CN105242040B - Human Haemophilus influenza quantum dot immunochromatography detection card, preparation method and application thereof - Google Patents
Human Haemophilus influenza quantum dot immunochromatography detection card, preparation method and application thereof Download PDFInfo
- Publication number
- CN105242040B CN105242040B CN201410406527.4A CN201410406527A CN105242040B CN 105242040 B CN105242040 B CN 105242040B CN 201410406527 A CN201410406527 A CN 201410406527A CN 105242040 B CN105242040 B CN 105242040B
- Authority
- CN
- China
- Prior art keywords
- detection
- protein
- human
- quantum dot
- preparation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention provides a human Haemophilus influenza quantum dot immunochromatography detection card, a preparation method and an application thereof. The detection card includes a base board, a sample pad, a water absorption pad, a combination pad and a detection layer. An anti-human Haemophilus influenza nano probe marked by quantum dots coats the detection layer. The detection layer is formed by a solid-phase nitrocellulose film having a detection line and a quality control line, wherein a mouse-anti-human Haemophilus influenza P6 protein polyclonal antibody coats the detection line and an anti-rabbit IgG coats the detection line. The detection layer is bonded to the base board. The combination pad and the water absorption pad are respectively disposed above the two ends of the detection layer, and then are partially overlapped with the detection and are respectively bonded to the detection layer and the base board. The sample pad is disposed above the combination pad, and then is partially overlapped with the combination pad and is respectively bonded to the combination pad and the base board. The detection card is simple in operations, is quick in detection and allows quantitative and high-sensitive detection.
Description
Technical field
The present invention relates to technical field of medical detection, specially a kind of artificial abortion's haemophilus influenza quantum dot immune chromatography detection
Card and its preparation method and application.
Background technology
Hemophilus influenza (haemophilus influenzae, hi) is a kind of important respiratory tract disease of the infection mankind
Pathogenic microorganism, this bacterium is found in an influenza pestilence of 1892 by Polish bacteriologist doctor Fei Fo, with
Widely studied by researcheres in time afterwards.Now only know that people is the host of this pathogen.The poor old man of immunity and child
For Susceptible population, the particularly infant of less than 5 years old.Hi can cause pneumonia, conjunctivitis, otitis media, meningitiss and bacteremia etc.,
In the whole world, annual at least 3,000,000 several cases occur, and infant can be caused to disable even dead.Hi be divided into encapsulated a, b, c,
D, e, f totally 6 serotypes and acapsular indecomposable form hemophilus influenza (nontypeable haemophilus
Influenzae, nthi), once popular with pod membrane b type hi.The most also pin of hi Serological testing that China carries out at present
The pod membrane b type stronger to aggressivity.And the successful research and development due to this type bacterial strain capsular polysaccharide vaccine and application, it is popular to be had
Effect controls.Recent research more show, infection hi patient in modal bacterial strain be nthi, its separation rate reached 50% with
On.
Clinically because hi is similar with the infection symptoms that other respiratory pathogens cause, therefore often it is difficult to according to clinical table
Existing, x- radiological survey X etc. is reached a conclusion, and makes a definite diagnosis and tends to rely on laboratory diagnosiss.The feature of infant disease is that onset is anxious, turns
Return fast, therefore sensitive, quick, practical hi detection has very important significance to carrying out effective clinical intervention early.
Although hemophilus influenza is propagated in the world, can be used for the standardization commercially available reagent of laboratory diagnosiss
Species is few.At present, the diagnostic method of hi infection has serological detection method, nucleic acid detection method and pathogen direct Detection Method.Inspection
Surveying the method that in serum, hi igg, iga, igm antibody is commonly used has: microimmunofluorescence antibody test (mif), complement fixation test
(cf), restructuring enzyme immunoassay (EIA) (reia), SC combines enzyme immunoassay (EIA) test (serocf eia) etc..But hi
Whether the detection of antibody can only illustrate that this individuality infected hi, but can not reflect in vivo still with the presence of hi viable bacteria, and serology
Detection of specific antibody often needs to be judged according to the dynamic result of igm antibody, needs longer time.Importantly,
The SD object that predominantly detects is anti-capsular antibody, and nthi due to not having pod membrane, then can cause missing inspection.Meanwhile, this
A little technology all have that sensitivity is low, operating procedure is complicated, need professional's operation, poor repeatability, detection time length, detection spy
The opposite sex defect such as poor, relatively costly, thus be difficult to meet being actually needed of clinic.
Detection of nucleic acids includes nucleic acid hybridization and polymerase chain reaction (pcr), and nucleic acid hybridization detects the high specificity of hi, but
Sensitivity is not high, is mainly used in detection, the judgement of pcr result, is not yet directly used in the detection of clinical samples；Pcr has higher
Sensitivity, but pcr experiment has particular/special requirement to laboratory, and sample disposal, amplification and detection require strict, and easy false sun
Property, can't be used as conventional methods for clinical diagnosis in China.
Pathogen detection method is mainly Isolation and culture of agent method, by specimen inoculation in the chocolate that with the addition of v the and x factor
On blood agar culture-medium, through 24 hours culture after, the suspicious bacterium colony of picking after Morphological Identification, with hi identification card, vilek 1
Antibacterial automatic analysis system identifies kind, and system carries out biological typing automatically.But it is complicated to there is operating procedure in this method, cell culture
The open defects such as time length, are not appropriate for clinical practice.Importantly, capsular swelling therein experiment etc. is only limitted to there being pod
The bacterial strain of film is identified, and no Buccal mucosa flap (nthi) then all missing inspections.
Therefore, tool high sensitivity, the human influenza influenzae antigens fast detection method of high specific are set up at present to meet
Clinical detection demand just seems very necessary.
Content of the invention
The present invention is directed to the technology bottle that in background technology, existing several artificial abortion's haemophilus influenzas run in detection mode
Neck it is proposed that a kind of have the advantages that easy and simple to handle, detection quick, can quantitation and high sensitivity artificial abortion's haemophilus influenza quantum
Point immunochromatographydetection detection card and its preparation method and application.
The purpose of the present invention is realized by following technological means:
A kind of artificial abortion's haemophilus influenza quantum dot immune chromatography detection card it is characterised in that: described artificial abortion's haemophilus influenza
Quantum dot immune chromatography detection card includes base plate, sample pad, pad, detection layers and adsorptive pads；Described pad is coated with
Quantum dot-labeled anti-human hemophilus influenza nano-probe；Described detection layers are by with a detection line and a nature controlling line
Solid phase nitrocellulose filter constitute；Described detection line is coated with Mus anti-human hemophilus influenza p6 protein polyclone antibody；Institute
State nature controlling line and be coated with anti-rabbit igg；Described detection layers are pasted onto on base plate；Described pad and adsorptive pads are separately positioned on inspection
After surveying the top at layer both ends and partly overlapping with detection layers respectively together with detection layers and base plate sticking；Described sample pad
After being arranged on above pad and partially overlapping with pad respectively together with pad and base plate sticking.
Preferably, the water solublity cdse/zns amount that quantum dot of the present invention is carboxylated amphipathic polymer to be modified
Sub- point.
Preferably, anti-rabbit igg of the present invention includes but is not limited to goat-anti rabbit igg.
Preferably, the long 2cm of detection layers of the present invention, it is 6.6-7.7cm that described detection layers are pasted onto length
Backplate surface interlude；Described detection layers and being pasted onto on detection layers and base plate and length are the adsorptive pads weights of 2.5-3cm
Folded 0.2-0.4cm；Described detection layers and being pasted onto on detection layers and base plate and length are that the pad of 0.5-0.8cm is overlapping
0.2-0.4cm；Described pad and the sample pad overlapping 0.2 that the length being pasted onto on pad and base plate is 2.5cm
0.4cm；Described detection line is 0.5-0.8cm with the spacing of nature controlling line；The width of described base plate is 0.3-0.5cm.
Preferably, adsorptive pads of the present invention are absorbent filters；Described base plate is pvc plate.
A kind of preparation method based on above-mentioned artificial abortion's haemophilus influenza quantum dot immune chromatography detection card, its feature exists
In: described preparation method comprises the following steps:
1) preparation of pad:
1.1) preparation of restructuring p6-his fusion protein, purification:
1.1.1) bioinformatic analysis are carried out to artificial abortion haemophilus influenza surface protein p6, obtain in its ectodomain
Epitope peptide fragment the abundantest；
1.1.2) find step 1.1.1) in the corresponding gene coded sequence of obtained peptide fragment, and 5 ' ends and 3 ' in sequence
End introduces restriction enzyme site chemosynthesis complete genome sequence, is labeled as p6 simultaneously；Its sequence is referring to sequence table；
1.1.3) by step 1.1.2) in obtained p6 be cloned into expression vector pet-28a by molecular biology method
Expression in escherichia coli restructuring p6-his fusion protein is proceeded to after (+)；Described restructuring p6-his fusion protein is with solubility expression
Mode is present in thalline；
1.1.4) use ni-sepharose purification step 1.1.3) obtained by recombiant protein, after sds-page detects its purity, with
Bradford method measures protein concentration, and adjustment protein concentration is standby after 0.2mg/ml；
1.2) preparation of rabbit and Mus anti-human hemophilus influenza p6 protein polyclone antibody igg:
1.2.1) with step 1.1.4) in obtained restructuring p6-his fusion protein as complete antigen, immunity is newly western respectively
Blue White Rabbit and Cavia porcelluss；Prepare rabbit anti-human hemophilus influenza p6 protein antiserum and Mus anti-human hemophilus influenza p6 egg respectively
White antiserum；The anti-human hemophilus influenza p6 protein antiserum of described rabbit and Mus anti-human hemophilus influenza p6 protein antiserum
Elisa potency is all higher than 1 × 10 indirectly5；
1.2.2) adopt protein g affinity column respectively purified rabbit anti-human's hemophilus influenza p6 protein antiserum and
Polyclonal antibody igg in Mus anti-human hemophilus influenza p6 protein antiserum；
1.2.3) with triumphant base braford protein content detection kit determination step 1.2.2) obtained by two kinds of polyclones
The concentration of antibody igg, its protein concentration is all adjusted to standby after 3mg/ml；
1.3) the quantum dot-labeled preparation of anti-human hemophilus influenza nano-probe and purification:
1.3.1) sequentially add in microcentrifugal tube 2nmol quantum dot, 300nmol n- N-Hydroxysuccinimide and
300nmol carbodiimide, with phosphate buffer constant volume as 2ml, in rotary mixer, with 15rpm, 37 DEG C of reaction 30min
Afterwards, dialysis removes excessive n- N-Hydroxysuccinimide and carbodiimide；In described phosphate buffer, each constituent content divides
It is not: 2.9g/l disodium hydrogen phosphate, 0.295g/l sodium dihydrogen phosphate and 2g/l sodium chloride, the ph=of described phosphate buffer
7.3；
1.3.2) activation quantum dot in, add 4-12nmol step 1.2) prepared by the bloodthirsty bar of the anti-human influenza of rabbit
Bacterium p6 protein polyclone antibody igg, lucifuge reacts 2h, adds Amino End Group polyethylene glycol to final concentration of 1.5%, closes not anti-
The activated carboxyl site answered, continues lucifuge reaction 1h；It is filtered to remove antibody aggregation thing with 0.2 μm of pes filter, then by filtrate
Transfer in 50000mw ultra-filtration centrifuge tube, 15min is centrifuged at 4 DEG C with 8000g centrifugal force, remove and coupling reaction does not occur
By-product in antibody and reaction；Collect super filter tube filter membrane upper strata quantum dot-antibody coupling matter solution, be dissolved in 2ml phosphoric acid brine wash
Wash in liquid, then this solution is transferred in 50000mw ultra-filtration centrifuge tube, 15min is centrifuged at 4 DEG C with 8000g centrifugal force, collect
Super filter tube filter membrane upper strata quantum dot-antibody coupling matter solution, is dissolved in 1ml phosphate and preserves in liquid, be so far obtained quantum dot-labeled
Anti-human hemophilus influenza nano-probe；
In described phosphate cleaning mixture, each constituent content is respectively as follows: 2.9g/l disodium hydrogen phosphate, 0.295g/l biphosphate
Sodium, 2g/l sodium chloride, 5ml/l tween 20 and 1g/l sodium azide；The ph=7.3 of described phosphate cleaning mixture；Described phosphate
Preserve each constituent content in liquid and be respectively as follows: 2.9g/l disodium hydrogen phosphate, 0.295g/l sodium dihydrogen phosphate, 2g/l sodium chloride, 10g/l
Bsa and 1g/l sodium azide；Described phosphate preserves the ph=7.3 of liquid；
1.4) load of quantum dot-labeled antibody:
Polyester fiber film is immersed step 1.3.2) obtained by quantum dot-labeled anti-human hemophilus influenza nanometer visit
1h in pin solution, takes out, and the rear 4 DEG C of sealing preserves of 25 DEG C of dryings are standby, and pad is so far obtained；
2) preparation of sample pad:
Take glass fibre element film one, glass fibre element film is soaked at least 3h in sample pad treatment fluid, then is placed in life
After 37 DEG C of aeration-dryings in thing safety cabinet, 25 DEG C of hermetically dryings preserve；So far sample pad is obtained；
In described sample pad treatment fluid, each constituent content is respectively as follows: 2.9g/l disodium hydrogen phosphate, 0.295g/l biphosphate
Sodium, 2g/l sodium chloride, 20g/l bovine serum albumin (bsa), 10ml/l tween 20,20g/l sucrose and 5g/l polyethylene pyrrole
Pyrrolidone, the ph=7.3 of described sample pad treatment fluid；
3) preparation of detection layers:
3.1) by step 1.2) the Mus anti-human hemophilus influenza p6 protein polyclone antibody prepared and anti-rabbit igg phosphoric acid
Salt buffer all adjusts standby to final concentration of 0.5-2.5mg/ml；Each constituent content difference in described phosphate buffer
For: 2.9g/l disodium hydrogen phosphate, 0.295g/l sodium dihydrogen phosphate and 2g/l sodium chloride, the ph=of described phosphate buffer
7.3；
3.2) anti-human for the Mus having diluted hemophilus influenza p6 protein polyclone antibody loading biodot is drawn film instrument shower nozzle
In, the amount of setting 0.8-2.5 μ l/cm is sprayed on nitrocellulose filter, forms detection line；Anti-rabbit igg having diluted is loaded
Biodot draws in film instrument shower nozzle, and the amount of setting 0.8-2.5 μ l/cm is sprayed on nitric acid fibre according to the interval with detection line 0.5-0.8cm
As nature controlling line on the plain film of dimension；
3.3) nitrocellulose filter being sprayed with detection line and nature controlling line is dried 2h at 37 DEG C, 4 DEG C of hermetically dryings preserve；
So far detection layers are obtained；
4) preparation of base plate
The base plate of pvc material is pressed standby after actual requirement cutting；
5) preparation of adsorptive pads
Absorbent filter is pressed standby after actual requirement cutting；
6) assembling of artificial abortion's haemophilus influenza quantum dot immune chromatography detection card:
6.1) by step 4) adhered protection film on preparation-obtained base plate takes off；
6.2) by step 3) preparation-obtained detection layers paste the central region of base plate, and floating face；
6.3) by step 5) preparation-obtained adsorptive pads are assembled on base plate, make the left side of adsorptive pads and detection layers have portion
Divide overlap, its right hand edge is alignd with the right hand edge of base plate simultaneously and glue and floating；
6.4) by step 1) preparation-obtained pad is overlapped in a left side for nitrocellulose filter by partly overlapping mode
Edge, sticks at pad on base plate simultaneously；
6.5) by step 2) prepared by obtain sample pad and be then overlapped at the left hand edge of pad by partly overlapping mode,
Another side is alignd with the left hand edge of base plate, sticks on base plate and floating；
6.6) artificial abortion assembling haemophilus influenza quantum dot immune is chromatographed detection card and carry out cutting, 4 DEG C of hermetically dryings
Keep in Dark Place；
Described step 6.1) to step 6.6) it is all to be operated in Biohazard Safety Equipment.
Preferably, step 1.3.2 of the present invention) in add the step 1.2 of 6nmol) prepared by rabbit anti-human
Hemophilus influenza p6 protein polyclone antibody igg；
Preferably, step 3.1 of the present invention) in by step 1.2) the Mus anti-human hemophilus influenza p6 for preparing
Protein polyclone antibody and anti-rabbit igg phosphate buffer adjust and are respectively 1.5-2.0mg/ml and 0.5- to final concentration
1.5mg/ml；
Preferably, step 3.2 of the present invention) in, by anti-human for the Mus having diluted hemophilus influenza p6 albumen
Polyclonal antibody loads biodot and draws in film instrument shower nozzle, and the amount of setting 1.0-2.0 μ l/cm is sprayed on nitrocellulose filter, is formed
Detection line；By anti-rabbit igg having diluted loading biodot draw in film instrument shower nozzle, setting 1.0-2.0 μ l/cm amount according to detection
The interval of line 0.5-0.8cm is sprayed on nitrocellulose filter as nature controlling line.
A kind of detection based on above-mentioned artificial abortion's haemophilus influenza quantum dot immune chromatography is blocked as nondiagnostic detection artificial abortion
The application of haemophilus influenza.
A kind of nondiagnostic detection method based on above-mentioned artificial abortion's haemophilus influenza quantum dot immune chromatography detection card, its
It is characterised by: described detection method comprises the following steps:
1), after measuring samples fully being dissolved with the sample treatment liquid of 500 μ l, take out 120 μ l and drip in the sample pad of detection card
On, observe testing result under uviol lamp within 15 minutes；In described sample treatment liquid, each constituent content is respectively disodium hydrogen phosphate
2.9g/l, sodium dihydrogen phosphate 0.295g/l, triton x-100 10ml/l and sodium chloride 2g/l, described sample treatment liquid
Ph=7.3；
2) if containing the quantum dot-labeled anti-human stream in human influenza influenzae antigens, with pad in measuring samples
Haemophilus influenza nano-probe combines, by Mus anti-human hemophilus influenza p6 egg first and on nitrocellulose filter for the chromatography effect
White polyclonal antibody can form a macroscopic fluoroscopic examination line after combining under ultraviolet excites at detection line, does not tie
The quantum dot-labeled antibody having closed continues to excite the macroscopic Article 2 of lower formation in ultraviolet after chromatography is combined with anti-rabbit igg
Fluorescence nature controlling line；
If unmanned hemophilus influenza antigen in measuring samples, a fluorescence nature controlling line only occurs；If fluorescence nature controlling line
Do not occur, then this detection card lost efficacy.
Preferably, measuring samples of the present invention are including but not limited to throat swabs.
Compared with prior art, the present invention has the advantage that
1st, the method for the detection human influenza influenzae antigens of the present invention is will be comprehensive with quantum dot-labeled technology for immunochromatography
Altogether, using the high-titer of present invention preparation, high specific polyclonal antibody, by exciting fluorescence that sample is examined
Survey, have the characteristics that high (it is 2 × 10 to the detection bottom line of artificial abortion's haemophilus influenza for sensitivity4Cfu/ml), with it to clinic
The testing result of sample no difference of science of statistics compared with detection " the goldstandard "-culture method to this pathogen at present.
2nd, the antibody used by the present invention is all many grams of the identification extracellular conserved region of artificial abortion's haemophilus influenza specificity p6 antigen
Grand antibody, its specificity is high, and for its more most widely used monoclonal antibody, preparation cost is cheap simultaneously, therefore, this
Invention testing cost is relatively low.
3rd, because the present invention is first using the exclusive outer membrane protein p6 of artificial abortion's haemophilus influenza as antigen target, and this is anti-
Former be not only present in all types of hemophilus influenza cell surfaces, include pod membrane and no Buccal mucosa flap, and conservative height (bacterium
Between strain, protein conservative is 100%), belong to hemophilus influenza specific antigen, therefore this detection card can high degree of specificity
Detection all types artificial abortion's haemophilus influenza infection.And can be fast as any card with this detection is had no at present on market
The instrument of speed detection all types artificial abortion's haemophilus influenza exists.
4th, detection method is simple, and detection is quickly it is easy to judge, result judgement completed in 20 minutes, both permissible
Carry out qualitative detection with Ultraviolet Detector, also the technology such as can scan in conjunction with ccd and carry out detection by quantitative, testing cost is cheap, overcomes
Prior art (as elisa) testing cost is high, complex operation is loaded down with trivial details, time-consuming and required professional just operable not
Foot.
5th, due to being human influenza influenzae antigens of detection card detection non-antibody (appearance of antibody needs to infect several days
To several Zhou Yihou), therefore the method is in the early clinical diagnosis of artificial abortion's haemophilus influenza and preventing and treating, pathogen neuraminidase, popular
Disease is learned the aspects such as investigation and is had very high practical value.
6th, the clinical sample used by detection method is respiratory secretions such as sputum etc., and non-blood, can exempt
The misery that infant patient takes a blood sample and the psychological burden of the head of a family, therefore be relatively easy to promote.
Brief description
Fig. 1 is the longitudinal profile structure schematic of detection card provided by the present invention；
Fig. 2 is the structural representation after completing assembling of detection card provided by the present invention；
Wherein:
1- sample pad；2- pad；3- detection layers；4- detection line；5- nature controlling line；6- adsorptive pads；7- base plate.
Specific embodiment
The operation principle of the present invention is: the present invention is on the premise of immunochormatography (double-antibody sandwich), with many
Based on clonal antibody, using quantum dot-labeled probe technique, the detection bloodthirsty bar of human influenza is developed by quantum dot labelling technique
The quantum dot immune chromatography detection card of bacterium antigen.It is rabbit anti-human hemophilus influenza p6 protein polyclone antibody first and Mus are anti-human
The preparation of hemophilus influenza p6 protein polyclone antibody, purification and quantum dot-labeled, are secondly spray film, then will detection card
Each constituent is assembled, and finally prepares artificial abortion's haemophilus influenza quantum dot immune chromatography detection card.Provided by the present invention
The features such as detection card has sensitivity, quick and specificity is good, and can detection by quantitative, the high flux examination of sample can be carried out, tool
There is preferable market application foreground.
As shown in Figure 1, a kind of artificial abortion's haemophilus influenza quantum dot immune chromatography detection card provided by the present invention, including
Sample pad 1, pad 2, detection layers 3, adsorptive pads 6 and base plate 7 form.Quantum dot-labeled anti-human stream is coated with pad 2
Haemophilus influenza nano-probe；Detection layers 3 are to be sprayed with the solid phase nitrocellulose filter abbreviation nc film of detection line 4 and nature controlling line 5；
Detection line 4 is coated with Mus anti-human hemophilus influenza p6 protein polyclone antibody；Nature controlling line 5 is coated with anti-rabbit igg；Quantum dot is
The water solublity cdse/zns quantum dot that carboxylated amphipathic polymer is modified；Adsorptive pads 6 material is absorbent filter；Base plate 7 material is
pvc.
Its concrete structure is: the long 2cm of detection layers, and detection layers are pasted onto the backplate surface interlude that length is 6.6-7.7cm；
Detection layers and the overlapping 0.2-0.4cm of adsorptive pads that being pasted onto on detection layers and base plate and length are 2.5-3cm；Detection layers with
It is pasted onto the pad overlap 0.2-0.4cm that on detection layers and base plate and length is 0.5-0.8cm；Pad be pasted onto
Length on pad and base plate is sample pad overlap 0.2 0.4cm of 2.5cm；Detection line and Quality Control distance between centers of tracks are 0.5-
0.8cm；The width of base plate is 0.3-0.5cm.
Wherein, above-mentioned parameter preferred version is: the long 2cm of detection layers 3, is pasted onto base plate 7 long 7.3cm surface interlude, this
Detection layers right-hand member and the overlapping 0.2cm of the long 3cm of adsorptive pads 6 being pasted onto the right end of base plate 7, its other end and the long 0.6cm of pad 2
Overlapping 0.3cm；Pad 2 then with the overlapping 0.3cm of the long 2.5cm of sample pad (1) being pasted onto base plate 7 left end；Inspection in detection layers 3
Survey line 4 and nature controlling line 5 spacing 0.7cm.The width of whole piece detection card is 0.4cm.
The method preparing above-mentioned artificial abortion's haemophilus influenza quantum dot immune chromatography detection card, its key step includes:
First, the preparation of pad
(1) preparation of restructuring p6-his fusion protein, purification:
Artificial abortion's haemophilus influenza p6 albumen is carried out with bioinformatic analysis, obtains artificial abortion's haemophilus influenza p6 albumen extracellular
Epitope peptide fragment the abundantest in domain, finds its corresponding gene order；5 ' ends and 3 ' in this two gene sequence
End introduces restriction enzyme site difference chemosynthesis complete genome sequence respectively, is labeled as p6 simultaneously.Its gene order is referring to sequence table.
By this gene order be cloned into according to a conventional method expression vector pet-28a (+) afterwards expression restructuring p6-his fusion protein.This merges
Albumen is present in genetic engineering thalline with solubility expression form.With the restructuring p6- in ni-sepharose purification genetic engineering bacterium thalline
His fusion protein, after sds-page detects its purity, then measures protein concentration with bradford method, adjustment protein concentration is
Standby after 0.2mg/ml；
(2) preparation of rabbit and Mus anti-human hemophilus influenza p6 protein polyclone antibody igg:
With the restructuring p6-his fusion protein of purification as complete antigen, immune new zealand white rabbit and globefish according to a conventional method
Mus, prepare rabbit anti-human hemophilus influenza p6 protein antiserum and Mus anti-human hemophilus influenza p6 protein antiserum respectively.Should
Two kinds of sero-fast indirect elisa potency are all higher than 1 × 105, with protein g affinity column two kinds of antiserums of purification respectively
In polyclonal antibody igg, measure antibody concentration be all adjusted to 3mg/ml with triumphant base braford protein content detection kit
Standby afterwards.Wherein rabbit anti-human hemophilus influenza p6 protein polyclone antibody igg is used as quantum dot-labeled test；The anti-human influenza of Mus
Haemophiluss p6 protein polyclone antibody igg is used as being coated of detection line.
(3) the quantum dot-labeled preparation of anti-human hemophilus influenza nano-probe and purification
Its operating procedure is as follows: sequentially adds 2nmol quantum dot, 300nmol n- hydroxysuccinimidyl acyl in microcentrifugal tube
Imines (sulfo-nhs) and 300nmol carbodiimide (edc), with phosphate buffer (2.9g/l disodium hydrogen phosphate, 0.295g/
L sodium dihydrogen phosphate, 2g/l sodium chloride, ph 7.3) constant volume is 2ml, in rotary mixer, with 15rpm, 37 DEG C of reaction 30min
Afterwards, dialysis removes excessive activator (sulfo-nhs and edc).In the quantum dot of activation, add 4-12nmol (preferably
The rabbit anti-human hemophilus influenza p6 protein polyclone antibody igg prepared by step (2) 6nmol), lucifuge reacts 2h, adds
Amino End Group polyethylene glycol (peg2000-nh2) to final concentration of 1.5%, close unreacted activated carboxyl site, continue to keep away
Photoreaction 1h.It is filtered to remove antibody aggregation thing with 0.2 μm of pes filter, then filtrate be transferred to 50000mw ultra-filtration centrifuge tube
In, 15min is centrifuged at 4 DEG C with 8000g centrifugal force, removes the by-product in the antibody that coupling reaction does not occur and reaction.Receive
Collection super filter tube filter membrane upper strata quantum dot-antibody coupling matter solution, be dissolved in 2ml phosphate cleaning mixture (2.9g/l disodium hydrogen phosphate,
0.295g/l sodium dihydrogen phosphate, 2g/l sodium chloride, 5ml/l tween 20,1g/l sodium azide, ph 7.3) in, then this solution is turned
Move on in 50000mw ultra-filtration centrifuge tube, 15min is centrifuged at 4 DEG C with 8000g centrifugal force, collect super filter tube filter membrane upper strata quantum
Point-antibody coupling matter solution, is dissolved in 1ml phosphate and preserves liquid (2.9g/l disodium hydrogen phosphate, 0.295g/l sodium dihydrogen phosphate, 2g/
L sodium chloride, 10g/l bsa, 1g/l sodium azide, ph 7.3) in, quantum dot-labeled anti-human hemophilus influenza nanometer is obtained and visits
Pin.
(4) load of quantum dot-labeled antibody
Quantum dot-labeled anti-human hemophilus influenza nano-probe polyester fiber film being immersed obtained by step (3) is molten
1h in liquid, takes out, after being cut into the specification of 4cm*0.6cm after 25 DEG C of dryings, 4 DEG C of sealing preserves are standby, and pad is so far obtained.
2nd, the preparation of sample pad
Take glass fibre element film one, by it in sample pad treatment fluid (2.9g/l disodium hydrogen phosphate, 0.295g/l di(2-ethylhexyl)phosphate
Hydrogen sodium, 2g/l sodium chloride, 20g/l bovine serum albumin (bsa), 10ml/l tween 20,20g/l sucrose, 5g/l polyvinyl pyrrole
Alkanone (pvp-10), ph 7.3) in soak at least 3h, then after being placed in 37 DEG C of aeration-dryings in Biohazard Safety Equipment, be cut into 4cm*
The specification of 2.5cm, 25 DEG C of hermetically dryings preserve.So far sample pad is obtained.It is experimentally verified that glass fibre element film through this kind of method
After process, considerably improve the release rate of quantum dot-labeled antibody.
3rd, the preparation of detection layers
The preparation of detection layers, is by respectively will be many by Mus anti-human hemophilus influenza p6 albumen prepared in step one
Clonal antibody igg and the special Membrane jetter of anti-rabbit igg form detection line and control line on nitrocellulose filter；It is specifically made
Preparation Method comprises the steps:
By the Mus anti-human hemophilus influenza p6 protein polyclone antibody igg of preparation and anti-rabbit igg phosphoric acid in step one
Salt buffer (2.9g/l disodium hydrogen phosphate, 0.295g/l sodium dihydrogen phosphate, 2g/l sodium chloride, ph 7.3) all adjusts respectively to end
Concentration is 0.5-2.5mg/ml, and wherein Mus anti-human hemophilus influenza p6 protein polyclone antibody igg preferably dilutes final concentration
For 1.5-2.0mg/ml, anti-rabbit igg preferably dilutes final concentration of 0.5-1.5mg/ml.Will be bloodthirsty for anti-human for the Mus having diluted influenza
Bacillus p6 protein polyclone antibody igg loads biodot and draws in film instrument shower nozzle, arranges 0.8-2.5 μ l/cm, preferably 1.0-2.0 μ
The amount of l/cm is sprayed on nitrocellulose filter, forms detection line；Anti-rabbit igg having diluted loading biodot is drawn film instrument shower nozzle
In, arrange 0.8-2.5 μ l/cm, the amount of preferably 1.0-2.0 μ l/cm is sprayed on as nature controlling line on nitrocellulose filter, its with inspection
Interval of survey line is 0.7cm.By the nitrocellulose filter having sprayed, 37 DEG C are dried 2h, are cut into the specification of 4cm*4cm, and 4 DEG C of sealings are dry
Dry preservation.So far detection layers are obtained.
4th, the processing of base plate
The base plate of pvc material is cut into standby after the specification of 4cm*7.3cm.
5th, the preparation of adsorptive pads
Absorbent filter is cut into the specification of 4cm*3cm, that is, makes adsorptive pads, standby.
6th, the assembling of detection card
Assembly working operates in Biohazard Safety Equipment, takes the adhered protection film on the base plate described in step 4 off first,
Detection layers (carrying the nitrocellulose filter of 1 nature controlling line and 1 detection line) described in above step three are pasted base plate
Central region, and carefully floating face.Secondly, the adsorptive pads described in above step five are assembled on base plate so as to the left side
Have with detection layers that 0.2cm's is overlapping, its right hand edge is alignd with the right hand edge of base plate simultaneously and glue and carefully floating.Again will above
Pad described in step one is overlapped at the left hand edge of nitrocellulose filter by 0.3cm, and 0.3cm sticks on base plate.Finally will
Sample pad described in above step two is then overlapped at the left hand edge of pad by one side 0.3cm, the left side of another side and base plate
Edge aligns, and sticks on base plate and carefully floating.The detection plate assembling is cut into the wide detection card of 4.0mm under cutting cutter, 4 DEG C
Hermetically drying keeps in Dark Place.So far artificial abortion haemophilus influenza quantum dot immune chromatography detection card is obtained.
The using method of above-mentioned artificial abortion's haemophilus influenza quantum dot immune chromatography detection card, step is as follows:
By measuring samples (as throat swab etc.) sample treatment liquid (2.9g/l disodium hydrogen phosphate, the 0.295g/l phosphorus of 500 μ l
Acid dihydride sodium, 10ml/l triton x-100,2g/l sodium chloride, ph 7.3) fully dissolve after, take out 120 μ l and drip in detection card
Sample pad on, 15 minutes under uviol lamp observe testing result.If containing human influenza influenzae antigens in measuring samples,
Then be combined with the quantum dot-labeled anti-human hemophilus influenza nano-probe in pad, first fine with nitric acid by chromatography effect
Meeting at detection line under ultraviolet excites after Mus anti-human hemophilus influenza p6 protein polyclone antibody combination on the plain film of dimension
Form a macroscopic fluoroscopic examination line, after the quantum dot-labeled antibody continuation chromatography being not associated with is combined with anti-rabbit igg
Excite the macroscopic Article 2 fluorescence nature controlling line of lower formation in ultraviolet；If no related antigen in measuring samples, only occur
Article one, fluorescence nature controlling line.If fluorescence nature controlling line does not occur, this detection card lost efficacy.
The water solublity cdse/zns quantum dot that carboxylated amphipathic polymer needed for the present invention is modified can arrive such as Wuhan Ka
The professional company such as source technology of quantum dots development corporation, Ltd. buys；Required pvc material base plate, absorbent filter, cellulose nitrate
It is professional that plain film, polyester fiber film, glass fibre element film etc. can arrive millipore and Shanghai Jinbiao Bio-Tech Co., Ltd. etc.
Company buys, and required other conventional instruments, equipment, biochemical drug are commercially available.
The present invention is further described in detail by following examples.
The present invention uses or the source of various materials of employing and the preparation of related reagent
1st, sample pad treatment fluid: weigh 0.29g disodium hydrogen phosphate, 0.0295g sodium dihydrogen phosphate, 0.2g sodium chloride, 2g cattle
Serum albumin (bsa), 1ml tween 20,2g sucrose, 0.5g Polyvinylpyrrolidone (pvp-10), be dissolved in 90ml go from
In sub- water, deionized water after ph to 7.3 is adjusted to be settled to 100ml with 1mol/l naoh.
2nd, phosphate cleaning mixture: weigh 0.29g disodium hydrogen phosphate, 0.0295g sodium dihydrogen phosphate, 0.2g sodium chloride, 0.5ml
Tween 20,0.1g Hydrazoic acid,sodium salt, it is dissolved in the deionized water of 90ml, adjust deionized water after ph to 7.3 with 1mol/lnaoh
It is settled to 100ml.
3rd, phosphate preserves liquid: weighs 0.29g disodium hydrogen phosphate, 0.0295g sodium dihydrogen phosphate, 0.2g sodium chloride, 1g cattle
Serum albumin (bsa), 0.1g nan3, it is dissolved in the deionized water of 90ml, adjusted with 1mol/l naoh and spend after ph to 7.3
Ionized water is settled to 100ml.
4th, phosphate buffer (pbs): weigh 0.29g disodium hydrogen phosphate, 0.0295g sodium dihydrogen phosphate, 0.2g sodium chloride,
It is dissolved in the deionized water of 90ml, adjust deionized water after ph to 7.3 to be settled to 100ml with 1mol/l naoh.
5th, rabbit anti-human hemophilus influenza p6 protein polyclone antibody igg: for present invention self-control, with pbs dilution, shake up,
Anti-TNF-α bulk concentration in solution is made to be 3mg/ml.
6th, Mus anti-human hemophilus influenza p6 protein polyclone antibody igg: for present invention self-control, with pbs dilution, shake up,
Anti-TNF-α bulk concentration in solution is made to be 3mg/ml.
7th, goat-anti rabbit igg: for doctor's moral Products, with pbs dilution, shake up, make the Anti-TNF-α bulk concentration in solution be
1mg/ml.
8th, quantum dot: in the present invention, quantum dot used is the water solublity cdse/zns quantum that carboxylated amphipathic polymer is modified
Point, its launch wavelength is 565nm, buys from Wuhan Jia Yuan technology of quantum dots development corporation, Ltd., name of product is that carboxyl is water-soluble
Property quantum dot -565.
9th, glass fibre element film: thickness is 0.4mm, water absorption is 42mg/cm2, glass fiber diameter be 0.6-3 μm, tool
There is good hydrophilic, buy in Shanghai Jinbiao Bio-Tech Co., Ltd. (model bt40).
10th, polyester fiber film: thickness is 0.48mm, absorption speed is 18s/4cm, has fabulous hydrophilic, for tying
Close the preparation of pad, buy in Shanghai Jinbiao Bio-Tech Co., Ltd. (model dl42).
11st, nitrocellulose filter: model millipore corp shf135, there is liner plate, buy public in millipore
Department.
12nd, absorbent filter: thickness is 0.95mm, absorption speed is 60s/4cm, and water absorption is 700mg/cm2, have good
Water absorption, as make adsorptive pads material.Buy in Shanghai Jinbiao Bio-Tech Co., Ltd. (model ch37k).
13rd, base plate: for high whiteness pvc material, surface is coated with monolayer high polymer pressure sensitive adhesive sm31, buys in Shanghai gold mark
Bio tech ltd.
14th, artificial abortion's haemophilus influenza bacterial strain: purchased from American type culture collection (atcc), numbering is
atcc53781.
15th, the microbiological specimens used in the present invention are purchased from American type culture collection (atcc).
With reference to embodiment, technical scheme provided by the present invention is described in detail:
Embodiment 1 (preparation embodiment)
The preparation of pad
(1) preparation of restructuring p6-his fusion protein, purification
1. the clone of related gene
To artificial abortion haemophilus influenza surface protein p6, (the accession number in its ncbi Protein Data Bank is
Aaa24994) carry out bioinformatic analysis, obtain epitope peptide fragment the abundantest in its extracellular conserved domain, find
Its corresponding dna coded sequence, introduces termination signal taa and restriction enzyme site at its 5 ' introducing restriction enzyme site ndei, 3 ' ends simultaneously
After xhoi, (complete sequence synthesis transfers to Jin Sirui bio tech ltd to complete to chemosynthesis complete genome sequence, artificial during delivery
The genetic fragment of synthesis is connected on carrier puc57), it is designated as p6.Its gene complete sequence is as shown in sequence table.Specifically, p6 base
Because the protein sequence of coding is natural human hemophilus influenza surface protein p6 (accession number:aaa24994)
48-153aa.The carrier puc57 of the dna fragment containing this section of synthetic is carried out after double digestion routinely with ndei and xhoi
Method reclaims purpose fragment, standby.Simultaneously adopt ndei and xhoi to carrier pet-28a (+) carry out double digestion, and routinely side
Method by the p6 gene obtaining after double digestion be connected into pet-28a (+) in carrier, and convert escherichia coli top10, build pet-p6
Expression vector.Confirm that expression vector establishment is errorless through enzyme action and sequencing.This vector expression restructuring p6-his fusion protein.
2. the expression and purification of restructuring p6-his fusion protein
Plasmid is extracted, routinely technology proceeds to competence e.colibl21 after identifying correct positive colony bacterium culture
(de3), in plyss, after the completion of conversion, bacterium solution is coated on the lb flat board containing 50 μ g/ml kanamycin, screen according to a conventional method
Expression strain.What picking pet-p6 converted has the single bacterium colony of exogenous protein expression ability and inoculates into 100ml lb culture medium
In, in 30 DEG C of overnight incubation.After taking out bacterium solution, it is inoculated in, by 1:100, the lb culture medium that 100ml contains 50 μ g/ml kanamycin
In, cultivate to od in 30 DEG C600When=0.6, add 1mol/l iptg to final concentration of 1mmol/l, shake bacterium culture in 30 DEG C, lure
Lead expressing fusion protein.Induction 4h is centrifuged 10min collects thalline under 8000r/min.This thalline is delayed with 20ml phosphate
Rush liquid (8g/l nacl, 0.2g/l kcl, 0.24g/l kh2po4, 1.44g/l na2hpo4Ph=7.4) washing is used in combination for 3 times
10ml sample-loading buffer (20mm na3po4, 0.5m nacl；30mm imidazoles, ph7.4) resuspended after carry out ultrasonication, operate bar
Part is: 50hz, 200w, ultrasonic 3s, interval 5s, works 100 times.After the completion of ultrasonic, 12000g centrifugation 15min collects precipitation respectively
With carry out electrophoresis detection after supernatant.Find that restructuring p6-his fusion protein is present in thalline in solubility expression mode.
His trapaffinity is used after the ultrasonication supernatant of above-mentioned acquisition is filtered with 0.45 μm of filter membrane
Columns (ge healthcare Products), method to specifications carries out the purification of p6-his fusion protein of recombinating.
Concrete grammar is as follows:
1) it is filled distilled water with 5ml syringe, turns on the stopper of post, with the joint providing, post and syringe are connected,
Post is washed with 1ml/min flow velocity.
2) 10ml sample-loading buffer is used to balance, 1ml/min flow velocity.
3) by fusion protein loading, 1ml/min flow velocity.
4) use 10ml sample-loading buffer, post is washed with 1ml/min flow velocity.
5) use 10ml elution buffer (20mm na3po4, 0.5m nacl, 300mm imidazoles, ph7.4), with 1ml/min stream
Fast eluting, is in charge of collection, often pipe 1ml, and 12%sds-page detects, merges the sample containing destination protein in elution fraction.Warp
After bradford test kit carries out determination of protein concentration, adjustment concentration is 0.2mg/ml.
(2) preparation of rabbit and Mus anti-human hemophilus influenza p6 protein polyclone antibody igg
1. the preparation of rabbit anti-human hemophilus influenza p6 protein polyclone antibody igg
Mixed with 1ml Freund's complete adjuvant according to 200 μ g (1ml) with the restructuring p6-his fusion protein of step (one) purification
Immune Male New Zealand White Rabbit (being provided by Disease Prevention Control Center, Hubei Prov) after emulsifying, in dorsal sc multi-point injection,
After the 7d of interval again immunity once, with the restructuring p6-his fusion protein of above-mentioned purification according to 200 μ g (1ml) and 1ml after 14d
Incomplete Freund's adjuvant carries out booster immunization after mixing emulsifying, booster immunization one more in same way as described above again after booster immunization 7d
Secondary.Haemanalysises antibody titer is taken after 7d.If dissatisfied, may be repeated one and arrive booster immunization twice, (use to antibody titer is satisfied
Elisa method measures antibody titer and is more than 1 × 105).If satisfied, Culling heart blood, separate serum, with protein g affinity chromatograph
Post (ge healthcare Products), in strict accordance with operating instruction purified polyclonal antibodies igg, with triumphant base braford egg
White reagent box for detecting content measures antibody concentration and with phosphate buffer (8g/l nacl, 0.2g/l kcl, 0.24g/l
kh2po4, 1.44g/l na2hpo4Ph7.4) it is adjusted to 2mg/ml, -20 DEG C of preservations are standby, the anti-human influenza of rabbit is so far obtained bloodthirsty
Bacillus p6 protein polyclone antibody igg.Westen blot test shows, this polyclonal antibody igg can specific recognition human influenza
Haemophiluss total length p6 albumen.
2. the preparation of Mus anti-human hemophilus influenza p6 protein polyclone antibody igg
Restructuring p6-his fusion protein with step (one) purification is (pre- by Hubei Province's disease as complete antigen immune guinea pig
Anti- control centre provides), injections of antigens 200 μ g/ under omoplate.Fundamental immunity is entered with Freund's complete adjuvant for isopyknic antigen
Row emulsifying, carried out a booster immunization every 2 weeks, and booster immunization is carried out with equal-volume incomplete Freund's adjuvant with equal-volume antigen
Emulsifying, immunity 4 times altogether.Haemanalysises antibody titer is taken after final immunization 10d.If dissatisfied, may be repeated one arrive twice plus
Immunity by force, (measures antibody titer with elisa method and is more than 1 × 10 to antibody titer is satisfied5).If satisfied, put to death Cavia porcelluss and take blood
Clearly, with protein g affinity column (ge healthcare Products), in strict accordance with operating instruction purified polyclonal
Antibody igg, measures antibody concentration and with phosphate buffer (8g/l with triumphant base braford protein content detection kit
Nacl, 0.2g/l kcl, 0.24g/l kh2po4, 1.44g/l na2hpo4Ph=7.4) it is adjusted to 2mg/ml, standby, so far make
Obtain Mus anti-human hemophilus influenza p6 protein polyclone antibody igg.Westen blot test shows, this polyclonal antibody igg energy
Specific recognition artificial abortion's haemophilus influenza total length p6 albumen.
(3) preparation of quantum dot-labeled anti-human hemophilus influenza nano-probe
1. the quantum dot-labeled rabbit of nanometer carboxylic anti-human hemophilus influenza p6 protein polyclone antibody igg reaction condition is excellent
Change:
1.1st, the determination of carboxyl quantum dot-labeled antibody probe optimum mark ph
During labelling is reacted, phosphate buffer ph is set to 5,6,7,8,9, and marked product is entered using full spectrogrph
Row fluorescent strength determining, observe different ph values to coupling reaction impact it is determined that quantum dot-labeled multi-resistance reaction optimal ph
For 7.0-8.0.This experimental selection ph7.4.
1.2nd, the determination of carboxyl quantum dot-labeled antibody probe optimum mark amount
The ratio of quantum dot molar concentration and multi-resistance concentration is respectively set to 1:1,1:2,1:3 and 1:4, is marked reaction
Afterwards, using full spectrogrph, fluorescent strength determining is carried out to marked product, observes the impact that the two variable concentrations compares coupling reaction,
Determine that the optimum molar concentration ratio that quantum dot-labeled rabbit anti-human hemophilus influenza p6 protein polyclone antibody igg reacts is quantum
Point and antibody molar ratio are 1:3.This optimal concentration ratio of this experimental selection is determining labelled amount.
1.3rd, the determination of the optimal sealer species of the quantum dot-labeled antibody probe of carboxyl
With ethanolamine, tris, peg2000-nh2Or bsa, as sealer, is entered by the condition of step 1.1 and 1.2 determinations
After line flag reaction, using full spectrogrph, fluorescent strength determining is carried out to marked product, observe different sealers for labelling
The impact of reaction, it was found that peg2000-nh2For optimal sealer, it is remarkably improved the colloid-stabilised of labeled complex
Property and immunocompetence.
2. labeling process:
2nmol carboxyl water-soluble quantum dot, 300nmol n- N-Hydroxysuccinimide is sequentially added in microcentrifugal tube
(sulfo-nhs) and 300nmol carbodiimide (edc), with phosphate buffer (2.9g/l disodium hydrogen phosphate, 0.295g/l phosphorus
Acid dihydride sodium, 4g/l sodium chloride, ph 7.4) constant volume is 2ml, ceaselessly mixed solution, after 37 DEG C of reaction 30min, dialysis removes
Excessive sulfo-nhs and edc as activator.Activation quantum dot in, add 6nmol step (two) prepare
Rabbit anti-human hemophilus influenza p6 protein polyclone antibody igg, lucifuge reacts 2h, adds single-ended amino polyethylene glycol
(peg2000-nh2) to final concentration of 1%, close unreacted activated carboxyl site, continue lucifuge reaction 1h.With 0.2 μm
Pes filter is filtered to remove antibody aggregation thing, then filtrate be transferred to, in 50000mw ultra-filtration centrifuge tube, exist with 8000g centrifugal force
It is centrifuged 15min at 4 DEG C, remove the by-product in the antibody that coupling reaction does not occur and reaction.Collect super filter tube filter membrane upper strata amount
Sub- point-antibody coupling matter solution, be dissolved in 2ml phosphate cleaning mixture (2.9g/l disodium hydrogen phosphate, 0.295g/l sodium dihydrogen phosphate,
4g/l sodium chloride, 5ml/l tween 20,0.3g/l sodium azide, ph 7.4) in, then by this solution transfer to 50000mw ultrafiltration from
In heart pipe, 15min is centrifuged at 4 DEG C with 8000g centrifugal force, collects super filter tube filter membrane upper strata quantum dot-antibody coupling matter solution,
Be dissolved in 1ml phosphate preserve liquid (2.9g/l disodium hydrogen phosphate, 0.295g/l sodium dihydrogen phosphate, 2g/l sodium chloride, 10g/l bsa,
0.3g/l sodium azide, ph 7.4) in, so far quantum dot-labeled anti-human hemophilus influenza nano-probe is obtained, is placed in 4 DEG C of guarantors
Deposit standby.
(4) load of quantum dot-labeled anti-human hemophilus influenza nano-probe
Polyester fiber film is immersed the quantum dot-labeled anti-human hemophilus influenza nano-probe obtained by step (three)
1h in solution, takes out, and is cut into rear specification for, after 4cm*0.6cm/ bar, 4 DEG C of sealing preserves are standby, knot is so far obtained after 25 DEG C of dryings
Close pad.
Embodiment 2 (preparation embodiment)
The preparation of sample pad
Prepare the sample pad treatment fluid of different formulations, observe the releasing effect of quantum dot traget antibody, by repeatedly orthogonal
Assay optimization, obtains the sample pad prescription for the treatment of liquid (i.e. of the present invention) of optimum.Take glass fibre element film one, by it in sample
Soak at least 3h in product pad treatment fluid, then after being placed in 37 DEG C of aeration-dryings in Biohazard Safety Equipment, being cut into specification is 4cm*
After 2.5cm/ bar, that is, sample pad is obtained, 25 DEG C of hermetically dryings preserve.It is experimentally verified that the use of this sample pad, substantially increase
The release rate of quantum dot-labeled antibody on pad, has reached preferable application effect.
Embodiment 3 (preparation embodiment)
The preparation of detection layers
Nitrocellulose filter is cut into 4cm*4cm size.By prepared Mus anti-human hemophilus influenza p6 in embodiment 1
Protein polyclone antibody igg and anti-rabbit igg phosphate buffer adjust and are respectively 2.0mg/ml and 1.0mg/ml to final concentration.
Anti-human for the Mus having diluted hemophilus influenza p6 protein polyclone antibody igg loading biodot is drawn in film instrument shower nozzle, arranges 1.0
The amount of μ l/cm is sprayed on nitrocellulose filter, forms detection line；Anti-rabbit igg having diluted loading biodot is drawn film instrument shower nozzle
In, the amount of setting 1.0 μ l/cm is sprayed on as nature controlling line on nitrocellulose filter, and it is 0.7cm with detection distance between centers of tracks.To spray
37 DEG C of nitrocellulose filter 2h is dried, be cut into the specification of 4cm*4cm, 4 DEG C of hermetically dryings preserve.So far detection layers are obtained.
Embodiment 4 (preparation embodiment)
The assembling of detection card
Below in conjunction with the accompanying drawings 1 and accompanying drawing 2 to detection card assembling be described further.
Base plate is cut into 4cm*7.3cm size, standby.
Absorbent filter is cut into 4cm*3cm size, as adsorptive pads, standby.
Assembly working operates in Biohazard Safety Equipment, takes the adhered protection film on base plate 7 off first, by embodiment 3 institute
The detection layers 3 the stated i.e. nitrocellulose filter with nature controlling line 5 and detection line 4 pastes the concrete area of accompanying drawing 1 indication on base plate 7
Domain, and carefully floating face.Secondly, the adsorptive pads cutting out in advance 6 are assembled on base plate 7 so as to the left side and the right end of detection layers
There is the overlap of 0.2cm at end, and its right hand edge is then alignd with the right hand edge of base plate 7 and glues and carefully floating.Again by described by embodiment 1
Pad 2 be overlapped at the left hand edge of detection layers 3 by 0.3cm, 0.3cm sticks on base plate 7.Finally by described by embodiment 2
Sample pad 1 be then overlapped in by one side 0.3cm at the left hand edge of pad 2, another side is alignd with the left hand edge of base plate 7, glue
On base plate 7 and carefully floating.The detection plate assembling is cut into the wide detection card of 4.0mm, 4 DEG C of hermetically dryings under cutting cutter
Keep in Dark Place.
Embodiment 5 (Application Example)
The using method of detection card
Obtain the throat swab of person to be checked according to a conventional method, be inserted into and with the addition of 1%tritonx-100 equipped with 500 μ l
In the flexible plastic pipe of phosphate buffer (pbst) of (percent by volume), squeezable plastic tube wall, so that the sample on swab is filled
Point dissolving after, take out 120 μ l drip in detection card sample pad on, 15 minutes under uv analyzer (model wd-9403a,
Liuyi Instruments Plant, Beijing produces, burst of ultraviolel wavelength 365nm) observe testing result.If containing the bloodthirsty bar of human influenza in throat swab
Bacterium antigen, then be combined with the quantum dot-labeled anti-human hemophilus influenza nano-probe in pad, is acted on first by chromatography
In inspection under ultraviolet excites after being combined with the anti-human hemophilus influenza p6 protein polyclone antibody of the Mus on nitrocellulose filter
A macroscopic fluoroscopic examination line can be formed, the quantum dot-labeled antibody being not associated with continues chromatography and anti-rabbit at survey line
Igg excites the macroscopic Article 2 fluorescence nature controlling line of lower formation in ultraviolet after combining；If no related anti-in throat swab to be checked
Former, then a fluorescence nature controlling line only occurs.If fluorescence nature controlling line does not occur, this detection card lost efficacy.
Embodiment 6 (Application Example)
The application effect citing of the present invention
In the present embodiment, the using method of artificial abortion's haemophilus influenza quantum dot immune chromatography detection card of indication is with reference to enforcement
Operating procedure described in example 5.
1) specific test
Propped up former with respiratory tract common causative such as human respiratory syncytial virus (long strain, atcc numbering vr26), people's pneumonia
(gb strain, atcc compiles for body (atcc numbering 15531), people's Chlamydia pneumoniae (ar-39 strain, atcc numbering 53592), adenovirus hominiss 3 type
Number vr-3), adenovirus hominiss 7 type (gomen strain, atcc numbering vr-7), influenza virus A hominis's (h1n1, atcc numbering vr-
1743), people's Influenza B viruss (atcc numbering vr-790), moraxelle catarrhalises (atcc numbering 25238), streptococcus pneumoniae
(atcc numbering 700670) etc. replaces artificial abortion's haemophilus influenza to be detected, the pbst dilution containing these microorganisms for the detection card detection
Liquid is all negative.
2) sensitivity testss
Do Study of Sensitivity by measuring artificial abortion's haemophilus influenza culture diluent, determine the inspection described in embodiment 4
The Monitoring lower-cut surveying card detection artificial abortion's haemophilus influenza bacterial strain (atcc numbering 53781) is 2 × 104cfu/ml.
3) clinical trial example
Using hemophilus influenza detection goldstandard-culture method as reference, take the pharynx of 88 Pneumology Department respiratory tract infection persons
Swab specimen is detected with the detection card described by embodiment 4, and culture method positive rate is 20.5% (18/88), and this detection blocks
For 21.6% (19/88), the coincidence rate of 2 kinds of methods is 96.6% (85/88).Concrete outcome is as shown in table 1.
The testing result of table 1 clinical samples
It is pointed out that the foregoing is only presently preferred embodiments of the present invention, not in order to limit the present invention, all
Any modification of being made within present invention spirit and principle, equivalent etc. should be included in protection scope of the present invention it
Interior.
Claims (2)
1. a kind of based on artificial abortion's haemophilus influenza quantum dot immune chromatography detection card preparation method it is characterised in that: described system
Preparation Method comprises the following steps:
1) preparation of pad:
1.1) preparation of restructuring p6-his fusion protein, purification:
1.1.1) bioinformatic analysis are carried out to artificial abortion haemophilus influenza surface protein p6, obtain antigen in its ectodomain
Epi-position peptide fragment the abundantest；
1.1.2) find step 1.1.1) in the corresponding gene coded sequence of obtained peptide fragment, and the 5 ' ends in sequence and 3 ' ends draw
Enter restriction enzyme site chemosynthesis complete genome sequence, be labeled as p6 simultaneously；
The complete genome sequence of described p6 is:
catatgtacaacaccgtatattttggttttgataaatacgacatcaccggtgaatacgttcaaatctt
ndei
agatgcgcacgcagcatatttaaatgcaacgccagctgctaaagtattagtagaaggtaatactgatgaacgt
ggtacaccagaatacaacatcgcattaggacaacgtcgtgcagatgcagttaaaggttatttagcaggtaaaggtgt
tgatgctggtaaattaggcacagtatcttacggtgaagaaaaacctgcagtattaggtcacgatgaagctgcatatt
ctaaaaaccgtcgtgcagtgttagcgtactaactcgag
xhoi
1.1.3) by step 1.1.2) in obtained p6 by molecular biology method be cloned into expression vector pet-28a (+) after
Proceed to expression in escherichia coli restructuring p6-his fusion protein；Described restructuring p6-his fusion protein is deposited in solubility expression mode
It is in thalline；
1.1.4) use ni-sepharose purification step 1.1.3) obtained by recombiant protein, after sds-page detects its purity, with
Bradford method measures protein concentration, and adjustment protein concentration is standby after 0.2mg/ml；
1.2) preparation of rabbit and Mus anti-human hemophilus influenza p6 protein polyclone antibody igg:
1.2.1) with step 1.1.4) in obtained restructuring p6-his fusion protein as complete antigen, immune New Zealand is big respectively
White rabbit and Cavia porcelluss；Prepare rabbit anti-human hemophilus influenza p6 protein antiserum respectively and Mus anti-human hemophilus influenza p6 albumen resists
Serum；The anti-human hemophilus influenza p6 protein antiserum of described rabbit and Mus anti-human hemophilus influenza p6 protein antiserum indirect
Elisa potency is all higher than 1 × 105；
1.2.2 purified rabbit anti-human's hemophilus influenza p6 protein antiserum and Mus resist respectively) to adopt protein g affinity column
Polyclonal antibody igg in artificial abortion's haemophilus influenza p6 protein antiserum；
1.2.3) with triumphant base braford protein content detection kit determination step 1.2.2) obtained by two kinds of polyclonal antibodies
The concentration of igg, its protein concentration is all adjusted to standby after 3mg/ml；
1.3) the quantum dot-labeled preparation of anti-human hemophilus influenza nano-probe and purification:
1.3.1 in microcentrifugal tube) sequentially add 2nmol quantum dot, 300nmol n- N-Hydroxysuccinimide and 300nmol
Carbodiimide, with phosphate buffer constant volume as 2ml, in rotary mixer, with 15rpm, after 37 DEG C of reaction 30min, dialysis
Remove excessive n- N-Hydroxysuccinimide and carbodiimide；In described phosphate buffer, each constituent content is respectively as follows:
2.9g/l disodium hydrogen phosphate, 0.295g/l sodium dihydrogen phosphate and 2g/l sodium chloride, the ph=7.3 of described phosphate buffer；
1.3.2) activation quantum dot in, add 4-12nmol step 1.2) prepared by rabbit anti-human hemophilus influenza p6
Protein polyclone antibody igg, lucifuge reacts 2h, adds Amino End Group polyethylene glycol to final concentration of 1.5%, closes unreacted
Activated carboxyl site, continues lucifuge reaction 1h；It is filtered to remove antibody aggregation thing with 0.2 μm of pes filter, then filtrate is shifted
To in 50000mw ultra-filtration centrifuge tube, 15min is centrifuged at 4 DEG C with 8000g centrifugal force, removes the antibody that coupling reaction does not occur
With the by-product in reaction；Collect super filter tube filter membrane upper strata quantum dot-antibody coupling matter solution, be dissolved in 2ml phosphate cleaning mixture
In, then this solution is transferred in 50000mw ultra-filtration centrifuge tube, 15min is centrifuged at 4 DEG C with 8000g centrifugal force, collects ultrafiltration
Pipe filter membrane upper strata quantum dot-antibody coupling matter solution, is dissolved in 1ml phosphate and preserves in liquid, quantum dot-labeled resist so far is obtained
Artificial abortion's haemophilus influenza nano-probe；
In described phosphate cleaning mixture each constituent content be respectively as follows: 2.9g/l disodium hydrogen phosphate, 0.295g/l sodium dihydrogen phosphate,
2g/l sodium chloride, 5ml/l tween 20 and 1g/l sodium azide；The ph=7.3 of described phosphate cleaning mixture；Described phosphate is protected
In liquid storage, each constituent content is respectively as follows: 2.9g/l disodium hydrogen phosphate, 0.295g/l sodium dihydrogen phosphate, 2g/l sodium chloride, 10g/l
Bsa and 1g/l sodium azide；Described phosphate preserves the ph=7.3 of liquid；
1.4) load of quantum dot-labeled antibody:
Polyester fiber film is immersed step 1.3.2) obtained by quantum dot-labeled anti-human hemophilus influenza nano-probe molten
1h in liquid, takes out, and the rear 4 DEG C of sealing preserves of 25 DEG C of dryings are standby, and pad is so far obtained；
2) preparation of sample pad:
Take glass fibre element film one, glass fibre element film is soaked at least 3h in sample pad treatment fluid, then is placed in biological peace
After 37 DEG C of aeration-dryings in full cabinet, 25 DEG C of hermetically dryings preserve；So far sample pad is obtained；
In described sample pad treatment fluid each constituent content be respectively as follows: 2.9g/l disodium hydrogen phosphate, 0.295g/l sodium dihydrogen phosphate,
2g/l sodium chloride, 20g/l bovine serum albumin, 10ml/l tween 20,20g/l sucrose and 5g/l Polyvinylpyrrolidone, institute
State the ph=7.3 of sample pad treatment fluid；
3) preparation of detection layers:
3.1) by step 1.2) the Mus anti-human hemophilus influenza p6 protein polyclone antibody prepared delayed with anti-rabbit igg phosphate
Rush liquid all adjust standby to final concentration of 0.5-2.5mg/ml；In described phosphate buffer, each constituent content is respectively as follows:
2.9g/l disodium hydrogen phosphate, 0.295g/l sodium dihydrogen phosphate and 2g/l sodium chloride, the ph=7.3 of described phosphate buffer；
3.2) anti-human for the Mus having diluted hemophilus influenza p6 protein polyclone antibody loading biodot is drawn in film instrument shower nozzle, if
The amount setting to 0 .8-2.5 μ l/cm is sprayed on nitrocellulose filter, forms detection line；Anti-rabbit igg having diluted loading biodot is drawn
In film instrument shower nozzle, the amount of setting 0.8-2.5 μ l/cm is sprayed on nitrocellulose filter according to the interval with detection line 0.5-0.8cm
As nature controlling line；
3.3) nitrocellulose filter being sprayed with detection line and nature controlling line is dried 2h at 37 DEG C, 4 DEG C of hermetically dryings preserve；So far
Prepared detection layers；
4) preparation of base plate
The base plate of pvc material is pressed standby after actual requirement cutting；
5) preparation of adsorptive pads
Absorbent filter is pressed standby after actual requirement cutting；
6) assembling of artificial abortion's haemophilus influenza quantum dot immune chromatography detection card:
6.1) by step 4) adhered protection film on preparation-obtained base plate takes off；
6.2) by step 3) preparation-obtained detection layers paste the central region of base plate, and floating face；
6.3) by step 5) preparation-obtained adsorptive pads are assembled on base plate, so that the left side of adsorptive pads is had with detection layers and partly weigh
Folded, its right hand edge is alignd with the right hand edge of base plate simultaneously and glue and floating；
6.4) by step 1) preparation-obtained pad is overlapped in the left hand edge of nitrocellulose filter by partly overlapping mode
Place, sticks at pad on base plate simultaneously；
6.5) by step 2) prepared by obtain sample pad and be then overlapped at the left hand edge of pad by partly overlapping mode, another
Being alignd with the left hand edge of base plate in side, sticks on base plate and floating；
6.6) artificial abortion assembling haemophilus influenza quantum dot immune is chromatographed detection card and carry out cutting, 4 DEG C of hermetically drying lucifuges
Preserve；
Described step 6.1) to step 6.6) it is all to be operated in Biohazard Safety Equipment.
2. method according to claim 1 it is characterised in that: described step 1.3.2) in add 6nmol step 1.2)
Prepared rabbit anti-human hemophilus influenza p6 protein polyclone antibody igg；
Described step 3.1) in by step 1.2) Mus anti-human hemophilus influenza p6 protein polyclone antibody and anti-rabbit igg prepared
Adjusted with phosphate buffer and be respectively 1.5-2.0mg/ml and 0.5-1.5mg/ml to final concentration；
Described step 3.2) in, anti-human for the Mus having diluted hemophilus influenza p6 protein polyclone antibody loading biodot is drawn film
In instrument shower nozzle, the amount of setting 1.0-2.0 μ l/cm is sprayed on nitrocellulose filter, forms detection line；By anti-rabbit igg having diluted
Load biodot to draw in film instrument shower nozzle, the amount of setting 1.0-2.0 μ l/cm is sprayed on nitre according to the interval with detection line 0.5-0.8cm
As nature controlling line on acid cellulose film.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410406527.4A CN105242040B (en) | 2014-08-18 | 2014-08-18 | Human Haemophilus influenza quantum dot immunochromatography detection card, preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410406527.4A CN105242040B (en) | 2014-08-18 | 2014-08-18 | Human Haemophilus influenza quantum dot immunochromatography detection card, preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105242040A CN105242040A (en) | 2016-01-13 |
| CN105242040B true CN105242040B (en) | 2017-01-18 |
Family
ID=55039760
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410406527.4A Active CN105242040B (en) | 2014-08-18 | 2014-08-18 | Human Haemophilus influenza quantum dot immunochromatography detection card, preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105242040B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110540965A (en) * | 2018-12-20 | 2019-12-06 | 湖北诺美华抗体药物技术有限公司 | human haemophilus influenzae surface protein monoclonal antibody and application |
| CN110540966B (en) * | 2018-12-20 | 2023-04-28 | 湖北云璐生物工程有限公司 | Human haemophilus influenzae surface protein monoclonal antibody and antigen capture ELISA kit |
Citations (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1988004932A1 (en) * | 1986-12-31 | 1988-07-14 | Praxis Biologics, Inc. | Vaccines and diagnostic assays for haemophilus influenzae |
| EP0281673A1 (en) * | 1986-11-18 | 1988-09-14 | The Research Foundation Of State University Of New York | Plasmid for production of membrane protein, bacterium containing same, monoclonal antibody therefore, and method for the identification of haemophilus influenzae |
| CN101339196A (en) * | 2008-07-29 | 2009-01-07 | 上海师范大学 | Rapid checking method for bladder cancer by quantum dot mark immunity-chromatography test paper |
| CN101514987A (en) * | 2008-07-14 | 2009-08-26 | 马义才 | System for quantitative detection of quanta dot mark test bar and detection method thereof |
| CN101893623A (en) * | 2010-06-22 | 2010-11-24 | 上海师范大学 | Rapid detection method employing ultrasensitive quantum dot microsphere immunity-chromatograph test paper strips |
| CN102216781A (en) * | 2009-01-07 | 2011-10-12 | 大塚制药株式会社 | Method for assaying all types of influenza viruses |
| CN102520165A (en) * | 2011-12-29 | 2012-06-27 | 北京康美天鸿生物科技有限公司 | Method for highly sensitive quantitative detection of quantum dot fluorescence immunochromatographic assay |
| CN103048460A (en) * | 2012-12-15 | 2013-04-17 | 武汉珈源生物医学工程有限公司 | Method for detecting by using quantum dot fluorescence immunochromatographic test strips |
| CN103376320A (en) * | 2013-07-16 | 2013-10-30 | 华中农业大学 | Fluorescence immunity chromatography test strip for escherichia coli O157:H7 detection |
| CN103529203A (en) * | 2013-10-16 | 2014-01-22 | 北京华卫博沃生物科技有限公司 | Method for detecting mycobacterium tuberculosis, quantum-dot labeled immunochromatography test paper and preparation method thereof |
| CN103926403A (en) * | 2014-04-29 | 2014-07-16 | 广州市微米生物科技有限公司 | Streptococcus-A quantum dot immunochromatographic detection reagent card and preparation method thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006071247A2 (en) * | 2004-03-30 | 2006-07-06 | California Institute Of Technology | Diagnostic assays including multiplexed lateral flow immunoassays with quantum dots |
-
2014
- 2014-08-18 CN CN201410406527.4A patent/CN105242040B/en active Active
Patent Citations (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0281673A1 (en) * | 1986-11-18 | 1988-09-14 | The Research Foundation Of State University Of New York | Plasmid for production of membrane protein, bacterium containing same, monoclonal antibody therefore, and method for the identification of haemophilus influenzae |
| WO1988004932A1 (en) * | 1986-12-31 | 1988-07-14 | Praxis Biologics, Inc. | Vaccines and diagnostic assays for haemophilus influenzae |
| CN101514987A (en) * | 2008-07-14 | 2009-08-26 | 马义才 | System for quantitative detection of quanta dot mark test bar and detection method thereof |
| CN101339196A (en) * | 2008-07-29 | 2009-01-07 | 上海师范大学 | Rapid checking method for bladder cancer by quantum dot mark immunity-chromatography test paper |
| CN102216781A (en) * | 2009-01-07 | 2011-10-12 | 大塚制药株式会社 | Method for assaying all types of influenza viruses |
| CN101893623A (en) * | 2010-06-22 | 2010-11-24 | 上海师范大学 | Rapid detection method employing ultrasensitive quantum dot microsphere immunity-chromatograph test paper strips |
| CN102520165A (en) * | 2011-12-29 | 2012-06-27 | 北京康美天鸿生物科技有限公司 | Method for highly sensitive quantitative detection of quantum dot fluorescence immunochromatographic assay |
| CN103048460A (en) * | 2012-12-15 | 2013-04-17 | 武汉珈源生物医学工程有限公司 | Method for detecting by using quantum dot fluorescence immunochromatographic test strips |
| CN103376320A (en) * | 2013-07-16 | 2013-10-30 | 华中农业大学 | Fluorescence immunity chromatography test strip for escherichia coli O157:H7 detection |
| CN103529203A (en) * | 2013-10-16 | 2014-01-22 | 北京华卫博沃生物科技有限公司 | Method for detecting mycobacterium tuberculosis, quantum-dot labeled immunochromatography test paper and preparation method thereof |
| CN103926403A (en) * | 2014-04-29 | 2014-07-16 | 广州市微米生物科技有限公司 | Streptococcus-A quantum dot immunochromatographic detection reagent card and preparation method thereof |
Non-Patent Citations (1)
| Title |
|---|
| New trends in fluorescence immunochromatography.;Dongjin Pyo, Jisun Yoo;《Journal of Immunoassay and Immunochemistry》;20121231;第33卷;第214-219页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105242040A (en) | 2016-01-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104198703B (en) | People's mycoplasma pneumoniae gold label silver stain immunochromatographytest test kit and its preparation method and application | |
| CN105319359B (en) | Streptococcus pneumoniae quantum dot immunochromatographic assay detection card and preparing method and application thereof | |
| CN105277693B (en) | Human parainfluenza virus quantum dot immunochromatography typing detection card, preparation method and applications | |
| CN105319373B (en) | Rapid human respiratory syncytial virus detection method and kit based on magnetic separating and quantum dot labeling | |
| CN105203754B (en) | Method and kit for fast detection of moraxella catarrhalis based on magnetic resolution and quantum dot labelling | |
| CN105203768B (en) | Method and kit for fast detection of human chlamydia pneumoniae antigen based on magnetic resolution and quantum dot labelling | |
| CN104198710B (en) | Based on the anti-human Chlamydia pneumoniae IgM of magnetic resolution and color quantum point mark, the IgG antibody method of altogether inspection and kit fast | |
| CN104181301B (en) | Based on the anti-human haemophilus influenzae IgM of magnetic resolution and color quantum point mark, the IgG antibody method of altogether inspection and kit fast | |
| CN111007257A (en) | Porcine pseudorabies virus gE protein antibody detection immune blocking chromatography kit and application thereof | |
| CN204028084U (en) | People's Chlamydia pneumoniae quantum dot immune chromatography test card | |
| CN105242040B (en) | Human Haemophilus influenza quantum dot immunochromatography detection card, preparation method and application thereof | |
| CN105223352B (en) | Method and kit for rapidly detecting human haemophilus influenzae based on magnetic separation and quantum dot labelling | |
| CN105203769B (en) | Method and kit for fast detection of human chlamydia pneumoniae antigen based on magnetic resolution and quantum dot labelling | |
| CN104181302A (en) | Method and kit for performing quick co-detection on anti-Sp (Streptococcus pneumoniae) IgM (Immunoglobulin M) and IgG (Immunoglobulin G) antibodies based on magnetic separation and multi-color quantum dot labeling | |
| CN105277694B (en) | Human group A streptococci quantum dot immunochromatography detection card, preparation method and applications | |
| CN105585633B (en) | The immune chromatography reagent kit of anti-human haemophilus influenzae P6 protein antibodies and the application antibody | |
| CN105319360B (en) | People's CPN quantum dot immune chromatography detection card and its preparation method and application | |
| CN102533795B (en) | Recombinant human cytomegalovirus protein and applications thereof | |
| CN204028085U (en) | Moraxelle catarrhalis quantum dot immune chromatography test card | |
| CN105753982B (en) | The immune chromatography reagent kit of anti-human streptococcus pneumonia fam1 family PspA protein antibodies and the application antibody | |
| CN104181306A (en) | Method and kit for performing quick co-detection on anti-Mc (Moraxella catarrhalis) IgM (Immunoglobulin M) and IgG (Immunoglobulin G) antibodies based on magnetic separation and multi-color quantum dot labeling | |
| CN105277713B (en) | Rapid detection method and kit for streptococcus pneumoniae based on magnetic separation and quantum dot labeling | |
| CN204028083U (en) | People streptococcus pneumonia quantum dot immune chromatography test card | |
| CN105223353B (en) | Moraxelle catarrhalis quantum dot immune chromatography detection card and its preparation method and application | |
| CN105968197B (en) | A kind of anti-3 type Ureaplasma urealyticum MB protein antibodies and the immune chromatography reagent kit using the antibody |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20180710 Address after: 432500 8 Heping Road, Yunmeng Economic Development Zone, Xiaogan, Hubei Patentee after: Hubei numeihua antibody drug Technology Co., Ltd. Address before: 432800 Hubei Hualong bio Pharmaceutical Co., Ltd. 8, Changzheng Road, Chengguan Town, Dawu County, Xiaogan, Hubei Patentee before: Dong Jun |