CN101914562A - Mycobacterium tuberculosis 38Kd-11Kd-CFP10 recombinant fusion protein and application thereof - Google Patents
Mycobacterium tuberculosis 38Kd-11Kd-CFP10 recombinant fusion protein and application thereof Download PDFInfo
- Publication number
- CN101914562A CN101914562A CN2010102309810A CN201010230981A CN101914562A CN 101914562 A CN101914562 A CN 101914562A CN 2010102309810 A CN2010102309810 A CN 2010102309810A CN 201010230981 A CN201010230981 A CN 201010230981A CN 101914562 A CN101914562 A CN 101914562A
- Authority
- CN
- China
- Prior art keywords
- antigen
- cfp10
- fusion protein
- mycobacterium tuberculosis
- colloid gold
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The invention relates to a mycobacterium tuberculosis 38Kd-11Kd-CFP10 recombinant fusion protein and application thereof. The invention provides the mycobacterium tuberculosis 38Kd-11Kd-CFP10 recombinant fusion protein, and also provides the application of the recombinant fusion protein in preparing monoclonal antibodies, polyclonal antibodies, assay kits and protein chips. Compared with congener kits in the market, the mycobacterium tuberculosis assay kit prepared from the mycobacterium tuberculosis 38Kd-11Kd-CFP10 recombinant fusion protein has the advantages of high specificity, high sensitivity and the like, and well meets the requirements for the clinical diagnosis of tubercle bacillus (TB) infection.
Description
Technical field
The present invention relates to the genetically engineered field, relate to a kind of mycobacterium tuberculosis recombinant fusion protein and application thereof particularly.
Background technology
Tuberculosis is that (Mycobacterium tuberculosis, TB) human diseases due to the infection is the main type of mycobacterial disease, mainly passes through respiratory infectious by Mycobacterium tuberculosis.Since Germany scientist Rrobert Koch in 1882 found TB, the whole world had 200,000,000 people to die from TB approximately, and the epidemic situation development is on the rise.Estimate that according to WHO existing patient TB 2,000 ten thousand in the whole world also will have 9,000 ten thousand people morbidity as not controlling 10 years from now on.China has 3.3 hundred million tubercle bacillus affection persons now, and pulmonary tuberculosis patient more than 600 ten thousand wherein has serious communicable patient 1,500,000, dies from 250,000 people that reach lungy every year.Therefore, prevention lungy, early diagnosis and treatment in time are the problems of showing great attention to.MTB has H37Rv and two kinds of reference cultures of H37Ra, and the former is an attenuation mutant for the virulent strain latter, and they all derive from people's lung H37 strain isolated in 1934.Different with some clinical separation strains is, H37Rv to medicaments insensitive, be beneficial to genetically engineered operation and in the TB animal model, kept complete virulence, thereby this bacterial strain be widely used in the relevant biological medicine research of TB (MTb H37Rv project at Sanger Institute, NCBI).Diagnosis of tuberculosis method commonly used at present has the chest x-ray perspective and mainly relies on the microscope direct smear of patient's sputum, hydrothorax, bronchovesicular liquid to check (AFP) and culture method, and molecular biology and Serological testing, the many antigens based on high specific of these methods are set up.
The invention provides a kind of tuberculosis recombination fusion protein of producing with gene engineering method as antigen, to compare specificity stronger with antigen commonly used, with its immunodiagnosis kit as antigen prepd, that the detection that can be tuberculosis infection provides is more special, instrument accurately.
Summary of the invention
(1) technical problem that will solve
The purpose of this invention is to provide a kind of mycobacterium tuberculosis recombinant fusion protein, and the application of this mycobacterium tuberculosis recombinant fusion protein in preparation monoclonal antibody, many anti-, detection kit and protein chip, vaccine research is provided.
(2) technical scheme
The invention provides a kind of fusion gene of the mycobacterium tuberculosis 38Kd-11Kd-CFP10 recombination fusion protein of encoding, its nucleotide sequence is shown in SEQ ID NO:1.
The present invention also provides a kind of mycobacterium tuberculosis 38Kd-11Kd-CFP10 recombination fusion protein, and this recombination fusion protein is encoded by described fusion gene, and its aminoacid sequence is shown in SEQ ID NO:2.
The invention provides a kind of expression vector of mycobacterium tuberculosis 38Kd-11Kd-CFP10 recombination fusion protein, this expression vector is that described fusion gene is inserted into the recombinant plasmid pET-28b-38Kd-11Kd-CFP10 that obtains on the plasmid pET-28b, and its plasmid map as shown in Figure 1.
The present invention provides a kind of engineering strain of expressing mycobacterium tuberculosis 38Kd-11Kd-CFP10 recombination fusion protein again, and this project bacterial strain contains expression vector pET-28b-38Kd-11Kd-CFP10, and its host bacterium is intestinal bacteria (Escherichia coli).
The present invention also provides a kind of mycobacterium tuberculosis antibody IgG enzyme-linked immunologic detecting kit, it comprises aforesaid 38Kd-11Kd-CFP10 recombination fusion protein and ELIAS secondary antibody, the package amount of described 38Kd-11Kd-CFP10 recombination fusion protein is 0.5-4.0 μ g/ hole, and the ELIAS secondary antibody working concentration is 2.0-16.0mg/mL.Preferably, the package amount of 38Kd-11Kd-CFP10 recombination fusion protein is 2.0 μ g/ holes, and the ELIAS secondary antibody working concentration is 4.0mg/mL.
The invention provides a kind of mycobacterium tuberculosis antibody IgG diagnostic kit, it comprises TB antigen, colloid gold label TB antigen and nature controlling line bag by the anti-TB antibody of rabbit, and wherein said TB antigen and colloid gold label TB antigen all are to be made by aforesaid mycobacterium tuberculosis 38Kd-11Kd-CFP10 recombination fusion protein.
Mycobacterium tuberculosis antibody IgG diagnostic kit of the present invention, TB antigen specking concentration is 0.25-2.0mg/mL, the working concentration of colloid gold label TB antigen staining fluid is OD value 50.0-100.0, TB antigen specking amount is 0.5-1.75 μ L/cm, colloid gold label TB antigen specking amount is 0.5-1.75 μ L/cm, the nature controlling line bag is 0.5-2.0mg/mL by the anti-TB antibody sandwich of rabbit concentration, reaction film off-period is 45-75 minute, the reaction film drying conditions is under the relative humidity 25%-30% dry 30-75 minute, colloid gold label TB antigen pad drying conditions is under the relative humidity 25%-30% dry 3-5 hour, the sample detection reaction time is 15 ℃～30 ℃ down reactions 10-30 minute, when temperature is lower than 15 ℃ sample detection reaction time 40-50 minute.
Preferably, TB antigen specking concentration is 1.0mg/mL, the working concentration of colloid gold label TB antigen staining fluid is an OD value 80.0, TB antigen specking amount is 1.0 μ L/cm, colloid gold label TB antigen specking amount is 1.0 μ L/cm, the nature controlling line bag is 1.0mg/mL by the anti-TB antibody sandwich of rabbit concentration, reaction film off-period is 60 minutes, the reaction film drying conditions descended dry 60 minutes for relative humidity 25%-30%, colloid gold label TB antigen pad drying conditions is relative humidity 25%-30% dry 4 hours down, and the sample detection reaction time is 15 ℃～30 ℃ reactions 25-30 minute down.
The invention also discloses described mycobacterium tuberculosis 38Kd-11Kd-CFP10 recombination fusion protein in preparation monoclonal antibody, many anti-application that reaches in the protein chip.
(3) beneficial effect
Adopt the diagnostic kit of mycobacterium tuberculosis 38Kd-11Kd-CFP10 recombination fusion protein preparation provided by the invention, compare with the similar test kit on the market, have advantages such as high specificity, sensitivity height, well satisfied the needs of TB infection clinical diagnosis.
Description of drawings
Fig. 1 is the structure schema of expression vector pET-28b-38Kd-11Kd-CFP10;
Fig. 2 is that expression vector pET-28b-38Kd-11Kd-CFP10 enzyme is cut the product electrophorogram, and wherein 1 represents DNA Marker, and 2,3,4 represent three positive bacterias after enzyme is cut respectively, the recombinant plasmid before 5 expression enzymes are cut;
Fig. 3 is a mycobacterium tuberculosis 38Kd-11Kd-CFP10 recombination fusion protein purifying electrophorogram, the supernatant of 1 expression after the lysis wherein, the precipitation after the 2 expression lysises, the TB albumen of 3 expression purifying;
Embodiment
Following examples are used to illustrate the present invention, but are not used for limiting protection scope of the present invention.
The preparation of embodiment 1 mycobacterium tuberculosis 38Kd-11Kd-CFP10 recombination fusion protein
1.1 gene fusion
By Computer Analysis TB H37Rv genom sequence, selecting the dna sequence dna of its strong antigen epi-position 38kDa albumen (GENEBANK locus:YP_177770), 11KDa albumen (GENEBANK locus:AAL16896) and CFP10 albumen (GENEBANK locus:BX842584) is template, and design of amplification primers is:
The 38kD amplimer:
38-11-CFa：atcgCATATGtgtggctcgaaaccaccgagc?54.8％?Tm：79.6
38-11-CFb：TCCGCAATCACCACCACCACCGCTGGAAATCGTCGCGATC?60.0％?Tm：86
The 11kD amplimer:
38-11-CFc：ggtggtggtggtGATTGCGGATCCCATGAC?60％?Tm：80.8
38-11-CFd：CTTCATCTCTGCCATACCACCACCACCTCCCAAGCTTCCTATGCG?56.0％?Tm：84
The CFP10 amplimer:
38-11-CFe：ggtggtggtggtATGGCAGAGATGAAGACCGATG?50％Tm：74.3
38-11-CFf：atcgCTCGAGTCAGAAGCCCATTTGCGAGG?55％Tm：79.5
50mL amplification system: ddH
2O 31.5mL, 10 * buffer 5.0mL, 4 * dNTP 4.0mL, the upstream and downstream primer mixes liquid 4.0mL, DNA 1.5mL, Taqplus 0.2mL (1U).
Get the thalline of Mycobacterium tuberculosis H37RV, add 100mL Proteinase K (10mg/mL), put 56 ℃ of water-bath digestion 4 hours,, carry out pcr amplification with above-mentioned primer with conventional phenol/chloroform method purifying.Wherein, 38Kd upstream primer and CFP10 downstream primer have increased Nde I and Xho I restriction enzyme site respectively.
Cloned sequence is modified, product cuts behind the agarose gel electrophoresis purifying, the blob of viscose that will contain the DNA band (leads to-Beijing TAKARA company name of product: TAKARA MiniBEST Plasmid purification) illustrate and reclaim DNA by DNA fast purifying test kit available from the six directions.And then be template with being connected pcr amplification 38kDa, 11kDa and CFP10 fusion gene with 38kDa, 11kDa and CFP10 gene fragment, middlely connect with 4 Gly (ggtggtggtggt).
Plasmid DNA and 38Kd-11Kd-CFP10 all cut through restriction endonuclease, the 50mL system: 10 x buffer5.0mL, and DNA 12mL, Xho I and each 15U of Nde I, ddH2O mends to 50mL; 37 ℃ of water-bath 6h.The 50mL enzyme is cut product and is separated through agarose gel electrophoresis, cutting DNA band agar block, and press the explanation of DNA fast purifying test kit and reclaim DNA.
With the fusion gene fragment cloning to pET-28b plasmid (having Xho I and Nde I restriction enzyme site), 20mL linked system: ddH2O15.0mL available from magnificent biotech firm, 10 x buffer 2.0mL, PET-28b 2.0mL, Pab 1.0mL, T4DNA ligase enzyme 20U.Plasmid self connects contrast, 20mL ligation system: ddH2O 16.0mL, 10 x buffer 2.0mL, PET-28b 2.0mL, T4DNA ligase enzyme 20U.By behind the above-mentioned application of sample, mixing, centrifugal slightly, 14 ℃ of-16 ℃ of connections are spent the night.Transformed E .coli is coated with flat board (the LB solid medium that contains 15 mcg/ml kantlex) and chooses the order-checking of clone's upgrading grain, determines the clone that sequence is correct.The enzyme of recombinant plasmid is cut (NdeI/XhoI) electrophorogram as shown in Figure 2.
1.2 product order-checking
Sequencing primer is: the universal primer of S38-11-CF (CAACTACGAGTACGCCATCGT) and T7promoter and T7 terminator.The mensuration synthetic and recombinant plasmid sequence pET-28b-38Kd-11Kd-CFP10 of all amplimers and sequencing primer all provides service by the big genome company of China.The nucleotide sequence that records the purpose fusion gene is shown in SEQ ID NO:1.
1.3 the expression of target protein, purifying
Recombinant plasmid (pET-28b-38Kd-11Kd-CFP10) with the correct clone of checking, transformed into escherichia coli BL21 (DE3, available from magnificent biotech firm) the host bacterium, target protein is expressed in inclusion body: BL21 (DE3) the host bacterium that will contain the 38Kd-11Kd-CFP10 gene is cultivated OD 0.6, with final concentration 1mM IPTG abduction delivering, collect thalline, ultrasonication, high speed centrifugation, collecting precipitation after 4 hours.The precipitation of collecting is carried out purifying with Ni post (the chelating sephrose fast flow of Pharmcia company), use following eluant solution: 300mM imidazoles, 20mM Tris, 500Mm NaCl, 8M Urea.38kDa, 11kDa and CFP10 fusion gene expressing protein be totally 561 amino acid, and aminoacid sequence is shown in SEQ ID NO:2.
1.4 fusion rotein calibrating
1.4.1 the mensuration of purity and molecular weight: through SDS-PAGE electrophoresis detection (albumen applied sample amount 10 μ g), be single district band, thin layer scanning identifies that purity is 93.4%.Molecular weight is about 71.8kD, and detected result is seen accompanying drawing 3.
1.4.2 concentration determination: measure through Folin-phenol method, as the standard reference product, antigen protein concentration is 3.5 ± 0.12mg/mL with bovine serum albumin.
1.4.3 determination of activity: measure with indirect ELISA method.Package amount 2.0 μ g/ holes use inner quality controlled serum to measure the OD value, the results are shown in Table 1.
Table 1 antigenic activity measurement result
Antigen antibody reaction: adopt protein blot technology (Western Blot), with anti-people's tuberculosis IgG antibody positive human serum test TB fused antigen, visible positive reaction, SDS-PAGE also confirms that antigenic molecular weight is 71.8KD.The results are shown in accompanying drawing 3.
Adopt indirect ELISA method to detect mycobacterium tuberculosis antibody IgG, can be used for the calibrating of TB antigenic activity and the auxiliary diagnosis that TB infects.For determining 38Kd-11Kd-CFP10 recombination fusion protein package amount and ELIAS secondary antibody working concentration, be specimen with positive and negative reference material, adopt the square formation volumetry to select best antigen coated amount and corresponding ELIAS secondary antibody working concentration, see the following form 2.
The selection of best antigen coated amount of table 2 and corresponding ELIAS secondary antibody working concentration
Annotate: with positive and negative reference material is specimen, and any a positive appears in negative reference material promptly to be judged and false positive results occurs, promptly represents with " ± " in table; Any a feminine gender appears in positive reference material promptly to be judged and false negative result occurs, promptly represents with " ± " in table.
According to test result, at 38Kd-11Kd-CFP10 recombination fusion protein package amount is 2.0 μ g/ holes, when the ELIAS secondary antibody working concentration is 2mg/ml, detected result the best, so the package amount with the 38Kd-11Kd-CFP10 recombination fusion protein is 2.0 μ g/ holes, the ELIAS secondary antibody working concentration is 2.0mg/mL, sets up mycobacterium tuberculosis antibody IgG enzyme-linked immunologic detecting kit.
The preparation of embodiment 3 mycobacterium tuberculosis antibody IgG diagnostic kits (colloidal gold method) and performance calibrating
2.1 test kit is formed and preparation
TB antigen that test kit of the present invention makes with the mycobacterium tuberculosis 38Kd-11Kd-CFP10 recombination fusion protein of purifying and colloid gold label TB antigen adopt dual-antigen sandwich method as antigen.Add serum to be checked during use, as containing anti-TB specific antibody in the sample, then combine with colloid gold label TB antigen earlier, moving ahead combines the formation mixture again and presents purple-red colour with the corresponding TB antigen on film surface.As nonreactive TB specific antibody in the sample, then have only the nature controlling line color, its colour intensity directly and the amount of the anti-TB specific antibody IgG that exists in the sample proportional.
The main moiety of test kit is a test panel, comprises sample application zone, the antigen coated film of colloid gold label TB district, the antigen coated detection zone of TB, Quality Control district and absorbent pad district.
2.1.1 the nature controlling line bag is by the anti-TB antibody of rabbit: (available from Beijing view biotech company, protein concentration is 4.0 ± 0.15mg/mL, immune agar double diffusion tires 〉=and 1: 16).
2.1.2 colloid gold label TB antigen: Radioactive colloidal gold diameter 30nm colloid gold particle, stoste optical density(OD) OD is not less than 10.0.
2.1.3 condition optimizing
2.1.3.1TB determining of antigen and the antigen coated concentration of colloid gold label TB: adopt the square formation titration to select best antigen coated concentration and corresponding golden labelled antigen working concentration, see the following form 3.
The selection of best TB antigen of table 3 and corresponding colloid gold label TB antigen working concentration
Annotate: with positive and negative serum Quality Control reference product is specimen, and any a positive appears in negative reference material promptly to be judged and false positive results occurs, promptly represents with "+/ " in table; Any a feminine gender appears in positive reference material promptly to be judged and false negative result occurs, promptly represents with "/" in table.
According to test result, be that 1.0 μ L/cm and colloid gold label TB antigen specking amount are under the condition of 1.0 μ L/cm in TB antigen specking amount, selected best TB antigen specking concentration is 1.0mg/mL, the working concentration of colloid gold label TB antigen staining fluid is an OD value 80.0.
2.1.3.2 determining of best TB antigen specking amount: determining that best TB antigen specking concentration is that 1.0mg/mL and best colloid gold label TB antigen specking concentration are on the basis of OD value 80.0, adopting the square formation titration to select best antigen specking amount (seeing Table 4)
Determining of the best TB antigen of table 4 specking amount
According to test result, selected best TB antigen specking amount is 1.0 μ L/cm.
2.1.3.3 determining of best colloid gold label TB antigen specking amount; Determining that best TB antigen specking concentration is 1.0mg/mL, the specking amount is that 1.0 μ L/cm and best colloid gold label TB antigen specking concentration are on the basis of OD value 80.0, adopts the square formation titration to select best colloid gold label TB antigen specking amount (seeing Table 5).
Determining of the best colloid gold label TB of table 5 antigen specking amount
According to test result, selected best colloid gold label TB antigen specking amount is 1.0 μ L/cm.
2.1.3.4 the nature controlling line bag is by the selection of the anti-TB antibody sandwich of rabbit concentration
Anti-TB antibody sandwich amount is 1 μ L/cm.The experimental result that the nature controlling line bag is selected by concentration by the anti-TB bag of rabbit sees Table 6.
Table 6 nature controlling line bag is by the selection of the anti-TB antibody sandwich of rabbit concentration
-: control line does not appear; +: control line is clear; +++: control line line is clear thick.
Table 6 shows that used colloid gold label TB antigen has reactive preferably in the anti-TB antibody of rabbit and this test.1.0mg/mL the anti-TB of concentration bag can be shown the contrast effect basically preferably, continues to improve antibody concentration and fails obviously to improve response intensity.Thereby the concentration of selecting the anti-TB of 1.0mg/mL as the nature controlling line bag by the concentration of the anti-TB antibody of rabbit.
2.1.3.5 the selection of reaction film off-period
The nitrocellulose filter bag by TB antigen and anti-TB antibody after, can reduce nonspecific reaction effectively through confining liquid sealing.Selection experimental result to reaction film off-period sees Table 7.
The selection experimental result of table 7 reaction film off-period (37 ℃)
| Reaction times | 15 minutes | 30 minutes | 45 minutes | 60 minutes | 75 minutes |
| Negative serum | × | × | - | - | - |
| Positive serum | × | × | ++ | ++ | ++ |
-: negative reaction; ±: probable positive; ++ positive reaction; *: the reaction film blurred background
Table 7 shows that off-period, difference had certain influence to correct reflection experimental result.Off-period, too short meeting caused the reaction film blurred background, influenced interpretation as a result.This result of experiment shows sealing 45 minutes-75 minutes, and sealing effect is better, helps to improve the accuracy of experimental result.Selecting sealing was production control condition in 60 minutes.
2.1.3.6 the selection of reaction film drying conditions
The experimental result that table 8 reaction film drying conditions is selected
The drying conditions that reaction film suits is not only relevant with the sensitivity of reagent, and more close with the stability relation of reagent.The result of table 8 shows, is under 20% environment in relative humidity, lacks the then poor stability of reagent time of drying, and time of drying, length then influenced the accuracy of reaction result.In relative humidity is 25%, 30% environment when being 45 minutes, 60 minutes, 75 minutes following time of drying, and reaction result is more approaching, and susceptibility and stability are preferably all arranged.Consider controllability in process of production, adopt relative humidity 25%-30%, 60 minutes condition of drying to be the drying conditions in producing.
2.1.3.7 the selection of colloid gold label TB antigen pad time of drying
The experimental result of table 9 gold labelled antigen pad selection time of drying
Colloid gold label TB antigen pad drying is under 37 ℃ of conditions.Table 9 shows that dry environment relative humidity is crossed to hang down may influence response intensity.Under relatively more suitable dry environment, 3 hours time of drying, 4 hours, 5 hours, drying effect was more approaching, and the reaction sensibility of reagent and stability are all better.So select relative humidity 25%-30% for use, be production control condition in dry 4 hours.
2.1.3.8 the selection of sample detection reaction time
The selection experimental result (A) of table 10 sample detection reaction time
The selection experimental result (B) of table 11 sample detection reaction time
Table 10 and table 11 show, under room temperature condition usually (15 ℃～30 ℃), the anti-TB positive or strong positive reaction serum clear and definite positive reaction result can occur in 5-10 minute after reaction.When the weak positive reaction serum of anti-TB reacts at normal temperatures, need the long reaction times, can obtain clear and definite positive reaction result in the time of 25-30 minute in reaction.Anti-TB negative serum is reflected in 30 minutes under common room temperature condition (15 ℃～30 ℃), can correctly reflect substantially to measure serum character.Reaction times is long might cause false positive.Therefore, the time of judgement is as a result determined judge reaction result in the time of 25-30 minute in reaction.Consider that in particular cases the room temperature of possible real work is lower than 15 ℃, influences reaction result, take to prolong the measure in 10 minute reaction times, also can obtain satisfied result.
2.1.4 the manufacturing of test kit
1) the bag quilt of check-out console: the precut of NC film, stickup, TB antigen is diluted to 1.0mg/mL with pH7.2,0.02mol/LPBS damping fluid, the nature controlling line bag is diluted to 1.0mg/mL by the anti-TB antibody of rabbit with pH7.2,0.02mol/LPBS damping fluid, respectively with the optimal conditions specking on the NC film, drying, sealing, drying;
Confining liquid prescription: 0.02mol/L PBS damping fluid (pH7.2 contains 0.25% skim-milk).
2) the antigenic stickup of colloid gold label TB: with 0.05mol/L Tris-HCl damping fluid (pH8.0) preparation colloid gold label TB antigenic solution, bag is pasted on bag by good check-out console by on the glass fibre mould after the drying;
3) assembling: check-out console cuts into test strip, assembles, packs.
2.1.5 detection method and interpretation of result
1) take out test panel, place on the plane operations platform, balance is to room temperature.
2) application of sample: micro sample adding appliance adds undiluted test serum 100 μ l in well.
3) observe and write down the result in 15-20 minute.The strong positive result can occur at 5 minutes, and the weak positive and negative findings need be waited for observation in 20 minutes.Positive: two red-purple lines appear in interpretation window (C and T position); Negative: red-purple lines (C position) only appear in the interpretation window; Invalid: the interpretation window does not have the red-purple lines.
2.2 test kit performance evaluation
2.2.1 detected result to 30 parts of TB reference materials
Use the test kit of the present invention's preparation, TB antibody reference material is detected, detected result sees Table 12.
Table 12 pair 30 parts of TB antibody reference material detected results
-: negative reaction; +: positive reaction; ++: than strong positive reaction; +++: strong positive reaction.
From the test the result as can be seen, negative, positive coincidence rate all reaches 100%.Therefore we think that it is feasible adopting this detection system.
2.2.2 cross reaction test to antibody positive serum such as HBV, HCV, HAV and syphilis
Adopt the cross reaction of test kit of the present invention to HBV (hepatitis B), HCV (hepatitis C), HAV (hepatitis A), cancer and non-tuberculosis respiratory system patients serum, with its specificity of further evaluation, above-mentioned affirmation patient blood sample is tested, be the results are shown in following table 13.
The cross reaction test result of antibody positive serum such as table 13HBV, HCV, HAV and syphilis
The result shows that this test kit and above-mentioned patient's blood sample no cross reaction take place.
2.2.3 the cross reaction to chaff interferences such as syphilis (RF) positive serum, blood fat, bilirubin and oxyphorases detects
The test result of chaff interferences such as table 14 pair syphilis (RF) positive serum, blood fat, bilirubin and oxyphorase
The result shows that the cross reaction of this test kit and chaff interferences such as RF positive serum, blood fat, bilirubin and oxyphorase does not surpass the false positive rate of normal human serum sample.
2.2.4 relatively wait testing data with external like product
Make comparisons with the tuberculosis antibody quick diagnosis reagent kit of new generation that test kit of the present invention and Beijing Modern Gold Biotech Co., Ltd. produce.200 parts of positive serums and normal people's negative serum are compared detection, the results are shown in following table
The compare test result of table 15 and the general tuberculosis antibody test kit of Shanghai Australia
Verity and predictive value's computational analysis:
Table 16 verity and predictive value's computational analysis
Test kit of the present invention and reference product Beijing are 93.49% up to the detection coincidence rate of tuberculosis antibody test kit.
2.2.5 clinical examination
Shenyang Hospital for Thoracics, the clinical examination result of Anhui Province's lung hospital of section and three families of 309 hospitals of PLA is as follows:
Table 17 tuberculosis antibody IgG detected result
* detect positive routine number for test kit in ()
Table 18 tuberculosis antibody IgG detected result
Through Shenyang Hospital for Thoracics, the clinical examination result of Anhui Province hospital of lung section and three families of 309 hospitals of PLA, test kit of the present invention (colloidal gold method) has reached the specification of quality of national regulation, and with the similar products at home and abroad not statistically significant on mass discrepancy.
Claims (10)
1. fusion gene of mycobacterium tuberculosis 38Kd-11Kd-CFP10 recombination fusion protein of encoding, it is characterized in that: its nucleotide sequence is shown in SEQ ID NO:1.
2. mycobacterium tuberculosis 38Kd-11Kd-CFP10 recombination fusion protein is characterized in that: it is by the described fusion gene coding of claim 1, and its aminoacid sequence is shown in SEQ ID NO:2.
3. the expression vector of a mycobacterium tuberculosis 38Kd-11Kd-CFP10 recombination fusion protein is characterized in that: it is that the described fusion gene of claim 1 is inserted into the recombinant plasmid pET-28b-38Kd-11Kd-CFP10 that obtains on the plasmid pET-28b according to as shown in Figure 1 building mode.
4. engineering strain of expressing mycobacterium tuberculosis 38Kd-11Kd-CFP10 recombination fusion protein, it is characterized in that: it contains the described expression vector pET-28b-38Kd-11Kd-CFP10 of claim 3, and its host bacterium is intestinal bacteria (Escherichia coli).
5. mycobacterium tuberculosis antibody IgG enzyme-linked immunologic detecting kit, it is characterized in that: it comprises described 38Kd-11Kd-CFP10 recombination fusion protein of claim 2 and ELIAS secondary antibody, the package amount of described 38Kd-11Kd-CFP10 recombination fusion protein is 0.5-4.0 μ g/ hole, and the ELIAS secondary antibody working concentration is 2.0-16.0mg/mL.
6. detection kit according to claim 5 is characterized in that: the package amount of 38Kd-11Kd-CFP10 recombination fusion protein is 2.0 μ g/ holes, and the ELIAS secondary antibody working concentration is 2.0mg/mL.
7. mycobacterium tuberculosis antibody IgG diagnostic kit, it comprises that TB antigen, colloid gold label TB antigen and nature controlling line bag by the anti-TB antibody of rabbit, is characterized in that: described TB antigen and colloid gold label TB antigen all are to be made by 38Kd-11Kd-CFP10 recombination fusion protein according to claim 2.
8. test kit according to claim 7, it is characterized in that: TB antigen specking concentration is 0.25-2.0mg/mL, the working concentration of colloid gold label TB antigen staining fluid is OD value 50.0-100.0, TB antigen specking amount is 0.5-1.75 μ L/cm, colloid gold label TB antigen specking amount is 0.5-1.75 μ L/cm, the nature controlling line bag is 0.5-2.0mg/mL by the anti-TB antibody sandwich of rabbit concentration, reaction film off-period is 45-75 minute, the reaction film drying conditions is under the relative humidity 25%-30% dry 30-75 minute, colloid gold label TB antigen pad drying conditions is under the relative humidity 25%-30% dry 3-5 hour, the sample detection reaction time is 15 ℃～30 ℃ down reactions 10-30 minute, when temperature is lower than 15 ℃ sample detection reaction time 40-50 minute.
9. test kit according to claim 8, it is characterized in that: TB antigen specking concentration is 1.0mg/mL, the working concentration of colloid gold label TB antigen staining fluid is an OD value 80.0, TB antigen specking amount is 1.0 μ L/cm, colloid gold label TB antigen specking amount is 1.0 μ L/cm, the nature controlling line bag is 1.0mg/mL by the anti-TB antibody sandwich of rabbit concentration, reaction film off-period is 60 minutes, the reaction film drying conditions descended dry 60 minutes for relative humidity 25%-30%, colloid gold label TB antigen pad drying conditions is relative humidity 25%-30% dry 4 hours down, and the sample detection reaction time is 15 ℃～30 ℃ reactions 25-30 minute down.
10. the application of mycobacterium tuberculosis 38Kd-11Kd-CFP10 recombination fusion protein according to claim 2 in preparation monoclonal antibody, many anti-, detection kit and protein chip.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102309810A CN101914562A (en) | 2010-07-20 | 2010-07-20 | Mycobacterium tuberculosis 38Kd-11Kd-CFP10 recombinant fusion protein and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102309810A CN101914562A (en) | 2010-07-20 | 2010-07-20 | Mycobacterium tuberculosis 38Kd-11Kd-CFP10 recombinant fusion protein and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101914562A true CN101914562A (en) | 2010-12-15 |
Family
ID=43322200
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010102309810A Pending CN101914562A (en) | 2010-07-20 | 2010-07-20 | Mycobacterium tuberculosis 38Kd-11Kd-CFP10 recombinant fusion protein and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101914562A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102718873A (en) * | 2012-07-05 | 2012-10-10 | 中国人民解放军第三〇九医院 | Mycobacterium tuberculosis specific fusion protein as well as preparation and application of mycobacterium tuberculosis specific fusion protein |
| CN115184603A (en) * | 2022-06-30 | 2022-10-14 | 首都医科大学附属北京胸科医院 | Application of EspC protein in preparation of mycobacterium tuberculosis separation or enrichment product |
-
2010
- 2010-07-20 CN CN2010102309810A patent/CN101914562A/en active Pending
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102718873A (en) * | 2012-07-05 | 2012-10-10 | 中国人民解放军第三〇九医院 | Mycobacterium tuberculosis specific fusion protein as well as preparation and application of mycobacterium tuberculosis specific fusion protein |
| CN115184603A (en) * | 2022-06-30 | 2022-10-14 | 首都医科大学附属北京胸科医院 | Application of EspC protein in preparation of mycobacterium tuberculosis separation or enrichment product |
| CN115184603B (en) * | 2022-06-30 | 2024-02-06 | 首都医科大学附属北京胸科医院 | Application of EspC protein in preparation of mycobacterium tuberculosis separation or enrichment product |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111220803B (en) | Novel coronavirus antibody detection reagent, preparation method thereof and novel coronavirus antibody detection card | |
| Samanich et al. | Serodiagnostic potential of culture filtrate antigens of Mycobacterium tuberculosis | |
| CN101968490A (en) | Indirect ELISA (Enzyme-Linked Immunosorbent Assay) method and kit for detecting haemophilus parasuis antibodies | |
| CN101100673A (en) | Mycobacterium tuberculosis recombination fusion protein and application thereof | |
| CN101294964A (en) | Reagent and method for detecting active tuberculosis and tuberculosis dormant infection | |
| CN101914563A (en) | Mycobacterium tuberculosis 38Kd-16Kd-CFP10 recombinant fusion protein and application thereof | |
| CN114736290B (en) | Nanometer antibody capable of recognizing porcine pseudorabies virus with high accuracy and sensitivity, preparation method and application | |
| CN103059109A (en) | Mycoplasma pneumonia antigen, preparation method and immunodetection kit | |
| CN101838660A (en) | Mycobacterium tuberculosis recombinant fusion protein and application thereof | |
| CN102533795B (en) | Recombinant human cytomegalovirus protein and applications thereof | |
| CN101914562A (en) | Mycobacterium tuberculosis 38Kd-11Kd-CFP10 recombinant fusion protein and application thereof | |
| CN106279408B (en) | Monoclonal antibody and antibody combination for resisting foot-and-mouth disease type O virus and application of monoclonal antibody and antibody combination in detection of virus antigen and antibody | |
| CN103820471A (en) | Recombined chlamydia trachomatis protein and application thereof | |
| CN113721035B (en) | Colloidal gold immunochromatographic test paper card for detecting African swine fever virus antibody | |
| CN101508999B (en) | Recombinant toxoplasma protein and uses thereof | |
| CN105218648A (en) | Negre antigen, nucleotide sequence and application thereof | |
| CN101781360B (en) | Recombinant rubella virus protein and application | |
| CN102660559B (en) | Mycobacterium tuberculosis (TB) recombinant protein and preparation method thereof | |
| EP4028768B1 (en) | Lateral flow immunoassay device for detection of candida infection and uses thereof | |
| CN105585633B (en) | The immune chromatography reagent kit of anti-human haemophilus influenzae P6 protein antibodies and the application antibody | |
| CN102899334B (en) | Mycobacterium tuberculosis recombinant protein and preparation method thereof | |
| CN1851463B (en) | Method for detecting horse arteritis virus by indirect enzyme-linked immunosorbent test | |
| CN101509002A (en) | Recombinant rubella virus protein and uses thereof | |
| CN105277694B (en) | Human group A streptococci quantum dot immunochromatography detection card, preparation method and applications | |
| CN105242040B (en) | Human Haemophilus influenza quantum dot immunochromatography detection card, preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20101215 |