diagnosis that TB infects.Present embodiment is done antigen with the mycobacterium tuberculosis recombinant fusion protein that embodiment 1 makes; For determining antigen coated amount and ELIAS secondary antibody working concentration, be specimen with positive and negative reference material, adopt the square formation volumetry to select best antigen coated amount and corresponding ELIAS secondary antibody working concentration, see the following form 4.
The selection of best antigen coated amount of table 4 and corresponding ELIAS secondary antibody working concentration
Annotate: with positive and negative reference material is specimen, and any a positive appears in negative reference material promptly to be judged and false positive results occurs, promptly represents with " ± " in table; Any a feminine gender appears in positive reference material promptly to be judged and false negative result occurs, promptly represents with " ± " in table.
According to test result, in antigen coated amount is 2.0 μ g/ holes, when the ELIAS secondary antibody working concentration is 4mg/ml, detected result the best, so by microwell plate and 4mg/ml ELIAS secondary antibody IgG, set up mycobacterium tuberculosis antibody IgG enzyme linked immunosorbent detection method (indirect ELISA) with TB recombinant antigen 2.0 μ g/ holes bag.
The preparation of embodiment 3 mycobacterium tuberculosis antibody IgG diagnostic kits (colloidal gold method) and performance calibrating
2.1 test kit is formed and preparation
Test kit of the present invention as antigen, adopts dual-antigen sandwich method with mycobacterium tuberculosis (TB) recombination fusion protein of embodiment 1 purifying.Add serum to be checked during use, as containing anti-TB specific antibody in the sample, then combine with golden mark TB antigen earlier, moving ahead combines the formation mixture again and presents purple-red colour with the corresponding TB antigen on film surface.As nonreactive TB specific antibody in the sample, then have only the nature controlling line color, its colour intensity directly and the amount of the anti-TB specific antibody IgG that exists in the sample proportional.
The main moiety of test kit is a test panel, comprises sample application zone, the antigen coated film of gold mark district, antigen coated detection zone, Quality Control district and absorbent pad district.
2.1.1 the nature controlling line bag is by the anti-TB antibody of rabbit: (available from Beijing Sai Dike biotech company, protein concentration is 4.0 ± 0.15mg/mL, immune agar double diffusion tires 〉=and 1: 16).
2.1.2 colloid gold label TB antigen: Radioactive colloidal gold diameter 30nm colloid gold particle, stoste optical density(OD) OD is not less than 10.0.
2.1.3 condition optimizing
2.1.3.1 determining of antigen and the antigen coated concentration of gold mark: adopt the square formation titration to select best antigen coated concentration and corresponding golden labelled antigen working concentration, see the following form 5.
The selection of best antigen of table 5 and corresponding golden labelled antigen working concentration
Annotate: with positive and negative serum Quality Control reference product is specimen, and any a positive appears in negative reference material promptly to be judged and false positive results occurs, promptly represents with "+/ " in table; Any a feminine gender appears in positive reference material promptly to be judged and false negative result occurs, promptly represents with "/" in table.
According to test result, be that 1.0 μ L/cm and golden labelled antigen specking amount are under the condition of 1.0 μ L/cm in antigen specking amount, selected best antigen specking concentration is 1.0mg/mL, the working concentration of golden labelled antigen staining fluid is an OD value 80.0.
2.1.3.2 determining of best antigen specking amount: determining that best antigen specking concentration is that 1.0mg/mL and best golden labelled antigen specking concentration are on the basis of OD value 80.0, adopting the square formation titration to select best antigen specking amount (seeing Table 6)
Determining of the best antigen specking of table 6 amount
According to test result, selected best antigen specking amount is 1.0 μ L/cm.
2.1.3.3 determining of best golden labelled antigen specking amount: determining that best antigen specking concentration is 1.0mg/mL, the specking amount is that 1.0 μ L/cm and best golden labelled antigen specking concentration are on the basis of OD value 80.0, adopts the square formation titration to select best golden labelled antigen specking amount (seeing Table 7).
Determining of the best golden labelled antigen specking amount of table 7
According to test result, selected best golden labelled antigen specking amount is 1.0 μ L/cm.
2.1.3.4 the selection of the anti-TB antibody sandwich of nature controlling line concentration
Anti-TB antibody sandwich amount is 1 μ L/cm.The experimental result that the anti-TB bag of nature controlling line is selected by concentration sees Table 8.
The anti-TB bag of table 8 nature controlling line is by the selection of concentration
-: control line does not appear; +: control line is clear; +++: control line line is clear thick.
Table 8 shows that used gold mark antigen has reactive preferably in the anti-TB antibody of rabbit and this test.1.0mg/mL the anti-TB of concentration bag can be shown the contrast effect basically preferably, continues to improve antibody concentration and fails obviously to improve response intensity.Thereby the concentration of selecting the anti-TB of 1.0mg/mL as the nature controlling line bag by concentration.
2.1.3.5 the selection of reaction film off-period
The nitrocellulose filter bag by TB antigen and anti-TB antibody after, can reduce nonspecific reaction effectively through confining liquid sealing.Selection experimental result to reaction film off-period sees Table 9.
The selection experimental result of table 9 reaction film off-period (37 ℃)
| Reaction times | 15 minutes | 30 minutes | 45 minutes | 60 minutes | 75 minutes |
| Negative serum | ??× | ??× | ??- | ??- | ??- |
| Positive serum | ??× | ??× | ??++ | ??++ | ??++ |
-: negative reaction; ±: probable positive; ++ positive reaction; *: the reaction film blurred background
Table 9 shows that off-period, difference had certain influence to correct reflection experimental result.Off-period, too short meeting caused the reaction film blurred background, influenced interpretation as a result.This result of experiment shows sealing 45 minutes-75 minutes, and sealing effect is better, helps to improve the accuracy of experimental result.Selecting sealing was production control condition in 60 minutes.
2.1.3.6 the selection of reaction film drying conditions
The experimental result that table 10 reaction film drying conditions is selected
The drying conditions that reaction film suits is not only relevant with the sensitivity of reagent, and more close with the stability relation of reagent.The result of table 10 shows, is under 20% environment in relative humidity, lacks the then poor stability of reagent time of drying, and time of drying, length then influenced the accuracy of reaction result.In relative humidity is 25%, 30% environment when being 45 minutes, 60 minutes, 75 minutes following time of drying, and reaction result is more approaching, and susceptibility and stability are preferably all arranged.Consider controllability in process of production, adopt relative humidity 25%-30%, 60 minutes condition of drying to be the drying conditions in producing.
2.1.3.7 the selection of golden labelled antigen pad time of drying
The experimental result of table 11 gold labelled antigen pad selection time of drying
Gold labelled antigen pad drying is under 37 ℃ of conditions.Table 11 shows that dry environment relative humidity is crossed to hang down may influence response intensity.Under relatively more suitable dry environment, 3 hours time of drying, 4 hours, 5 hours, drying effect was more approaching, and the reaction sensibility of reagent and stability are all better.So select relative humidity 25%-30% for use, be production control condition in dry 4 hours.
2.1.3.8 the selection of sample detection reaction time
The selection experimental result (A) of table 12 sample detection reaction time
The selection experimental result (B) of table 13 sample detection reaction time
Table 12 and table 13 show, under room temperature condition usually (15 ℃～30 ℃), the anti-TB positive or strong positive reaction serum clear and definite positive reaction result can occur in 5-10 minute after reaction.When the weak positive reaction serum of anti-TB reacts at normal temperatures, need the long reaction times, can obtain clear and definite positive reaction result in the time of 25-30 minute in reaction.Anti-TB negative serum is reflected in 30 minutes under common room temperature condition (15 ℃～30 ℃), can correctly reflect substantially to measure serum character.Reaction times is long might cause false positive.Therefore, the time of judgement is as a result determined judge reaction result in the time of 25-30 minute in reaction.Consider that in particular cases the room temperature of possible real work is lower than 15 ℃, influences reaction result, take to prolong the measure in 10 minute reaction times, also can obtain satisfied result.
2.1.4 the manufacturing of test kit
1) the bag quilt of check-out console: the precut of NC film, stickup, antigen is diluted to optimum concn with pH7.2,0.02mol/L PBS damping fluid, the anti-TB antibody of Quality Control is diluted to optimum concn with pH7.2,0.02mol/L PBS damping fluid, respectively with the optimal conditions specking on the NC film, drying, sealing, drying;
Confining liquid prescription: 0.02mol/L PBS damping fluid (pH7.2 contains 0.25% skim-milk);
2) stickup of golden labelled antigen: with the golden labelled antigen solution of 0.05mol/L Tris-HCl damping fluid (pH8.0) preparation, bag is pasted on bag by good check-out console by on the glass fibre mould after the drying;
3) assembling: check-out console cuts into test strip, assembles, packs.
2.1.5 detection method and interpretation of result
1) take out test panel, place on the plane operations platform, balance is to room temperature.
2) application of sample: micro sample adding appliance adds undiluted test serum 100 μ l in well.
3) observe and write down the result in 15-20 minute.The strong positive result can occur at 5 minutes, and the weak positive and negative findings need be waited for observation in 20 minutes.Positive: two red-purple lines appear in interpretation window (C and T position); Negative: red-purple lines (C position) only appear in the interpretation window; Invalid: the interpretation window does not have the red-purple lines.
2.2 test kit performance evaluation
2.2.1 detected result to 30 parts of TB reference materials
Use the test kit of the present invention's preparation, TB antibody reference material is detected, detected result sees Table 14.
Table 14 pair 30 parts of TB antibody reference material detected results
-: negative reaction; +: positive reaction; ++: than strong positive reaction; +++: strong positive reaction.
From the test the result as can be seen, negative, positive coincidence rate all reaches 100%.Therefore we think that it is feasible adopting this detection system.
2.2.2 cross reaction test to antibody positive serum such as HBV, HCV, HAV and syphilis
Adopt the cross reaction of test kit of the present invention to HBV (hepatitis B), HCV (hepatitis C), HAV (hepatitis A), cancer and non-tuberculosis respiratory system patients serum, with its specificity of further evaluation, above-mentioned affirmation patient blood sample is tested, be the results are shown in following table.
The cross reaction test result of antibody positive serum such as table 15HBV, HCV, HAV and syphilis
The result shows that this test kit and above-mentioned patient's blood sample no cross reaction take place.
2.2.3 the cross reaction to chaff interferences such as syphilis (RF) positive serum, blood fat, bilirubin and oxyphorases detects
The test result of chaff interferences such as table 16 pair syphilis (RF) positive serum, blood fat, bilirubin and oxyphorase
The result shows that the cross reaction of this test kit and chaff interferences such as RF positive serum, blood fat, bilirubin and oxyphorase does not surpass the false positive rate of normal human serum sample.
2.2.4 relatively wait testing data with external like product
Make comparisons with the tuberculosis antibody quick diagnosis reagent kit of new generation that the general biological medicine of test kit of the present invention and Shanghai Australia company limited produces.215 parts of positive serums and healthy people's negative serum are compared detection, the results are shown in following table
The compare test result of table 17 and the general tuberculosis antibody test kit of Shanghai Australia
Verity and predictive value's computational analysis:
Table 18 verity and predictive value's computational analysis
| Method of calculation | Calculation result |
| Sensitivity=A/ (A+C) * 100% | ??174/(174+26)＝87.0％ |
| Specific degree=D/ (B+D) * 100% | ??228/(2+228)＝99.1％ |
| The * 100% of false positive rate=B/B+D) | ??2/(2+228)＝0.8％ |
| The * 100% of false negative rate=C/B+D) | ??26/(2+228)＝11.3％ |
| Thick consistent=(A+D)/(A+B+C+D) * 100% | ??(174+228)/(174+2+26+228)＝93.4％ |
| Adjust consistence=1/4 (A/ (A+B)+A/ (A+C)+D/ (C+D)+D/ (B+D)) * 100% | ??1/4(174/(174+2)+174/(174+26)+228/(26+228)??+228/(2+228))＝93.6％ |
| Youden index=(A/ (A+C)+D/ (B+D))-1 | ??(174/(174+26)+228/(2+228))＝0.861 |
| Predictive value=the A/ of positive test (A+B) * 100% | ??174/(174+2)＝98.8 |
| Predictive value=the D/ of negative test (C+D) * 100% | ??228/(26+228)＝89.7％ |
The detection coincidence rate of the general tuberculosis antibody test kit of test kit of the present invention and reference product Shanghai Australia is 93.49%.
SEQUENCE?LISTING
＜110〉Jilin University
＜120〉a kind of mycobacterium tuberculosis recombinant fusion protein and application thereof
<130>GD0702
<160>2
<170>PatentIn?version?3.3
<210>1
<211>1857
<212>DNA
＜213〉Mycobacterium tuberculosis (Mycobacterium tuberculosis)
<400>1
tgtggctcga?aaccaccgag?cggttcgcct?gaaacgggcg?ccggcgccgg?tactgtcgcg???60
actacccccg?cgtcgtcgcc?ggtgacgttg?gcggagaccg?gtagcacgct?gctctacccg??120
ctgttcacct?gtggggtccg?gcctttcacg?agaggtatcc?gaacgtcacg?atcaccgctc??180
agggcaccgg?ttctggtgcc?gggatcgcgc?aggccgccgc?cgggacggtc?aacattgggg??240
cctccgacgc?ctattgtcgg?aaggtgatat?ggccgcgcac?aaggggctga?tgaacatcgc??300
gctagccatc?tccgctcagc?aggtcaacta?caacctgccc?ggagtgagcg?agcacctcaa??360
gctgaacgga?aaagtcctgg?cgccatgtac?cagggcacca?tcaaaacctg?ggacgacccg??420
cagatcgctg?cgctcaaccc?cggcgtgaac?ctgcccggca?ccgcggtagt?tccgctgcac??480
cgctccgacg?ggtccggtga?caccttctgt?tcacccagta?cctgtccaag?caagatcccg??540
agggctgggg?caagtcgccc?ggcttcggca?ccaccgtcga?cttcccggcg?gtgccgggtg??600
cgctgggtga?gaacggcaac?ggcggcatgg?tgaccgttgc?gccgagacac?cgggctgcgt??660
ggcctatatc?ggcatcagct?tcctcgacca?ggccagtcaa?cggggactcg?gcgaggccca??720
actaggcaat?agctctggca?atttcttgtt?gcccgacgcg?caagcattca?ggccgcggcg??780
gctggcttcg?catcgaaaac?cccggcgaac?caggcgattt?cgatgatcga?cgggcccgcc??840
ccggacggct?acccgatcat?caactacgag?tacgccatcg?tcaacaaccg?caaaaggacg??900
ccgccaccgc?gcagaccttg?caggcatttc?tgcactgggc?gatcaccgac?ggcaacaagg???960
cctcgttcct?cgaccaggtt?catttccagc?cgctgccgcc?cgcggtggtg?aagttgctga??1020
cgcgttgatc?gcgacgattt?ccagcggtgg?tggtggtatg?aacaatctcg?cattgtggtc??1080
gcgtccggtg?tgggacgttg?agccctggga?ccgctggcta?cgtgacttct?tcggccctgc??1140
cgcacgacgg?actggtaccg?cccggtcgcc?ggagacttca?cgccggccgc?cgagatcgtc??1200
aaggatggcg?cgacgcggtg?gtccgtttgg?aactgcccgg?cattgacgtc?gacaaggacg??1260
tcaacgtcgg?cttgaccctg?gccagccggt?gagccgcctg?gtgatccgcg?gcgaacaccg??1320
cgacgagcac?acgcaagcgc?cggagacaaa?gacggccgca?ccctgcgtga?gatccgctac??1380
ggatcattcc?gccgccgttc?cggctgcccg?cgcacgtcac?cagcgaggcc?atcgcggctt??1440
cctatgacgc?cggtgtgctg?accgccgggt?tgccggcgcc?tacaaggccc?cagccgaaac??1500
tcaggcgcag?cgcatcgcca?tacgaagtag?ggtggtggtg?gtgattgcgg?atcccatgac??1560
agagcagcag?tggaatttcg?cgggtatcga?ggccgcggca?agcgcaatcc?agggaaatgt??1620
cacgtccatt?cattccctcc?ttgacgaggg?gaagcagtcc?ctgaccaagc?tcgcagcggc??1680
ctggggcggt?agcggttcgg?aggcgtacca?gggtgtccag?caaaaatggg?acgccacggc??1740
taccgagctg?aacaacgcgc?tgcagaacct?ggcgcggacg?atcagcgaag?ccggtcaggc??1800
aatggcttcg?accgaaggca?acgtcactgg?gatgttcgca?taggaagctt?gggaatc?????1857
<210>2
<211>619
<212>PRT
＜213〉Mycobacterium tuberculosis (Mycobacterium tuberculosis)
<220>
<221>misc_feature
<222>(349)..(349)
<223>Xaa?can?be?any?naturally?occurring?amino?acid
<400>2
Cys?Gly?Ser?Lys?Pro?Pro?Ser?Gly?Ser?Pro?Glu?Thr?Gly?Ala?Gly?Ala
1???????????????5???????????????????10??????????????????15
Gly?Thr?Val?Ala?Thr?Thr?Pro?Ala?Ser?Ser?Pro?Val?Thr?Leu?Ala?Glu
20??????????????????25??????????????????30
Thr?Gly?Ser?Thr?Leu?Leu?Tyr?Pro?Leu?Phe?Thr?Cys?Gly?Val?Arg?Pro
35??????????????????40??????????????????45
Phe?Thr?Arg?Gly?Ile?Arg?Thr?Ser?Arg?Ser?Pro?Leu?Arg?Ala?Pro?Val
50??????????????????55??????????????????60
Leu?Val?Pro?Gly?Ser?Arg?Arg?Pro?Pro?Pro?Gly?Arg?Ser?Thr?Leu?Gly
65??????????????????70??????????????????75??????????????????80
Pro?Pro?Thr?Pro?Ile?Val?Gly?Arg?Gly?Tyr?Gly?Arg?Ala?Gln?Gly?Ala
85??????????????????90??????????????????95
Asp?Glu?His?Arg?Ala?Ser?His?Leu?Arg?Ser?Ala?Gly?Gln?Leu?Gln?Pro
100?????????????????105?????????????????110
Ala?Arg?Ser?Glu?Arg?Ala?Pro?Gln?Ala?Glu?Arg?Lys?Ser?Pro?Gly?Ala
115?????????????????120?????????????????125
Met?Tyr?Gln?Gly?Thr?Ile?Lys?Thr?Trp?Asp?Asp?Pro?Gln?Ile?Ala?Ala
130?????????????????135?????????????????140
Leu?Asn?Pro?Gly?Val?Asn?Leu?Pro?Gly?Thr?Ala?Val?Val?Pro?Leu?His
145?????????????????150?????????????????155?????????????????160
Arg?Ser?Asp?Gly?Ser?Gly?Asp?Thr?Phe?Cys?Ser?Pro?Ser?Thr?Cys?Pro
165?????????????????170?????????????????175
Ser?Lys?Ile?Pro?Arg?Ala?Gly?Ala?Ser?Arg?Pro?Ala?Ser?Ala?Pro?Pro
180?????????????????185?????????????????190
Ser?Thr?Ser?Arg?Arg?Cys?Arg?Val?Arg?Trp?Val?Arg?Thr?Ala?Thr?Ala
195?????????????????200?????????????????205
Ala?Trp?Gly?Pro?Leu?Arg?Arg?Asp?Thr?Gly?Leu?Arg?Gly?Leu?Tyr?Arg
210?????????????????215?????????????????220
His?Gln?Leu?Pro?Arg?Pro?Gly?Gln?Ser?Thr?Gly?Thr?Arg?Arg?Gly?Pro
225?????????????????230?????????????????235?????????????????240
Thr?Arg?Gln?Leu?Leu?Trp?Gln?Phe?Leu?Val?Ala?Arg?Arg?Ala?Ser?Ile
245?????????????????250?????????????????255
Gln?Ala?Ala?Ala?Ala?Gly?Phe?Ala?Ser?Lys?Thr?Pro?Ala?Asn?Gln?Ala
260?????????????????265?????????????????270
Ile?Ser?Met?Ile?Asp?Gly?Pro?Ala?Pro?Asp?Gly?Tyr?Pro?Ile?Ile?Asn
275?????????????????280?????????????????285
Tyr?Glu?Tyr?Ala?Ile?Val?Asn?Asn?Arg?Lys?Arg?Thr?Pro?Pro?Pro?Arg
290?????????????????295?????????????????300
Arg?Pro?Cys?Arg?His?Phe?Cys?Thr?Gly?Arg?Ser?Pro?Thr?Ala?Thr?Arg
305?????????????????310?????????????????315?????????????????320
Pro?Arg?Ser?Ser?Thr?Arg?Phe?Ile?Ser?Ser?Arg?Cys?Arg?Pro?Arg?Trp
325?????????????????330?????????????????335
Arg?Ser?Cys?Gly?Arg?Val?Asp?Arg?Asp?Asp?Phe?Gln?Arg?Trp?Trp?Trp
340?????????????????345?????????????????350
Tyr?Glu?Gln?Ser?Arg?Ile?Val?Val?Ala?Ser?Gly?Val?Gly?Arg?Cys?Ala
355?????????????????360?????????????????365
Leu?Gly?Pro?Leu?Ala?Thr?Gly?Leu?Leu?Arg?Pro?Cys?Arg?Thr?Thr?Asp
370?????????????????375?????????????????380
Trp?Tyr?Arg?Pro?Val?Ala?Gly?Asp?Phe?Thr?Pro?Ala?Ala?Glu?Ile?Val
385?????????????????390?????????????????395?????????????????400
Lys?Asp?Gly?Ala?Thr?Arg?Trp?Ser?Val?Trp?Asn?Cys?Pro?Ala?Leu?Thr
405?????????????????410?????????????????415
Ser?Thr?Arg?Thr?Ser?Thr?Ser?Ala?Val?Pro?Trp?Pro?Ala?Gly?Glu?Pro
420?????????????????425?????????????????430
Pro?Gly?Asp?Pro?Arg?Arg?Thr?Pro?Arg?Arg?Ala?His?Ala?Ser?Ala?Gly
435?????????????????440?????????????????445
Asp?Lys?Asp?Gly?Arg?Thr?Leu?Arg?Glu?Ile?Arg?Tyr?Gly?Ser?Phe?Arg
450?????????????????455?????????????????460
Arg?Arg?Ser?Gly?Cys?Pro?Arg?Thr?Ser?Pro?Ala?Arg?Pro?Ser?Arg?Leu
465?????????????????470?????????????????475?????????????????480
Pro?Met?Thr?Pro?Val?Cys?Gly?Pro?Pro?Gly?Cys?Arg?Arg?Leu?Gln?Gly
485?????????????????490?????????????????495
Pro?Ser?Arg?Asn?Ser?Gly?Ala?Ala?His?Arg?His?Thr?Lys?Arg?Gly?Gly
500?????????????????505?????????????????510
Gly?Gly?Asp?Cys?Gly?Ser?His?Asp?Arg?Ala?Ala?Val?Glu?Phe?Arg?Gly
515?????????????????520?????????????????525
Tyr?Arg?Gly?Arg?Gly?Lys?Arg?Asn?Pro?Gly?Lys?Cys?His?Val?His?Ser
530?????????????????535?????????????????540
Phe?Pro?Pro?Lys?Arg?Gly?Glu?Ala?Val?Pro?Asp?Gln?Ala?Arg?Ser?Gly
545?????????????????550?????????????????555?????????????????560
Leu?Gly?Arg?Pro?Arg?Phe?Gly?Gly?Val?Pro?Gly?Cys?Pro?Ala?Lys?Met
565?????????????????570?????????????????575
Gly?Arg?His?Gly?Tyr?Arg?Ala?Glu?Gln?Arg?Ala?Ala?Glu?Pro?Gly?Ala
580?????????????????585?????????????????590
Asp?Asp?Gln?Arg?Ser?Arg?Ser?Gly?Asn?Gly?Phe?Asp?Arg?Arg?Gln?Arg
595?????????????????600?????????????????605
His?Trp?Asp?Val?Arg?Ile?Gly?Ser?Leu?Gly?Ile
610?????????????????615
Claims (10)
1. the gene 38Kd-16Kd-11Kd of a mycobacterium tuberculosis recombinant fusion protein, it is characterized in that: its nucleotide sequence is shown in SEQ ID NO:1.
2. mycobacterium tuberculosis recombinant fusion protein, it is characterized in that: its aminoacid sequence is shown in SEQ ID NO:2.
3. a kind of mycobacterium tuberculosis recombinant fusion protein according to claim 2 is characterized in that: it is from Mycobacterium tuberculosis H37RV.
4. a kind of mycobacterium tuberculosis recombinant fusion protein according to claim 2 is characterized in that: it is to be made by following method:
1) synthetic following primer:
38-16-11a：ATCGCATATGTGTGGCTCGAAACCACCGAGC
38-16-11b：GATTGTTCATACCACCACCACCGCTGGAAATCGTCGCGATCGC
38-16-11c：GGTGGTGGTGGTATGAACAATCTCGCATTG
38-16-11d：TCCGCAATCACCACCACCACCCTACTTCGTATGGCGATGCG
38-16-11e：GGTGGTGGTGGTGATTGCGGATCCCATGAC
38-16-11f：ATCGCTCGAGTCCCAAGCTTCCTATGCGAA
With Mycobacterium tuberculosis H37RV is that template increases, and makes gene 38Kd-16Kd-11Kd;
2) the gene insertion is reached on the carrier pET-28b, get recombinant plasmid pET-28b-38Kd-16Kd-11Kd;
3) the recombinant plasmid transfection is expressed to the e. coli bl21 (DE3), purifying.
5. mycobacterium tuberculosis antibody IgG enzyme-linked immunologic detecting kit, it comprises: TB antigen and ELIAS secondary antibody, it is characterized in that: TB antigen is claim 2,3 or 4 described a kind of mycobacterium tuberculosis recombinant fusion proteins, the antigen coated amount of TB is 1.0-8.0 μ g/ hole, and the ELIAS secondary antibody working concentration is 2.0-16.0mg/mL.
6. a kind of mycobacterium tuberculosis antibody IgG enzyme-linked immunologic detecting kit according to claim 5 is characterized in that: the antigen coated amount of TB is 2.0 μ g/ holes, and the ELIAS secondary antibody working concentration is 4.0mg/mL.
7. mycobacterium tuberculosis antibody IgG colloidal gold kit, it comprises: TB antigen, colloid gold label TB antigen and nature controlling line bag be is characterized in that by the anti-TB antibody of rabbit: TB antigen is claim 2,3 or 4 described a kind of mycobacterium tuberculosis recombinant fusion proteins.
8. a kind of mycobacterium tuberculosis antibody IgG colloidal gold kit according to claim 7, it is characterized in that: TB antigen specking concentration is 0.25-2.0mg/mL, the working concentration of gold mark TB antigen staining fluid is OD value 50.0-100.0, TB antigen specking amount is 0.5-1.75 μ L/cm, gold mark TB antigen specking amount is 0.5-1.75 μ L/cm, and the anti-TB antibody sandwich of nature controlling line concentration is 0.5-2.0mg/mL.
9. a kind of mycobacterium tuberculosis antibody IgG colloidal gold kit according to claim 8, it is characterized in that: TB antigen specking concentration is 1.0mg/mL, the working concentration of gold mark TB antigen staining fluid is an OD value 80.0, TB antigen specking amount is 1.0 μ L/cm, gold mark TB antigen specking amount is 1.0 μ L/cm, and the anti-TB antibody sandwich of nature controlling line concentration is 1.0mg/mL.
10. according to the application in preparation monoclonal antibody, many anti-, vaccines and protein chip of claim 2,3 or 4 described a kind of mycobacterium tuberculosis recombinant fusion proteins.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910217951A CN101838660A (en) | 2009-12-02 | 2009-12-02 | Mycobacterium tuberculosis recombinant fusion protein and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910217951A CN101838660A (en) | 2009-12-02 | 2009-12-02 | Mycobacterium tuberculosis recombinant fusion protein and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101838660A true CN101838660A (en) | 2010-09-22 |
Family
ID=42742336
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200910217951A Pending CN101838660A (en) | 2009-12-02 | 2009-12-02 | Mycobacterium tuberculosis recombinant fusion protein and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101838660A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102183649A (en) * | 2011-01-31 | 2011-09-14 | 中国农业大学 | Bovine tuberculosis antigen specific gamma-interferon enzyme-linked immuno sorbent assay (ELISA) kit |
| CN102295687A (en) * | 2011-08-12 | 2011-12-28 | 广东瀚森生物药业有限公司 | Renaturing and purifying method of mycobacterium-tuberculosis recombinant inclusion-body protein |
| CN102653553A (en) * | 2011-03-03 | 2012-09-05 | 中国科学院生物物理研究所 | Polypeptide having high affinity with beta clamp of mycobacterium tuberculosis |
| CN109856405A (en) * | 2018-12-21 | 2019-06-07 | 新兴县国研科技有限公司 | A kind of Porcine epidemic diarrhea virus antibody test test strips |
-
2009
- 2009-12-02 CN CN200910217951A patent/CN101838660A/en active Pending
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102183649A (en) * | 2011-01-31 | 2011-09-14 | 中国农业大学 | Bovine tuberculosis antigen specific gamma-interferon enzyme-linked immuno sorbent assay (ELISA) kit |
| CN102653553A (en) * | 2011-03-03 | 2012-09-05 | 中国科学院生物物理研究所 | Polypeptide having high affinity with beta clamp of mycobacterium tuberculosis |
| CN102295687A (en) * | 2011-08-12 | 2011-12-28 | 广东瀚森生物药业有限公司 | Renaturing and purifying method of mycobacterium-tuberculosis recombinant inclusion-body protein |
| CN109856405A (en) * | 2018-12-21 | 2019-06-07 | 新兴县国研科技有限公司 | A kind of Porcine epidemic diarrhea virus antibody test test strips |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP1478395B1 (en) | Rapid lateral flow assay for determining exposure to mycobacterium tuberculosis and other mycobacteria | |
| CN101100673A (en) | Mycobacterium tuberculosis recombination fusion protein and application thereof | |
| CN101294964A (en) | Reagent and method for detecting active tuberculosis and tuberculosis dormant infection | |
| CN101968490A (en) | Indirect ELISA (Enzyme-Linked Immunosorbent Assay) method and kit for detecting haemophilus parasuis antibodies | |
| CN111647054B (en) | Reagent for detecting novel coronavirus SARS-CoV-2 antibody and its application | |
| JP2009501900A (en) | Methods and compositions for detecting herpes simplex virus type 2 | |
| CN101914563A (en) | Mycobacterium tuberculosis 38Kd-16Kd-CFP10 recombinant fusion protein and application thereof | |
| CN103059109B (en) | Mycoplasma pneumonia antigen, preparation method and immunodetection kit | |
| CN114736290B (en) | Nanometer antibody capable of recognizing porcine pseudorabies virus with high accuracy and sensitivity, preparation method and application | |
| CN101838660A (en) | Mycobacterium tuberculosis recombinant fusion protein and application thereof | |
| CN113215107A (en) | Time-resolved fluoroimmunoassay kit for detecting novel coronavirus and preparation method thereof | |
| CN101363858B (en) | Test paper strip for detecting PRRSV antibody colloidal gold, method for making same and applications | |
| CN110964089B (en) | Mycoplasma pneumoniae antigen | |
| CN101914562A (en) | Mycobacterium tuberculosis 38Kd-11Kd-CFP10 recombinant fusion protein and application thereof | |
| CN103834668A (en) | Recombination mycoplasma pneumoniae protein and application thereof | |
| CN101509002B (en) | Recombinant rubella virus protein and uses thereof | |
| Burnie | Developments in the serological diagnosis of opportunistic fungal infections | |
| CN101508999B (en) | Recombinant toxoplasma protein and uses thereof | |
| CN113721035B (en) | Colloidal gold immunochromatographic test paper card for detecting African swine fever virus antibody | |
| KR20170062742A (en) | Diagnostic kit for tsutsugamushi disease | |
| CN102660559B (en) | Mycobacterium tuberculosis (TB) recombinant protein and preparation method thereof | |
| CN105004865A (en) | Candida albicans enolase antibody test paper | |
| CN106279408B (en) | Monoclonal antibody and antibody combination for resisting foot-and-mouth disease type O virus and application of monoclonal antibody and antibody combination in detection of virus antigen and antibody | |
| CN109734792B (en) | Human CNTN1 antigen, human CNTN1 antibody detection kit, preparation method and application thereof | |
| EP3792630A1 (en) | Lateral flow immunoassay device for detection of candida infection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20100922 |