CN110794135A - GPBB latex enhanced turbidimetry detection kit and preparation and use methods thereof - Google Patents

Abstract

The invention discloses a GPBB latex enhanced turbidimetry detection kit, which comprises R1 and R2, R1: PBS, PEG6000, BSA, NaCl, NaN₃EDTA; r2: PBS, PEG6000, BSA, NaCl, latex microspheres coupled with goat anti-human GPBB polyclonal antibody, TX-100 and NaN₃EDTA. The invention also discloses a preparation method and a use method of the GPBB latex enhanced turbidimetry detection kit. The invention has the advantages that: the invention can be used on a full-automatic biochemical analyzer, has low cost and high automation and saves the detection time; in addition, under the conditions of high stability and high precision, compared with other products, the method has higher sensitivity and specificity, and greatly improves the GPBB detectionAnd measuring the application value.

Description

GPBB latex enhanced turbidimetry detection kit and preparation and use methods thereof

Technical Field

The invention relates to the fields of genetic engineering technology and immunological determination and analysis, in particular to a GPBB latex enhanced turbidimetry detection kit and a preparation and use method thereof.

Background

Glycogen Phosphorylase (GP) is a key enzyme of Glycogen catabolism. GP monomer has a molecular weight of about 94kD and is usually present as a homodimer. There are at least three types of GP isozymes in human tissue, named GPBB (brain), GPMM (muscle), and GPLL (liver), respectively, depending on their tissue origin. GPBB is a major isozyme in fetal period, is mainly expressed in brain and heart after adult, and has similar expression amount between two organs. GPBB, a key enzyme in glycogenolysis, is a specific component of the glycogenolysis complex in the sarcoplasmic reticulum Structure (SR) in cardiac myocytes, and the binding and breakdown of this complex depends on the oxygen and blood supply status of the myocardium. Under normal conditions, the glycogen phosphorylase complex is firmly combined with SR and is not easy to decompose. However, when myocardial cells are ischemic and anoxic, the key enzyme GPBB for glycogenolysis can accelerate the degradation process. Glycogen degradation processes can be co-catalyzed by phosphorylated active gp (gpa) and non-phosphorylated active gp (gpb) as well as AMP-dependent forms. After ischemia occurs, it is a prerequisite for GP to become a soluble dimer, favoring the conversion of bound GPb to GPa, thereby accelerating the glycogenolysis process. When myocardial ischemia and hypoxia occur, the permeability of cell membrane is changed, GPBB can diffuse into blood, and the concentration of GPBB in the blood is increased. Therefore, GPBB is highly sensitive to ischemic myocardial injury, and analysis of GPBB can be used for differential diagnosis of Acute Myocardial Infarction (AMI) of patients with sudden chest pain within 4 hours and ischemic coronary syndrome, ST-T wave changes of patients with unstable chest pain accompanied by rest, and serum GPBB is the only test index detected to rise to pathological concentration so far. The diagnostic value of the compound on ischemic myocardial injury, particularly the early diagnosis on AMI (angiotensin converting enzyme) is obviously superior to other biochemical indexes (CK, CK-MB, TnT and the like).

The existing GPBB detection methods include a near infrared fluorescence method, a colloidal gold method and an ELISA method. Wherein, the colloidal gold method has low specificity and sensitivity, and is not suitable for clinical use; the near-infrared fluorescence method needs special instruments such as a spectrometer and the like, is long in time consumption and cannot be popularized and used in hospitals; ELISA is time consuming and not suitable for the need for rapid AMI diagnosis in emergency rooms and the field.

The latex boosting immune ratio method is a detection method for dynamically measuring antigen-antibody combination: in a specific dilution system, antigen and antibody are combined, and when the combination proportion is proper, particles are formed and are separated out from a liquid phase; before and after the antigen and antibody are combined, turbidity changes occur; the turbidity change is detected by a full-automatic biochemical analyzer, and a linear curve is drawn by using a standard substance, so that the content of the substance to be detected in the corresponding sample can be obtained. The method does not need special instruments, and is simple and convenient to operate. In addition, the latex enhanced immunoturbidimetry can enhance the absorbance of reaction by using a latex carrier, so that the sensitivity of detection is greatly improved, the detection is realized automatically by a full-automatic biochemical analyzer, the detection is more convenient and rapid, the time is saved, and the requirement of clinical large sample detection can be met.

Disclosure of Invention

The invention mainly aims to provide a GPBB latex enhanced turbidimetry detection kit and a preparation and use method thereof, and aims to solve the problems of low specificity and sensitivity, high detection cost and long time consumption of the existing GPBB detection method.

In order to achieve the purpose, the invention provides a GPBB latex enhanced turbidimetry detection kit, which comprises independent R1 and R2 double liquid components, and comprises the following components in corresponding content:

R1：

R2：

as one of the preferred modes of the invention, the composition comprises the following components in percentage by weight:

R1：

the solvent is purified water;

R2：

as one of the preferable modes of the invention, the GPBB calibrator is further included, and the GPBB calibrator comprises the following components in parts by weight:

as one of the preferable modes of the invention, the GPBB calibration product comprises the following components in percentage by weight:

as one of the preferable modes of the invention, the method for obtaining the rGPBB in the GPBB calibrator is specifically recombinant human GPBB protein as follows:

① acquisition of human GPBB Gene:

with reference to GENBANK accession number NM _002862.4, adding a restriction enzyme site SnaB I at the upstream, adding a flexible linker to protect the spatial structure of a target fragment, and adding a restriction enzyme site Not I and a protective base at the downstream to obtain a gene sequence shown as SEQ ID No. 1; after obtaining the gene sequence, sending the gene sequence to a gene company for synthesis, and obtaining a target gene sequence after the sequencing is qualified;

② construction of expression vector:

carrying out double enzyme digestion on the synthesized gene and pPIC9K plasmid by using two endonucleases of SnaB I and Not I, connecting double enzyme digestion products by using ligase, electrically transducing the double enzyme digestion products into pichia pastoris competent cells, coating the pichia pastoris competent cells on a YPD plate containing 100mg/L Zeocin, carrying out constant temperature culture at 28 ℃ for 36h, selecting bacterial colonies growing on a resistance plate, sending the bacterial colonies to a gene sequencing identification target gene, identifying the bacterial colonies as positive after the coincidence degree is 99.99%, and indicating that the construction of an expression vector is successful, and marking the bacterial colonies as GS15/rGPBB engineering bacteria;

③ expression and purification of recombinant human GPBB:

carrying out shake culture on the sequenced GPBB positive bacteria in a BMGY culture medium under the conditions of 28 ℃ and 250r/min until OD600 is 2-6, and centrifuging to collect bacteria; resuspending the thallus with BMMY culture medium until OD600 is 1, continuing shake fermentation, and adding anhydrous methanol to the culture medium every 24h until the final concentration is 1%; culturing for 48h, terminating, centrifuging for 5min at the rotating speed of 12000rpm/min, and taking the supernatant to obtain a crude product of the target protein rGPBB;

adding the crude product of the target protein rGPBB into enterokinase, and carrying out enzyme digestion overnight in water bath at 23 ℃; after enzyme digestion, filtering the crude protein, passing through a GST affinity chromatography column, performing gradient Elution by using a first Elution buffer, and collecting an rGPBB peak; passing through a desalting column, replacing with a desalting column buffer solution, balancing the columns with Loading buffers respectively, Loading, performing gradient Elution with a second Elution buffer, and collecting the rGPBB peak; passing the obtained rGPBB through a molecular sieve chromatographic column, and collecting the rGPBB peak by using a third Elutionbuffer; wherein the formula of the first Elution buffer is as follows: 50mM Tris-Cl, 40mM reduced glutathione, pH 7.0; the formula of the desalting column buffer solution is as follows: 50mM Tris-Cl, pH 9.0; the formula of the Loadingbuffer comprises the following components: 50mM Tris-Cl, pH 7.0; the formula of the second Elution buffer is as follows: 50mM Tris-Cl, 1M NaCl, pH 7.0; the formula of the third Elution buffer is as follows: 50mM Na₂HPO₄，0.15M NaCl，pH7.0；

Using a GPBB antibody as a first antibody, using goat anti-rabbit IgG marked by HRP as a second antibody as WB, and when the collected rGPBB protein sample has a positive band at a position of 110kD, indicating that the rGPBB obtained after purification is the recombinant human GPBB protein required by the target; at this time, glycerol of 20% final concentration was added for aseptic packaging and stored at-80 ℃ for further use.

As one of the preferable modes of the invention, the method for obtaining the latex microspheres coupled with the goat anti-human GPBB polyclonal antibody comprises the following steps: and coupling the goat anti-human GPBB polyclonal antibody to the polystyrene latex microspheres by using the polystyrene latex microspheres with the diameters of 30-60 nm and adopting a covalent coupling method.

In a preferred embodiment of the present invention, the method for preparing the goat anti-human GPBB polyclonal antibody comprises:

(1) preparation of recombinant human GPBB protein

① acquisition of human GPBB Gene:

with reference to GENBANK accession number NM _002862.4, adding a restriction enzyme site SnaB I at the upstream, adding a flexible linker to protect the spatial structure of a target fragment, and adding a restriction enzyme site Not I and a protective base at the downstream to obtain a gene sequence shown as SEQ ID No. 1; after obtaining the gene sequence, sending the gene sequence to a gene company for synthesis, and obtaining a target gene sequence after the sequencing is qualified;

② construction of expression vector:

carrying out double enzyme digestion on the synthesized gene and pPIC9K plasmid by using two endonucleases of SnaB I and Not I, connecting double enzyme digestion products by using ligase, electrically transducing the double enzyme digestion products into pichia pastoris competent cells, coating the pichia pastoris competent cells on a YPD plate containing 100mg/L Zeocin, carrying out constant temperature culture at 28 ℃ for 36h, selecting bacterial colonies growing on a resistance plate, sending the bacterial colonies to a gene sequencing identification target gene, identifying the bacterial colonies as positive after the coincidence degree is 99.99%, and indicating that the construction of an expression vector is successful, and marking the bacterial colonies as GS15/rGPBB engineering bacteria;

③ expression and purification of recombinant human GPBB:

carrying out shake culture on the sequenced GPBB positive bacteria in a BMGY culture medium under the conditions of 28 ℃ and 250r/min until OD600 is 2-6, and centrifuging to collect bacteria; resuspending the thallus with BMMY culture medium until OD600 is 1, continuing shake fermentation, and adding anhydrous methanol to the culture medium every 24h until the final concentration is 1%; culturing for 48h, terminating, centrifuging for 5min at the rotating speed of 12000rpm/min, and taking the supernatant to obtain a crude product of the target protein rGPBB;

adding the crude product of the target protein rGPBB into enterokinase, and carrying out enzyme digestion overnight in water bath at 23 ℃; after enzyme digestion, filtering the crude protein, passing through a GST affinity chromatography column, performing gradient Elution by using a first Elution buffer, and collecting an rGPBB peak; passing through a desalting column, replacing with a desalting column buffer solution, balancing the columns with Loading buffers respectively, Loading, performing gradient Elution with a second Elution buffer, and collecting the rGPBB peak; passing the obtained rGPBB through a molecular sieve chromatographic column, and collecting the rGPBB peak by using a third Elutionbuffer; wherein the formula of the first Elution buffer is as follows: 50mM Tris-Cl, 40mM reduced glutathione, pH 7.0; the desalting column buffer solutionThe formula of the composition is as follows: 50mM Tris-Cl, pH 9.0; the formula of the Loadingbuffer comprises the following components: 50mM Tris-Cl, pH 7.0; the formula of the second Elution buffer is as follows: 50mM Tris-Cl, 1M NaCl, pH 7.0; the formula of the third Elution buffer is as follows: 50mM Na₂HPO₄，0.15M NaCl，pH7.0；

Using a GPBB antibody as a first antibody, using goat anti-rabbit IgG marked by HRP as a second antibody as WB, and when the collected rGPBB protein sample has a positive band at a position of 110kD, indicating that the rGPBB obtained after purification is the recombinant human GPBB protein required by the target; at this time, adding glycerol with 20% of final concentration, aseptically packaging, and storing at-80 deg.C for use;

(2) obtaining of goat anti-human GPBB polyclonal antibody

① goat immunization:

selecting 7-month-old female goats with the weight of 40-50 kg; 1mL of rGPBB with the concentration of 5mg/mL is taken and emulsified by Freund's complete adjuvant, and each goat is injected with 2mL of emulsified rGPBB in four hoofs for the first immunization; after 7 days, a second immunization was performed with complete freund adjuvant emulsified rgbbb, and the immunization protocol was as before; after 21 days, a third immunization was performed with rgbbb emulsified in freund's incomplete adjuvant, and the immunization protocol was as before; after 42 days, a fourth immunization was performed with the Freund's incomplete adjuvant emulsified rGPBB, and the immunization protocol was as before; after 49 days, a fifth immunization was performed by intravenous injection of 2mL of 2.5mg/mL rGPBB into the ear margin; taking auricular vein blood at 55 days, measuring the antibody titer by using an agar double diffusion method, measuring the titer to be 1:32 or more, and stopping the immunity; obtaining whole blood by adopting a neck vein sterile bloodletting method;

② purification of polyclonal antibodies:

cutting the whole blood obtained in the step at room temperature, standing for 2 hours, and taking the supernatant to obtain crude serum; centrifuging the crude serum at 4 deg.C and 3000r/min for 15min, adding equal volume of PBS, mixing to obtain mixed solution, slowly adding saturated ammonium sulfate of the same volume into the mixed solution, and standing at 4 deg.C for 5 hr; centrifuging at 4 deg.C and 4200r/min for 30min, discarding supernatant, dissolving precipitate with 200mL PBS, adding 33% saturated ammonium sulfate, standing at 4 deg.C for 3 hr, and centrifuging at 4 deg.C and 4200r/min for 30 min; at this time, the supernatant was discarded, and the precipitate was dissolved in 200mL of PBS, and saturated ammonium sulfate was added in an amount of 33% of the total volume, and after standing at 4 ℃ for 3 hours, the mixture was centrifuged at 4 ℃ at 4200r/min for 30 minutes; the pellet after centrifugation was dissolved with 200ml PBS and further packed into a 10kD dialysis bag; finally, placing the goat anti-human GPBB polyclonal antibody in an environment at 4 ℃, dialyzing by using PBS dialysate with 20 times of volume for 6h to remove salt to obtain the goat anti-human GPBB polyclonal antibody;

③ validation of polyclonal antibodies:

the rGPBB prepared above is used as an antigen, the goat anti-human GPBB polyclonal antibody prepared above is used as a first antibody, the donkey anti-goat IgG labeled with HRP is used as a second antibody to prepare WB, and the antigen has a positive band at a position of 110 kD; as the rGPBB has been subjected to commercial antibody verification and has no other tag protein, the polyclonal antibody is used for verifying that the rGPBB also has a positive band, which indicates that the goat anti-human polyclonal antibody is successfully prepared.

The preparation method of the GPBB latex enhanced turbidimetry detection kit comprises the following steps:

(1) preparation of recombinant human GPBB protein

① acquisition of human GPBB Gene:

with reference to GENBANK accession number NM _002862.4, adding a restriction enzyme site SnaB I at the upstream, adding a flexible linker to protect the spatial structure of a target fragment, and adding a restriction enzyme site Not I and a protective base at the downstream to obtain a gene sequence shown as SEQ ID No. 1; after obtaining the gene sequence, sending the gene sequence to a gene company for synthesis, and obtaining a target gene sequence after the sequencing is qualified;

② construction of expression vector:

carrying out double enzyme digestion on the synthesized gene and pPIC9K plasmid by using two endonucleases of SnaB I and Not I, connecting double enzyme digestion products by using ligase, electrically transducing the double enzyme digestion products into pichia pastoris competent cells, coating the pichia pastoris competent cells on a YPD plate containing 100mg/L Zeocin, carrying out constant temperature culture at 28 ℃ for 36h, selecting bacterial colonies growing on a resistance plate, sending the bacterial colonies to a gene sequencing identification target gene, identifying the bacterial colonies as positive after the coincidence degree is 99.99%, and indicating that the construction of an expression vector is successful, and marking the bacterial colonies as GS15/rGPBB engineering bacteria;

③ expression and purification of recombinant human GPBB:

carrying out shake culture on the sequenced GPBB positive bacteria in a BMGY culture medium under the conditions of 28 ℃ and 250r/min until OD600 is 2-6, and centrifuging to collect bacteria; resuspending the thallus with BMMY culture medium until OD600 is 1, continuing shake fermentation, and adding anhydrous methanol to the culture medium every 24h until the final concentration is 1%; culturing for 48h, terminating, centrifuging for 5min at the rotating speed of 12000rpm/min, and taking the supernatant to obtain a crude product of the target protein rGPBB;

adding the crude product of the target protein rGPBB into enterokinase, and carrying out enzyme digestion overnight in water bath at 23 ℃; after enzyme digestion, filtering the crude protein, passing through a GST affinity chromatography column, performing gradient Elution by using a first Elution buffer, and collecting an rGPBB peak; passing through a desalting column, replacing with a desalting column buffer solution, balancing the columns with Loading buffers respectively, Loading, performing gradient Elution with a second Elution buffer, and collecting the rGPBB peak; passing the obtained rGPBB through a molecular sieve chromatographic column, and collecting the rGPBB peak by using a third Elutionbuffer; wherein the formula of the first Elution buffer is as follows: 50mM Tris-Cl, 40mM reduced glutathione, pH 7.0; the formula of the desalting column buffer solution is as follows: 50mM Tris-Cl, pH 9.0; the formula of the Loadingbuffer comprises the following components: 50mM Tris-Cl, pH 7.0; the formula of the second Elution buffer is as follows: 50mM Tris-Cl, 1M NaCl, pH 7.0; the formula of the third Elution buffer is as follows: 50mM Na₂HPO₄，0.15M NaCl，pH7.0；

Using a GPBB antibody as a first antibody, using goat anti-rabbit IgG marked by HRP as a second antibody as WB, and when the collected rGPBB protein sample has a positive band at a position of 110kD, indicating that the rGPBB obtained after purification is the recombinant human GPBB protein required by the target; at this time, adding glycerol with 20% of final concentration, aseptically packaging, and storing at-80 deg.C for use;

(2) obtaining of goat anti-human GPBB polyclonal antibody

① goat immunization:

selecting 7-month-old female goats with the weight of 40-50 kg; 1mL of rGPBB with the concentration of 5mg/mL is taken and emulsified by Freund's complete adjuvant, and each goat is injected with 2mL of emulsified rGPBB in four hoofs for the first immunization; after 7 days, a second immunization was performed with complete freund adjuvant emulsified rgbbb, and the immunization protocol was as before; after 21 days, a third immunization was performed with rgbbb emulsified in freund's incomplete adjuvant, and the immunization protocol was as before; after 42 days, a fourth immunization was performed with the Freund's incomplete adjuvant emulsified rGPBB, and the immunization protocol was as before; after 49 days, a fifth immunization was performed by intravenous injection of 2mL of 2.5mg/mL rGPBB into the ear margin; taking auricular vein blood at 55 days, measuring the antibody titer by using an agar double diffusion method, measuring the titer to be 1:32 or more, and stopping the immunity; obtaining whole blood by adopting a neck vein sterile bloodletting method;

② purification of polyclonal antibodies:

cutting the whole blood obtained in the step at room temperature, standing for 2 hours, and taking the supernatant to obtain crude serum; centrifuging the crude serum at 4 deg.C and 3000r/min for 15min, adding equal volume of PBS, mixing to obtain mixed solution, slowly adding saturated ammonium sulfate of the same volume into the mixed solution, and standing at 4 deg.C for 5 hr; centrifuging at 4 deg.C and 4200r/min for 30min, discarding supernatant, dissolving precipitate with 200mL PBS, adding 33% saturated ammonium sulfate, standing at 4 deg.C for 3 hr, and centrifuging at 4 deg.C and 4200r/min for 30 min; at this time, the supernatant was discarded, and the precipitate was dissolved in 200mL of PBS, and saturated ammonium sulfate was added in an amount of 33% of the total volume, and after standing at 4 ℃ for 3 hours, the mixture was centrifuged at 4 ℃ at 4200r/min for 30 minutes; the pellet after centrifugation was dissolved with 200ml PBS and further packed into a 10kD dialysis bag; finally, placing the goat anti-human GPBB polyclonal antibody in an environment at 4 ℃, dialyzing by using PBS dialysate with 20 times of volume for 6h to remove salt to obtain the goat anti-human GPBB polyclonal antibody;

③ validation of polyclonal antibodies:

the rGPBB prepared above is used as an antigen, the goat anti-human GPBB polyclonal antibody prepared above is used as a first antibody, the donkey anti-goat IgG labeled with HRP is used as a second antibody to prepare WB, and the antigen has a positive band at a position of 110 kD; as the rGPBB has been subjected to commercial antibody verification and has no other tag protein, the polyclonal antibody is used for verifying that the rGPBB also has a positive band, which indicates that the goat anti-human polyclonal antibody is successfully prepared;

(3) preparation of latex microspheres coupled with goat anti-human GPBB polyclonal antibody

Coupling the goat anti-human GPBB polyclonal antibody prepared in the step (2) to polystyrene latex microspheres by using polystyrene latex microspheres with the diameter of 30-60 nm and adopting a covalent coupling method to obtain the target latex microspheres coupled with the goat anti-human GPBB polyclonal antibody;

(4) preparation of glycogen phosphorylase isoenzyme BB latex enhanced turbidimetry detection kit

① formulation R1:

according to the content of the R1 component, mixing the components in the same container, and uniformly mixing to obtain R1;

② formulation R2:

mixing the latex microspheres of the goat anti-human GPBB coupled polyclonal antibody prepared in the step (3) and the rest other component substances in the same container according to the component content of R2, and uniformly mixing to prepare R2;

③ formulation of GPBB calibrator:

the GPBB calibrator comprises the following components in corresponding content:

and (3) mixing the rGPBB prepared in the step (1) and the rest other components in the same container according to the component content of the GPBB calibrator, and uniformly mixing to prepare the GPBB calibrator.

A use method of the GPBB latex enhanced turbidimetry detection kit comprises the following specific steps:

(1) sucking 20 μ L of sample, adding 240 μ LR1, and incubating at 37 deg.C for 5 min;

(2) then 60 mu LR2 is added for mixing and fully reacting;

(3) reading a light absorption value A1 after 1min, reading a light absorption value A2 after 3min, and calculating delta A;

(4) the calibration method is 6-point calibration, a full-automatic biochemical analyzer is adopted for detection, and the concentrations of calibrators are respectively set as follows: 0.2, 4, 8, 16, 32 ng/mL; and (4) calculating the GPBB content in the sample according to the delta A according to the calibration value.

The kit consists of R1 and R2, wherein the R1 consists of buffer solution (PBS), surfactant (PEG6000),Stabilizers (BSA, NaCl, EDTA) and preservatives (NaN)₃) The R2 is prepared from buffer solution (PBS), surfactant (PEG6000, TX-100), stabilizer (BSA, NaCl, EDTA), and antiseptic (NaN)₃) And latex microspheres coupled with goat anti-human GPBB polyclonal antibodies.

Compared with the prior art, the invention has the advantages that:

(1) compared with an ELISA method, the reagent provided by the invention uses a latex enhanced immunotransmission turbidimetry method to measure glycogen phosphorylase isoenzyme BB, and the detection signal magnification improves the detection sensitivity; moreover, the method can be used for a full-automatic biochemical analyzer, is more time-saving compared with a full-automatic ELISA (enzyme-linked immunosorbent assay) instrument, and is more flexible in one-time detection sample amount compared with an ELISA method;

(2) compared with a near infrared fluorescence method, the reagent is used for a full-automatic biochemical analyzer, additional instrument and equipment are not needed, the cost is low, the automation is high, the detection time is saved, and the operation is simple and convenient;

(3) compared with a colloidal gold method, the reagent disclosed by the invention can realize quantitative detection, has higher clinical detection value than qualitative detection, has higher specificity and sensitivity, and improves the clinical application value of glycogen phosphorylase isoenzyme BB detection.

Drawings

FIG. 1 is a graph showing the result of Western Blot identification of rGPBB protein in example 4 (in the figure, lane M: protein Marker 26616; lane 1: control of GPBB antibody (ab251810) from abcam, lane 2: sample after purification of recombinant human GPBB);

FIG. 2 is a graph showing the result of Western Blot analysis of the goat anti-human GPBB polyclonal antibody of example 4 (lane M: protein Marker 26616; lane 1: sample after purification of the polyclonal antibody);

FIG. 3 is a graph showing the linear relationship between the kit of the present invention and a commercial GPBB detection kit in example 6;

FIG. 4 is a linear range linear regression plot of the kit of the invention in example 6.

Detailed Description

The following examples are given for the detailed implementation and specific operation of the present invention, but the scope of the present invention is not limited to the following examples.

Example 1

The GPBB latex enhanced turbidimetry detection kit of the embodiment comprises independent R1 and R2 double liquid components, and comprises the following components in corresponding content:

R1：

R2：

in addition, the GPBB calibrator is also included, and the components and corresponding contents are as follows:

further, the rgbbb in the GPBB calibrator is specifically recombinant human GPBB protein (preparation method see example 4).

Further, the method for obtaining the latex microspheres coupled with the goat anti-human GPBB polyclonal antibody in the R2 comprises the following steps: polystyrene latex microspheres with the diameter of 30-60 nm are used, and a goat anti-human GPBB polyclonal antibody (the preparation method is shown in example 4) is coupled to the polystyrene latex microspheres by a covalent coupling method.

Example 2

The GPBB latex enhanced turbidimetry detection kit of the embodiment comprises independent R1 and R2 double liquid components, and comprises the following components in corresponding content:

R1：

R2：

in addition, the GPBB calibrator is also included, and the components and corresponding contents are as follows:

further, the rgbbb in the GPBB calibrator is specifically recombinant human GPBB protein (preparation method see example 4).

Further, the method for obtaining the latex microspheres coupled with the goat anti-human GPBB polyclonal antibody in the R2 comprises the following steps: polystyrene latex microspheres with the diameter of 30-60 nm are used, and a goat anti-human GPBB polyclonal antibody (the preparation method is shown in example 4) is coupled to the polystyrene latex microspheres by a covalent coupling method.

Example 3

The GPBB latex enhanced turbidimetry detection kit of the embodiment comprises independent R1 and R2 double liquid components, and comprises the following components in corresponding content:

R1：

R2：

in addition, the GPBB calibrator is also included, and the components and corresponding contents are as follows:

further, the rgbbb in the GPBB calibrator is specifically recombinant human GPBB protein (preparation method see example 4).

Further, the method for obtaining the latex microspheres coupled with the goat anti-human GPBB polyclonal antibody in the R2 comprises the following steps: polystyrene latex microspheres with the diameter of 30-60 nm are used, and a goat anti-human GPBB polyclonal antibody (the preparation method is shown in example 4) is coupled to the polystyrene latex microspheres by a covalent coupling method.

Example 4

This example is a method for preparing the GPBB latex enhanced turbidimetry assay kit of examples 1-3, which includes the following steps:

(1) preparation of recombinant human GPBB protein

① acquisition of human GPBB Gene:

with reference to GENBANK accession number NM _002862.4, adding a restriction enzyme site SnaB I at the upstream, adding a flexible linker to protect the spatial structure of a target fragment, and adding a restriction enzyme site Not I and a protective base at the downstream to obtain a gene sequence shown as SEQ ID No. 1; after obtaining the gene sequence, sending the gene sequence to Huada Gene company for synthesis, and obtaining a target gene sequence after the sequencing is qualified;

② construction of expression vector:

carrying out double enzyme digestion on the synthesized gene and pPIC9K plasmid by using two endonucleases of SnaB I and Not I, connecting double enzyme digestion products by using ligase, electrically transducing the double enzyme digestion products into pichia pastoris competent cells, coating the pichia pastoris competent cells on a YPD plate containing 100mg/L Zeocin, carrying out constant temperature culture at 28 ℃ for 36h, selecting bacterial colonies growing on a resistance plate, sending the bacterial colonies to a gene sequencing identification target gene, identifying the bacterial colonies as positive after the coincidence degree is 99.99%, and indicating that the construction of an expression vector is successful, and marking the bacterial colonies as GS15/rGPBB engineering bacteria;

③ expression and purification of recombinant human GPBB:

carrying out shake culture on the sequenced GPBB positive bacteria in a BMGY culture medium under the conditions of 28 ℃ and 250r/min until OD600 is 2-6, and centrifuging to collect bacteria; resuspending the thallus with BMMY culture medium until OD600 is 1, continuing shake fermentation, and adding anhydrous methanol to the culture medium every 24h until the final concentration is 1%; culturing for 48h, terminating, centrifuging for 5min at the rotating speed of 12000rpm/min, and taking the supernatant to obtain a crude product of the target protein rGPBB;

adding enterokinase into the crude product of the target protein rGPBB, and heating at 23 deg.CEnzyme digestion is carried out overnight in water bath; after enzyme digestion, filtering the crude protein, passing through a GST affinity chromatography column, performing gradient Elution by using a first Elution buffer, and collecting an rGPBB peak; passing through a desalting column, replacing with a desalting column buffer solution, balancing the columns with Loading buffers respectively, Loading, performing gradient Elution with a second Elution buffer, and collecting the rGPBB peak; passing the obtained rGPBB through a molecular sieve chromatographic column, and collecting the rGPBB peak by using a third Elutionbuffer; wherein the formula of the first Elution buffer is as follows: 50mM Tris-Cl, 40mM reduced glutathione, pH 7.0; the formula of the desalting column buffer solution is as follows: 50mM Tris-Cl, pH 9.0; the formula of the Loadingbuffer comprises the following components: 50mM Tris-Cl, pH 7.0; the formula of the second Elution buffer is as follows: 50mM Tris-Cl, 1M NaCl, pH 7.0; the formula of the third Elution buffer is as follows: 50mM Na₂HPO₄，0.15M NaCl，pH7.0；

When the collected rGPBB protein sample has a positive band at the position of 110kD (shown in figure 1), the rGPBB obtained after purification is the recombinant human GPBB protein required by the target; at this time, glycerol of 20% final concentration was added for aseptic packaging and stored at-80 ℃ for further use.

(2) Obtaining of goat anti-human GPBB polyclonal antibody

① goat immunization:

selecting 7-month-old female goats with the weight of 40-50 kg; 1mL of rGPBB with the concentration of 5mg/mL is taken and emulsified by Freund's complete adjuvant, and each goat is injected with 2mL of emulsified rGPBB in four hoofs for the first immunization; after 7 days, a second immunization was performed with complete freund adjuvant emulsified rgbbb, and the immunization protocol was as before; after 21 days, a third immunization was performed with rgbbb emulsified in freund's incomplete adjuvant, and the immunization protocol was as before; after 42 days, a fourth immunization was performed with the Freund's incomplete adjuvant emulsified rGPBB, and the immunization protocol was as before; after 49 days, a fifth immunization was performed by intravenous injection of 2mL of 2.5mg/mL rGPBB into the ear margin; taking auricular vein blood at 55 days, measuring the antibody titer by using an agar double diffusion method, measuring the titer to be 1:32 or more, and stopping the immunity; obtaining whole blood by adopting a neck vein sterile bloodletting method;

② purification of polyclonal antibodies:

cutting the whole blood obtained in the step at room temperature, standing for 2 hours, and taking the supernatant to obtain crude serum; centrifuging the crude serum at 4 deg.C and 3000r/min for 15min, adding equal volume of PBS, mixing to obtain mixed solution, slowly adding saturated ammonium sulfate of the same volume into the mixed solution, and standing at 4 deg.C for 5 hr; centrifuging at 4 deg.C and 4200r/min for 30min, discarding supernatant, dissolving precipitate with 200mL PBS, adding 33% saturated ammonium sulfate, standing at 4 deg.C for 3 hr, and centrifuging at 4 deg.C and 4200r/min for 30 min; at this time, the supernatant was discarded, and the precipitate was dissolved in 200mL of PBS, and saturated ammonium sulfate was added in an amount of 33% of the total volume, and after standing at 4 ℃ for 3 hours, the mixture was centrifuged at 4 ℃ at 4200r/min for 30 minutes; the pellet after centrifugation was dissolved with 200ml PBS and further packed into a 10kD dialysis bag; finally, placing the goat anti-human GPBB polyclonal antibody in an environment at 4 ℃, dialyzing by using PBS dialysate with 20 times of volume for 6h to remove salt to obtain the goat anti-human GPBB polyclonal antibody;

③ validation of polyclonal antibodies:

using the rGPBB prepared above as an antigen, the goat anti-human GPBB polyclonal antibody prepared above as a primary antibody, and donkey anti-goat IgG (HRP-labeled, ab6885) from abcam as a secondary antibody as WB, the antigen produced a positive band at 110kD (see FIG. 2); as the rGPBB has been subjected to commercial antibody verification and has no other tag protein, the polyclonal antibody is used for verifying that the rGPBB also has a positive band, which indicates that the goat anti-human polyclonal antibody is successfully prepared;

(3) preparation of latex microspheres coupled with goat anti-human GPBB polyclonal antibody

Coupling the goat anti-human GPBB polyclonal antibody prepared in the step (2) to polystyrene latex microspheres by using polystyrene latex microspheres with the diameter of 30-60 nm and adopting a covalent coupling method to obtain the target latex microspheres coupled with the goat anti-human GPBB polyclonal antibody;

(4) preparation of glycogen phosphorylase isoenzyme BB latex enhanced turbidimetry detection kit

① formulation R1:

according to the content of the R1 component, mixing the components in the same container, and uniformly mixing to obtain R1;

② formulation R2:

mixing the latex microspheres of the goat anti-human GPBB coupled polyclonal antibody prepared in the step (3) and the rest other component substances in the same container according to the component content of R2, and uniformly mixing to prepare R2;

③ formulation of GPBB calibrator:

and (3) mixing the rGPBB prepared in the step (1) and the rest other components in the same container according to the component content of the GPBB calibrator, and uniformly mixing to prepare the GPBB calibrator.

Example 5

This example is a method of determining the GPBB latex enhanced turbidimetry assay kit of examples 1-3 above:

the analysis method comprises the following steps: a two-point end-point method;

the reaction direction is as follows: raising reaction;

the calibration method comprises the following steps: Logit-Log (5P);

measuring wavelength: 600 nm;

measuring temperature: 37 ℃;

samples R1: R2: 20:240:60(μ L);

the testing steps are as follows: 20 μ L of the sample was aspirated, 240 μ LR1 was added, incubation was performed at 37 ℃ for 5min, 60 μ LR2 was added, absorbance A1 was read after 1min, absorbance A2 was read after 3min, and Δ A was calculated.

The calibration method comprises the following steps: 6 point calibration, adopting a Beckman AU680 full-automatic biochemical analyzer (or other brands and models), detecting, and setting the concentrations of the calibrators as follows: 0.2, 4, 8, 16, 32 ng/mL.

And calculating the GPBB content in the sample according to the delta A according to the calibration value.

Example 6

This example is used to evaluate the GPBB latex enhanced turbidimetry assay kit of the above examples:

(1) linear correlation verification

The reagent prepared by the formula of the example 1 is compared with a GPBB ELISA detection kit of a certain marketed company approved by the State food and drug administrationThe test results are shown in table 1 below, a correlation curve between the kit of the present invention and GPBB ELISA detection reagents sold in some companies on the market is obtained (see fig. 3), and the linear correlation curve of the two kits is shown as y ═ 0.9109x +0.2044, and the correlation coefficient R is shown as²0.8122, the two have a larger correlation.

TABLE 1 comparison of the linear correlation between the kit of the present invention and a commercially available GPBB detection kit

(2) Linear range verification

The recombinant GPBB purified product and physiological saline are used for preparing test products with the concentrations of 100ng/mL, 50ng/mL, 25ng/mL, 12.5ng/mL, 6.25ng/mL and 0ng/mL (physiological saline control), the concentration of each test product is measured by using the kit disclosed by the invention, a linear regression equation is obtained by using the dilution concentration as an independent variable and the measurement result as a dependent variable, the relative deviation of the measurement result is calculated, and the calculation result is shown in Table 2. The results show that the linear regression equation between the assay and the diluted concentration is y-0.9971 x +0.1254, see fig. 4. Coefficient of correlation R²The linear relation is good when the value is 0.9998, and the linear range can reach 100 ng/mL.

Table 2 validation of the linear range of the reagents of the invention

(3) Accuracy verification

And taking one portion of traceable high-value serum quality control and one portion of traceable low-value serum quality control, detecting for 6 times by using the kit, taking a mean value, and comparing with a quality control target value. The results show that the detection values have smaller relative deviation and higher accuracy than the target values, which are shown in Table 3.

Accuracy verification results of the kit described in Table 3

(4) Precision verification

Taking high value and low value of clinical serum samples detected by the kit on sale, continuously detecting the same serum sample for 10 times by using the kit, and calculating the coefficient of variation of the kit. The precision detection data are shown in the following table 4, and the detection result shows that the variation coefficients of the kit are smaller and respectively 3.36% and 4.70% when the kit detects high-value samples and low-value samples, and the precision is better.

Precision verification results of the kit shown in Table 4

Detection value 1	Detection value 2	Detection value 3	Detection value 4	Detection value 5
					6.29	5.94	5.91	5.98	5.95
0.96	0.93	1.00	1.09	1.02
					Detection value 6	Detection value 7	Detection value 8	Detection value 9	Detection value 10
5.64	5.61	6.06	5.90	5.78
					1.02	0.99	1.04	1.02	1.07
Mean value of detection	Standard deviation of	Coefficient of variation
					5.906	0.1983	3.36％
1.014	0.0476	4.70％

(5) Verification of sensitivity and specificity

Selecting 50 positive serums (abnormal serums) for diagnosing AMI diseases and 50 negative serums of healthy patients, selecting a commercial ELISA GPBB detection kit to synchronously detect the 100 serum samples with the kit, setting the standard value higher than a reference standard as positive and the standard value lower than the reference standard as negative according to the judgment standard of each kit, calculating the sensitivity and specificity of each kit, and obtaining the result shown in Table 5. The result shows that the kit has higher sensitivity and specificity compared with the commercial ELISA kit. The invention has the outstanding advantages that compared with an ELISA detection kit, the kit has higher sensitivity and specificity, thereby greatly improving the accuracy of clinical detection, and the reagent has lower cost, can use a full-automatic biochemical analyzer for detection, and can greatly meet the requirement of clinical detection.

Table 5 compares the sensitivity and specificity of the kit with those of commercially available detection reagents

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.

SEQUENCE LISTING

<110> Daqian bioengineering Co., Ltd, Anhui

<120> GPBB latex enhanced turbidimetry detection kit and preparation and use methods thereof

<130>2019

<160>1

<170>PatentIn version 3.3

<210>1

<211>2591

<212>DNA

<213> Artificial sequence

<400>1

tacgtaggtg gtggtggttc cggtggtggt ggttccggtg gtggtggttc catggcgaag 60

ccgctgacgg acagcgagaa gcggaagcag atcagcgtgc gcggcctggc ggggctaggc 120

gacgtggccg aggtgcggaa gagcttcaac cggcacttgc acttcacgct ggtcaaggac 180

cgcaatgtgg ccacgccccg cgactacttc ttcgcgctgg cgcacacggt gcgcgaccac 240

ctcgtgggcc gctggatccg cacgcagcag cactactacg agcgcgaccc caagcgcatt 300

tattatcttt ccctggaatt ctacatgggt cgcacgctgc agaacacgat ggtgaacctg 360

ggccttcaga atgcctgcga tgaagccatc tatcagttgg ggttagactt ggaggaactc 420

gaggagatag aagaagatgc tggccttggg aatggaggcc tggggaggct ggcagcgtgt 480

ttccttgact caatggctac cttgggcctg gcagcatacg gctatggaat ccgctatgaa 540

tttgggattt ttaaccagaa gattgtcaat ggctggcagg tagaggaggc cgatgactgg 600

ctgcgctacg gcaacccctg ggagaaagcg cggcctgagt atatgcttcc cgtgcacttc 660

tacggacgcg tggagcacac ccccgacggc gtgaagtggc tggacacaca ggtggtgctg 720

gccatgccct acgacacccc agtgcccggc tacaagaaca acaccgtcaa caccatgcgg 780

ctgtggtccg ccaaggctcc caacgacttc aagctgcagg acttcaacgt gggagactac 840

atcgaggcgg tcctggaccg gaacttggct gagaacatct ccagggtcct gtatccaaat 900

gataacttct ttgaggggaa ggagctgcgg ctgaagcagg agtacttcgt ggtggccgcc 960

acgctccagg acatcatccg ccgcttcaag tcgtccaagt tcggctgccg ggaccctgtg 1020

agaacctgtt tcgagacgtt cccagacaag gtggccatcc agctgaacga cacccacccc 1080

gccctctcca tccctgagct catgcggatc ctggtggacg tggagaaggt ggactgggac 1140

aaggcctggg aaatcacgaa gaagacctgt gcatacacca accacactgt gctgcctgag 1200

gccttggagc gctggcccgt gtccatgttt gagaagctgc tgccgcggca cctggagata 1260

atctatgcca tcaaccagcg gcacctggac cacgtggccg cgctgtttcc cggcgatgtg 1320

gaccgcctgc gcaggatgtc tgtgatcgag gagggggact gcaagcggat caacatggcc 1380

cacctgtgtg tgattgggtc ccatgctgtc aatggtgtgg cgaggatcca ctcggagatc 1440

gtgaaacagt cggtctttaa ggatttttat gaactggagc cagagaagtt ccagaataag 1500

accaatggca tcaccccccg ccggtggctg ctgctgtgca acccggggct ggccgatacc 1560

atcgtggaga aaattgggga ggagttcctg actgacctga gccagctgaa gaagctgctg 1620

ccgctggtca gtgacgaggt gttcatcagg gacgtggcca aggtcaaaca ggagaacaag 1680

ctcaagttct cggccttcct ggagaaggag tacaaggtga agatcaaccc ctcctccatg 1740

ttcgatgtgc atgtgaagag gatccacgag tacaagcggc agctgctcaa ctgcctgcac 1800

gtcgtcaccc tgtacaatcg aatcaagaga gacccggcca aggcttttgt gcccaggact 1860

gttatgattg ggggcaaggc agcgcccggt taccacatgg ccaagctgat catcaagttg 1920

gtcacctcca tcggcgacgt cgtcaatcat gacccagttgtgggtgacag gttgaaagtg 1980

atcttcctgg agaactaccg tgtgtccttg gctgagaaag tgatcccggc cgctgatctg 2040

tcgcagcaga tctccactgc aggcaccgag gcctcaggca caggcaacat gaagttcatg 2100

ctcaacgggg ccctcaccat cggcaccatg gacggcgcca acgtggagat ggccgaggag 2160

gccggggccg agaacctctt catcttcggc ctgcgggtgg aggatgtcga ggccttggac 2220

cggaaagggt acaatgccag ggagtactac gaccacctgc ccgagctgaa gcaggccgtg 2280

gaccagatca gcagtggctt tttttctccc aaggagccag actgcttcaa ggacatcgtg 2340

aacatgctga tgcaccatga caggttcaag gtgtttgcag actatgaagc ctacatgcag 2400

tgccaggcac aggtggacca gctgtaccgg aaccccaagg agtggaccaa gaaggtcatc 2460

aggaacatcg cctgctcggg caagttctcc agtgaccgga ccatcacgga gtatgcacgg 2520

gagatctggg gtgtggagcc ctccgacctg cagatcccgc cccccaacat cccccgggac 2580

tagccggccg c 2591

Claims (9)

1. A GPBB latex enhanced turbidimetry detection kit is characterized by comprising independent R1 and R2 double liquid components, and the components and corresponding contents are as follows:

R1：

R2：

2. the GPBB latex-enhanced turbidimetry detection kit of claim 1, characterized by comprising the following components and corresponding contents:

R1：

R2：

3. the GPBB latex-enhanced turbidimetry detection kit of claim 1, further comprising a GPBB calibrator comprising the following components and corresponding contents:

4. the GPBB latex enhanced turbidimetry detection kit of claim 3, wherein the GPBB calibrator comprises the following components in parts by weight:

5. the GPBB latex enhanced turbidimetry detection kit of claim 3, wherein the rGPBB in the GPBB calibrator is specifically a recombinant human GPBB protein, and the obtaining method is specifically as follows:

① acquisition of human GPBB Gene:

with reference to GENBANK accession number NM _002862.4, adding a restriction enzyme site SnaB I at the upstream, adding a flexible linker to protect the spatial structure of a target fragment, and adding a restriction enzyme site Not I and a protective base at the downstream to obtain a gene sequence shown as SEQ ID No. 1; after obtaining the gene sequence, sending the gene sequence to a gene company for synthesis, and obtaining a target gene sequence after the sequencing is qualified;

② construction of expression vector:

carrying out double enzyme digestion on the synthesized gene and pPIC9K plasmid by using two endonucleases of SnaB I and Not I, connecting double enzyme digestion products by using ligase, electrically transducing the double enzyme digestion products into pichia pastoris competent cells, coating the pichia pastoris competent cells on a YPD plate containing 100mg/L Zeocin, carrying out constant temperature culture at 28 ℃ for 36h, selecting bacterial colonies growing on a resistance plate, sending the bacterial colonies to a gene sequencing identification target gene, identifying the bacterial colonies as positive after the coincidence degree is 99.99%, and indicating that the construction of an expression vector is successful, and marking the bacterial colonies as GS15/rGPBB engineering bacteria;

③ expression and purification of recombinant human GPBB:

carrying out shake culture on the sequenced GPBB positive bacteria in a BMGY culture medium under the conditions of 28 ℃ and 250r/min until OD600 is 2-6, and centrifuging to collect bacteria; resuspending the thallus with BMMY culture medium until OD600 is 1, continuing shake fermentation, and adding anhydrous methanol to the culture medium every 24h until the final concentration is 1%; culturing for 48h, terminating, centrifuging for 5min at the rotating speed of 12000rpm/min, and taking the supernatant to obtain a crude product of the target protein rGPBB;

adding the crude product of the target protein rGPBB into enterokinase, and carrying out enzyme digestion overnight in water bath at 23 ℃; after enzyme digestion, filtering the crude protein, passing through a GST affinity chromatography column, performing gradient Elution by using a first Elution buffer, and collecting an rGPBB peak; passing through a desalting column, replacing with a desalting column buffer solution, balancing the columns with a Loading buffer respectively, Loading, performing gradient elution with a second Elutionbuffer, and collecting the rGPBB peak; passing the obtained rGPBB through a molecular sieve chromatographic column, and collecting an rGPBB peak by using a third Elution buffer; wherein the formula of the first Elution buffer is as follows: 50mM Tris-Cl, 40mM reduced glutathione, pH 7.0; the formula of the desalting column buffer solution is as follows: 50mM Tris-Cl, pH 9.0; the formula of the Loading buffer comprises: 50mM Tris-Cl, pH 7.0; the formula of the second Elution buffer is as follows: 50mM Tris-Cl, 1M NaCl, pH 7.0; the formula of the third Elution buffer is as follows: 50mM Na₂HPO₄，0.15M NaCl，pH7.0；

Using a GPBB antibody as a first antibody, using goat anti-rabbit IgG marked by HRP as a second antibody as WB, and when the collected rGPBB protein sample has a positive band at a position of 110kD, indicating that the rGPBB obtained after purification is the recombinant human GPBB protein required by the target; at this time, glycerol of 20% final concentration was added for aseptic packaging and stored at-80 ℃ for further use.

6. The GPBB latex enhanced turbidimetry detection kit of any one of claims 1 to 5, wherein the latex microspheres coupled with the goat anti-human GPBB polyclonal antibody are obtained by a method comprising: and coupling the goat anti-human GPBB polyclonal antibody to the polystyrene latex microspheres by using the polystyrene latex microspheres with the diameters of 30-60 nm and adopting a covalent coupling method.

7. The GPBB latex-enhanced turbidimetry detection kit of claim 6, wherein the goat anti-human GPBB polyclonal antibody is prepared by the following method:

(1) preparation of recombinant human GPBB protein

① acquisition of human GPBB Gene:

with reference to GENBANK accession number NM _002862.4, adding a restriction enzyme site SnaB I at the upstream, adding a flexible linker to protect the spatial structure of a target fragment, and adding a restriction enzyme site Not I and a protective base at the downstream to obtain a gene sequence shown as SEQ ID No. 1; after obtaining the gene sequence, sending the gene sequence to a gene company for synthesis, and obtaining a target gene sequence after the sequencing is qualified;

② construction of expression vector:

carrying out double enzyme digestion on the synthesized gene and pPIC9K plasmid by using two endonucleases of SnaB I and Not I, connecting double enzyme digestion products by using ligase, electrically transducing the double enzyme digestion products into pichia pastoris competent cells, coating the pichia pastoris competent cells on a YPD plate containing 100mg/L Zeocin, carrying out constant temperature culture at 28 ℃ for 36h, selecting bacterial colonies growing on a resistance plate, sending the bacterial colonies to a gene sequencing identification target gene, identifying the bacterial colonies as positive after the coincidence degree is 99.99%, and indicating that the construction of an expression vector is successful, and marking the bacterial colonies as GS15/rGPBB engineering bacteria;

③ expression and purification of recombinant human GPBB:

carrying out shake culture on the sequenced GPBB positive bacteria in a BMGY culture medium under the conditions of 28 ℃ and 250r/min until OD600 is 2-6, and centrifuging to collect bacteria; resuspending the thallus with BMMY culture medium until OD600 is 1, continuing shake fermentation, and adding anhydrous methanol to the culture medium every 24h until the final concentration is 1%; culturing for 48h, terminating, centrifuging for 5min at the rotating speed of 12000rpm/min, and taking the supernatant to obtain a crude product of the target protein rGPBB;

will be at the topAdding enterokinase into the crude product of the target protein rGPBB, and performing enzyme digestion overnight in water bath at 23 ℃; after enzyme digestion, filtering the crude protein, passing through a GST affinity chromatography column, performing gradient Elution by using a first Elution buffer, and collecting an rGPBB peak; passing through a desalting column, replacing with a desalting column buffer solution, balancing the columns with a Loading buffer respectively, Loading, performing gradient elution with a second Elutionbuffer, and collecting the rGPBB peak; passing the obtained rGPBB through a molecular sieve chromatographic column, and collecting an rGPBB peak by using a third Elution buffer; wherein the formula of the first Elution buffer is as follows: 50mM Tris-Cl, 40mM reduced glutathione, pH 7.0; the formula of the desalting column buffer solution is as follows: 50mM Tris-Cl, pH 9.0; the formula of the Loading buffer comprises: 50mM Tris-Cl, pH 7.0; the formula of the second Elution buffer is as follows: 50mM Tris-Cl, 1M NaCl, pH 7.0; the formula of the third Elution buffer is as follows: 50mM Na₂HPO₄，0.15M NaCl，pH7.0；

Using a GPBB antibody as a first antibody, using goat anti-rabbit IgG marked by HRP as a second antibody as WB, and when the collected rGPBB protein sample has a positive band at a position of 110kD, indicating that the rGPBB obtained after purification is the recombinant human GPBB protein required by the target; at this time, adding glycerol with 20% of final concentration, aseptically packaging, and storing at-80 deg.C for use;

(2) obtaining of goat anti-human GPBB polyclonal antibody

① goat immunization:

selecting 7-month-old female goats with the weight of 40-50 kg; 1mL of rGPBB with the concentration of 5mg/mL is taken and emulsified by Freund's complete adjuvant, and each goat is injected with 2mL of emulsified rGPBB in four hoofs for the first immunization; after 7 days, a second immunization was performed with complete freund adjuvant emulsified rgbbb, and the immunization protocol was as before; after 21 days, a third immunization was performed with rgbbb emulsified in freund's incomplete adjuvant, and the immunization protocol was as before; after 42 days, a fourth immunization was performed with the Freund's incomplete adjuvant emulsified rGPBB, and the immunization protocol was as before; after 49 days, a fifth immunization was performed by intravenous injection of 2mL of 2.5mg/mL rGPBB into the ear margin; taking auricular vein blood at 55 days, measuring the antibody titer by using an agar double diffusion method, measuring the titer to be 1:32 or more, and stopping the immunity; obtaining whole blood by adopting a neck vein sterile bloodletting method;

② purification of polyclonal antibodies:

cutting the whole blood obtained in the step at room temperature, standing for 2 hours, and taking the supernatant to obtain crude serum; centrifuging the crude serum at 4 deg.C and 3000r/min for 15min, adding equal volume of PBS, mixing to obtain mixed solution, slowly adding saturated ammonium sulfate of the same volume into the mixed solution, and standing at 4 deg.C for 5 hr; centrifuging at 4 deg.C and 4200r/min for 30min, discarding supernatant, dissolving precipitate with 200mL PBS, adding 33% saturated ammonium sulfate, standing at 4 deg.C for 3 hr, and centrifuging at 4 deg.C and 4200r/min for 30 min; at this time, the supernatant was discarded, and the precipitate was dissolved in 200mL of PBS, and saturated ammonium sulfate was added in an amount of 33% of the total volume, and after standing at 4 ℃ for 3 hours, the mixture was centrifuged at 4 ℃ at 4200r/min for 30 minutes; the pellet after centrifugation was dissolved in 200mL PBS and further filled into a 10kD dialysis bag; finally, placing the goat anti-human GPBB polyclonal antibody in an environment at 4 ℃, dialyzing by using PBS dialysate with 20 times of volume for 6h to remove salt to obtain the goat anti-human GPBB polyclonal antibody;

③ validation of polyclonal antibodies:

using the prepared rGPBB as an antigen, the prepared goat anti-human GPBB polyclonal antibody as a first antibody, using an HRP-labeled donkey anti-goat IgG as a second antibody as WB, and generating a positive band at a position of 110 kD; as the rGPBB has been subjected to commercial antibody verification and has no other tag protein, the polyclonal antibody is used for verifying that the rGPBB also has a positive band, which indicates that the goat anti-human polyclonal antibody is successfully prepared.

8. A method of making the GPBB latex-enhanced turbidimetry assay kit of any of claims 1-7, comprising the steps of:

(1) preparation of recombinant human GPBB protein

① acquisition of human GPBB Gene:

with reference to GENBANK accession number NM _002862.4, adding a restriction enzyme site SnaB I at the upstream, adding a flexible linker to protect the spatial structure of a target fragment, and adding a restriction enzyme site Not I and a protective base at the downstream to obtain a gene sequence shown as SEQ ID No. 1; after obtaining the gene sequence, sending the gene sequence to a gene company for synthesis, and obtaining a target gene sequence after the sequencing is qualified;

② construction of expression vector:

carrying out double enzyme digestion on the synthesized gene and pPIC9K plasmid by using two endonucleases of SnaB I and Not I, connecting double enzyme digestion products by using ligase, electrically transducing the double enzyme digestion products into pichia pastoris competent cells, coating the pichia pastoris competent cells on a YPD plate containing 100mg/L Zeocin, carrying out constant temperature culture at 28 ℃ for 36h, selecting bacterial colonies growing on a resistance plate, sending the bacterial colonies to a gene sequencing identification target gene, identifying the bacterial colonies as positive after the coincidence degree is 99.99%, and indicating that the construction of an expression vector is successful, and marking the bacterial colonies as GS15/rGPBB engineering bacteria;

③ expression and purification of recombinant human GPBB:

carrying out shake culture on the sequenced GPBB positive bacteria in a BMGY culture medium under the conditions of 28 ℃ and 250r/min until OD600 is 2-6, and centrifuging to collect bacteria; resuspending the thallus with BMMY culture medium until OD600 is 1, continuing shake fermentation, and adding anhydrous methanol to the culture medium every 24h until the final concentration is 1%; culturing for 48h, terminating, centrifuging for 5min at the rotating speed of 12000rpm/min, and taking the supernatant to obtain a crude product of the target protein rGPBB;

adding the crude product of the target protein rGPBB into enterokinase, and carrying out enzyme digestion overnight in water bath at 23 ℃; after enzyme digestion, filtering the crude protein, passing through a GST affinity chromatography column, performing gradient Elution by using a first Elution buffer, and collecting an rGPBB peak; passing through a desalting column, replacing with a desalting column buffer solution, balancing the columns with a Loading buffer respectively, Loading, performing gradient elution with a second Elutionbuffer, and collecting the rGPBB peak; passing the obtained rGPBB through a molecular sieve chromatographic column, and collecting an rGPBB peak by using a third Elution buffer; wherein the formula of the first Elution buffer is as follows: 50mM Tris-Cl, 40mM reduced glutathione, pH 7.0; the formula of the desalting column buffer solution is as follows: 50mM Tris-Cl, pH 9.0; the formula of the Loading buffer comprises: 50mM Tris-Cl, pH 7.0; the formula of the second Elution buffer is as follows: 50mM Tris-Cl, 1M NaCl, pH 7.0; the formula of the third Elution buffer is as follows: 50mM Na₂HPO₄，0.15M NaCl，pH7.0；

Using a GPBB antibody as a first antibody, using goat anti-rabbit IgG marked by HRP as a second antibody as WB, and when the collected rGPBB protein sample has a positive band at a position of 110kD, indicating that the rGPBB obtained after purification is the recombinant human GPBB protein required by the target; at this time, adding glycerol with 20% of final concentration, aseptically packaging, and storing at-80 deg.C for use;

(2) obtaining of goat anti-human GPBB polyclonal antibody

① goat immunization:

selecting 7-month-old female goats with the weight of 40-50 kg; 1mL of rGPBB with the concentration of 5mg/mL is taken and emulsified by Freund's complete adjuvant, and each goat is injected with 2mL of emulsified rGPBB in four hoofs for the first immunization; after 7 days, a second immunization with antigen emulsified in Freund's complete adjuvant was performed, the immunization protocol being as before; after 21 days, a third immunization was performed with rgbbb emulsified in freund's incomplete adjuvant, and the immunization protocol was as before; after 42 days, a fourth immunization was performed with the Freund's incomplete adjuvant emulsified rGPBB, and the immunization protocol was as before; after 49 days, a fifth immunization was performed by intravenous injection of 2mL of 2.5mg/mL rGPBB into the ear margin; taking auricular vein blood at 55 days, measuring the antibody titer by using an agar double diffusion method, measuring the titer to be 1:32 or more, and stopping the immunity; obtaining whole blood by adopting a neck vein sterile bloodletting method;

② purification of polyclonal antibodies:

cutting the whole blood obtained in the step at room temperature, standing for 2 hours, and taking the supernatant to obtain crude serum; centrifuging the crude serum at 4 deg.C and 3000r/min for 15min, adding equal volume of PBS, mixing to obtain mixed solution, slowly adding saturated ammonium sulfate of the same volume into the mixed solution, and standing at 4 deg.C for 5 hr; centrifuging at 4 deg.C and 4200r/min for 30min, discarding supernatant, dissolving precipitate with 200mL PBS, adding 33% saturated ammonium sulfate, standing at 4 deg.C for 3 hr, and centrifuging at 4 deg.C and 4200r/min for 30 min; at this time, the supernatant was discarded, and the precipitate was dissolved in 200mL of PBS, and saturated ammonium sulfate was added in an amount of 33% of the total volume, and after standing at 4 ℃ for 3 hours, the mixture was centrifuged at 4 ℃ at 4200r/min for 30 minutes; the pellet after centrifugation was dissolved in 200mL PBS and further filled into a 10kD dialysis bag; finally, placing the goat anti-human GPBB polyclonal antibody in an environment at 4 ℃, dialyzing by using PBS dialysate with 20 times of volume for 6h to remove salt to obtain the goat anti-human GPBB polyclonal antibody;

③ validation of polyclonal antibodies:

the rGPBB prepared above is used as an antigen, the goat anti-human GPBB polyclonal antibody prepared above is used as a first antibody, the donkey anti-goat IgG marked by HRP is used as a second antibody to prepare WB, and a positive band is generated at the 110kD position; as the rGPBB has been subjected to commercial antibody verification and has no other tag protein, the polyclonal antibody is used for verifying that the rGPBB also has a positive band, which indicates that the goat anti-human polyclonal antibody is successfully prepared;

(3) preparation of latex microspheres coupled with goat anti-human GPBB polyclonal antibody

Coupling the goat anti-human GPBB polyclonal antibody prepared in the step (2) to polystyrene latex microspheres by using polystyrene latex microspheres with the diameter of 30-60 nm and adopting a covalent coupling method to obtain the target latex microspheres coupled with the goat anti-human GPBB polyclonal antibody;

(4) preparation of glycogen phosphorylase isoenzyme BB latex enhanced turbidimetry detection kit

① formulation R1:

according to the content of the R1 component, mixing the components in the same container, and uniformly mixing to obtain R1;

② formulation R2:

mixing the latex microspheres of the goat anti-human GPBB coupled polyclonal antibody prepared in the step (3) and the rest other component substances in the same container according to the component content of R2, and uniformly mixing to prepare R2;

③ formulation of GPBB calibrator:

the GPBB calibrator comprises the following components in corresponding content:

and (3) mixing the rGPBB prepared in the step (1) and the rest other components in the same container according to the component content of the GPBB calibrator, and uniformly mixing to prepare the GPBB calibrator.

9. A method of using the GPBB latex-enhanced turbidimetry assay kit of any of claims 1-7, comprising the specific steps of:

(1) sucking 20 μ L of sample, adding 240 μ LR1, and incubating at 37 deg.C for 5 min;

(2) then 60 mu LR2 is added for mixing and fully reacting;

(3) reading a light absorption value A1 after 1min, reading a light absorption value A2 after 3min, and calculating delta A;

(4) the calibration method is 6-point calibration, a full-automatic biochemical analyzer is adopted for detection, and the concentrations of calibrators are respectively set as follows: 0.2, 4, 8, 16, 32 ng/mL; and (4) calculating the GPBB content in the sample according to the delta A according to the calibration value.

Images