CN111273028B

CN111273028B - rhTSG-6 direct competition ELISA quantitative detection kit and use method and application thereof

Info

Publication number: CN111273028B
Application number: CN202010116340.6A
Authority: CN
Inventors: 王明丽; 周炜; 何志远; 夏兵兵; 吴博; 蒋敏之
Original assignee: Wuhu Tianming Biotechnology Co ltd
Current assignee: Wuhu Tianming Biotechnology Co ltd
Priority date: 2020-02-25
Filing date: 2020-02-25
Publication date: 2023-03-28
Anticipated expiration: 2040-02-25
Also published as: CN111273028A

Abstract

The invention discloses a rhTSG-6 direct competition ELISA quantitative detection kit and a use method and application thereof, and the kit comprises an enzyme label plate coated with an anti-rhTSG-6 polyclonal antibody, an enzyme-labeled rhTSG-6 recombinant antigen, an rhTSG-6 protein standard, a sample diluent, a washing solution, a developing solution A, a developing solution B and a stop solution; by antigen-antibody specific reaction and based on enzyme immunity technology, methodology and commercialized kit for detecting rhTSG-6 in fermentation liquor, semi-finished product, finished product and tissue cell sample by direct quantitative competitive ELISA method are established and developed, and can be used for developing corresponding products and performing specific detection on clinical sample samples. The method has the advantages that the lowest detection limit can reach 1.1536ng/ml, the intra-batch difference is less than 5 percent, and the inter-batch difference is less than 10 percent; the recovery rate of the rhTSG-6 quantitative detection in the sample by using the kit and the corresponding method is between 90 and 110 percent, and the kit has important commercial development value for product quality control and clinical specimen detection of production enterprises.

Description

rhTSG-6 direct competition ELISA quantitative detection kit and use method and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a rhTSG-6 direct competition ELISA quantitative detection kit, and a use method and application thereof.

Background

Tumor necrosis factor alpha-stimulating gene 6 (TSG-6) is an inflammation-related secretory protein, is produced by the reaction of mesenchymal stem cells or stromal cells (MSCs) to inflammatory signals, and is highly expressed in a variety of inflammatory diseases or inflammatory-like pathological processes. It is known that TSG-6 mediates many immune regulation and tissue repair processes, has anti-inflammatory and tissue protective effects, and is a functional protein that is upregulated.

A large number of researches show that the TSG-6 protein has the functions of inhibiting the expression of inflammatory factors TNF-alpha, IL-1 beta, IL-6 and the like, inhibiting neutrophil infiltration and the like, and has stronger anti-inflammatory effect. With the progress of related research, the efficacy of TSG-6 protein has been gradually emphasized by the field of biological medicine. The invention discovers for the first time that recombinant human TSG-6 (recombinant human TSG-6, rhTSG-6) has antiviral activity in vitro and in vivo. And the rhTSG-6 direct competition ELISA quantitative detection kit is developed based on the discovery, and the blank in the field is filled.

Disclosure of Invention

The invention provides a rhTSG-6 direct competition ELISA quantitative detection kit, a using method and application thereof, and the kit has the characteristics of simplicity, rapidness, low cost, high accuracy and sensitivity and the like.

The technical scheme adopted by the invention is as follows:

a direct competition ELISA kit for recombinant human tumor necrosis factor alpha-induced protein 6 comprises an ELISA plate coated with an anti-rhTSG-6 polyclonal antibody, an enzyme-labeled rhTSG-6 recombinant antigen, an rhTSG-6 protein standard, a sample diluent, a washing solution, a developing solution A, a developing solution B and a stop solution.

The enzyme-labeled rhTSG-6 antigen is a rhTSG-6 recombinant antigen labeled by horseradish peroxidase.

The rhTSG-6 recombinant antigen gene SEQUENCE is shown as SEQUENCE LISTING 400 (2), which is obtained by performing codon optimization on the recombinant human TSG-6 gene shown as SEQUENCE LISTING 400 (1), wherein the Codon Adaptation Index (CAI) before optimization is 0.73, the CAI after optimization is 0.97, and the efficient expression of the recombinant human TSG-6 antigen protein can be realized by the codon optimization.

The rhTSG-6 recombinant antigen has the amino acid SEQUENCE shown in SEQ ID NO 400 (3).

The preparation method of the enzyme label plate coated with the anti-rhTSG-6 polyclonal antibody comprises the following steps: diluting the anti-rhTSG-6 polyclonal antibody by 0.05M carbonate buffer solution, coating the diluted antibody on an enzyme label plate, standing overnight at 4 ℃, sealing by 0.01mol/L phosphate buffer solution containing 10% by volume of calf serum and having pH of 7.0, washing, drying, filling into a packaging bag, and vacuumizing for storage.

The anti-rhTSG-6 polyclonal antibody is obtained by purifying antiserum obtained by immunizing Balb/c mice with rhTSG-6 recombinant antigen.

The rhTSG-6 protein standard is prepared by mixing rhTSG-6 recombinant antigen with a freeze-drying protective agent and freeze-drying.

The sample diluent is 0.01mol/L phosphate buffer solution with pH 7.0 and containing calf serum with volume fraction of 10%; the washing solution is a phosphate buffer solution containing 0.01mol/L of 0.05% Tween-20 by volume fraction in pH 7.0.

The developing solution A is a solution added with hydrogen peroxide; the color development liquid B is a solution added with tetramethyl benzidine (TMB); the stop solution is a 2mol/L sulfuric acid solution.

The invention also provides a use method of the recombinant human tumor necrosis factor alpha-induced protein 6 direct competition ELISA quantitative detection kit. The using method comprises the following steps:

(1) Diluting the rhTSG-6 protein standard substance into rhTSG-6 protein standard substance solutions with serial concentrations by using sample diluent;

(2) Respectively mixing the rhTSG-6 protein standard substance solution, the sample to be detected and the enzyme-labeled rhTSG-6 recombinant antigen in equal volume to obtain a mixed solution;

(3) Adding 100 mul of the mixed solution obtained in the step (2) into each hole of the enzyme label plate pre-coated with the anti-rhTSG-6 polyclonal antibody, and incubating for 30min at 37 ℃;

(4) Discarding the liquid in the plate, adding 200 mul/hole of washing liquid into each hole, washing for 5 times, and then patting dry;

(5) Adding 50 mul/hole of the color development liquid B, adding 50 mul/hole of the color development liquid A, tapping the plate frame to mix evenly, and reacting for 10min at room temperature in a dark place;

(6) The reaction was stopped by adding 50. Mu.l/well of stop buffer and the absorbance value at 450nm was immediately measured on a microplate reader.

(7) And drawing a standard curve by taking the negative logarithm of the concentration of the rhTSG-6 protein standard substance solution as a horizontal coordinate and the absorbance value as a vertical coordinate, solving a linear regression equation, and substituting the absorbance value in the hole of the sample to be detected into the standard curve to obtain the concentration of the rhTSG-6 in the sample to be detected.

The invention also provides a quantitative detection method of the recombinant human tumor necrosis factor alpha-induced protein 6, which utilizes the quantitative detection kit of the recombinant human tumor necrosis factor alpha-induced protein 6 by a direct competition ELISA method to carry out detection according to the using method.

The invention develops a direct competition ELISA method kit suitable for rhTSG-6 quantitative detection for the first time, improves the adaptation index of codons by carrying out codon optimization on rhTSG-6 genes in a gene library, can carry out rapid mass production with high efficiency by using prokaryotic expression, has high purity and low cost, and improves the yield of prokaryotic expression recombinant proteins by more than 100 times compared with the yield of prokaryotic expression recombinant proteins in the prior art; and purifying antiserum of a Balb/c mouse immunized by using the prepared rhTSG-6 recombinant antigen to obtain a highly specific and highly sensitive anti-rhTSG-6 polyclonal antibody; the antibody is coated on an enzyme label plate to detect rhTSG-6 in a specimen, and the method has the advantages of simplicity, convenience, rapidness, good stability and the like; the rhTSG-6 recombinant antigen labeled conjugate labeled by horseradish peroxidase is added with 50% of glycerol for storage, and the characteristics can be kept unchanged for 2 years at 4 ℃; the quality is stable.

The method is used for detecting the rhTSG-6 content in fermentation liquor, semi-finished products, finished products and tissue cell samples by establishing a direct quantitative competitive ELISA method through antigen-antibody specific reaction and taking an enzyme immune technology as a basis, and is beneficial to determining the product quality and detecting mass samples.

Compared with the prior art, the ELISA method kit for quantitatively detecting rhTSG-6 is highly sensitive, rapid and accurate, and is mainly used for screening samples in large scale; the main reagents in the kit are all provided in the form of working solution, wherein the rhTSG-6 complete antigen is efficiently expressed by optimizing codon pronucleus, the purity is high, the cost is low, and the kit can be produced in large batch. Thus, the preparation cost of the specific polyclonal antibody and the enzyme-labeled antigen can be greatly reduced; the kit is convenient to use, has the characteristics of high specificity, high sensitivity, high accuracy and the like, and can be used for quickly and quantitatively detecting TSG-6 in a sample.

The minimum detection limit of the method established by the invention can reach 1.1536ng/ml, the intra-batch difference is less than 5 percent, and the inter-batch difference is less than 10 percent. The recovery rate of rhTSG-6 quantitative detection in the sample by using the method of the invention is between 90% and 110%. The method has important commercial development value for product quality control of production enterprises.

Drawings

FIG. 1 shows the result of PCR identification of the optimized recombinant human TSG-6 gene, wherein the ratio of lane M: DNA Marker DL2000; lane 1: negative control; lanes 2-5: the PCR identification result of the optimized recombinant human TSG-6 gene is obtained;

FIG. 2 shows the results of the double restriction enzyme identification of the recombinant plasmid pET32 a-rhTSG-6; wherein M is DNA Marker DL2000; lane 1 shows the results of BamHI and HindIII double digestion of the recombinant plasmid pET32a-rhTSG-6,

lanes

2 and 3 show the results of single digestion of the recombinant plasmid pET32a-rhTSG-6 with BamHI and HindIII respectively, and lane 4 shows the negative control of the recombinant plasmid pET32 a-rhTSG-6;

FIG. 3 shows SDS-PAGE results of recombinant human TSG-6 protein induced by expression using 1.0mM IPTG at 30 ℃; wherein M is protein marker, lane 1 is empty carrier thallus total protein obtained by induction under the same condition, lane 2 is recombinant human TSG-6 engineering bacteria induced for 5h and thallus expressed total protein; lane 3 is the precipitate after the thallus is broken after the recombinant human TSG-6 engineering bacteria is induced for 5h, and Lane 4 is the supernatant after the thallus is broken after the recombinant human TSG-6 engineering bacteria is induced for 5 h.

FIG. 4 shows the result of detecting the expression of recombinant human TSG-6 protein, wherein M is protein marker, lane 1 is empty vector total protein obtained by induction under the same conditions, lane 2 is the supernatant of disrupted recombinant human TSG-6 engineering bacteria after 5h induction, lane 3 is the precipitate of disrupted recombinant human TSG-6 engineering bacteria after 5h induction;

FIG. 5 shows the result of identifying recombinant human TSG-6 protein by Western Blot; wherein M is a protein marker, a lane 1 is total protein obtained by crushing empty vector thalli, and a lane 2 is a recombinant human TSG-6 protein sample;

FIG. 6 shows the SDS-PAGE result after the purification of the recombinant human TSG-6 protein; wherein M is a protein marker, lane 2 is a recombinant human TSG-6 protein solution before purification, lane 3 is a purified recombinant human TSG-6 protein standard;

FIG. 7 is a step of quantitative determination of rhTSG-6 using rhTSG-6 direct competition ELISA kit;

FIG. 8 is a standard curve of competitive ELISA method.

Detailed Description

The present invention will be described in detail with reference to examples.

Example 1

A direct competitive ELISA kit for recombinant human tumor necrosis factor alpha-induced protein 6 comprises an ELISA plate coated with an anti-rhTSG-6 polyclonal antibody, an enzyme-labeled rhTSG-6 recombinant antigen, an rhTSG-6 protein standard, a sample diluent, a washing solution, a developing solution A, a developing solution B and a stop solution.

The preparation method of the rhTSG-6 recombinant antigen comprises the following steps:

(1) The recombinant human TSG-6 gene shown in SEQUENCE LISTING 400 <1 > reported in Genebank is subjected to codon optimization, and the recombinant human TSG-6 gene shown in SEQUENCE LISTING 400 <2 > is obtained by using a chemical synthesis method, wherein the Codon Adaptation Index (CAI) before optimization is 0.73, and the CAI after optimization is 0.97. The amino acid SEQUENCE of the recombinant human TSG-6 protein coded by the recombinant human TSG-6 gene shown in SEQUENCE testing 400 (2) is shown in SEQUENCE testing 400 (3).

(2) Subcloning the recombinant human TSG-6 gene obtained in the step (1) into a pET-32a expression vector, converting the expression vector into BL21 escherichia coli, coating an LB plate containing ampicillin for overnight culture, selecting a single colony on the LB plate to perform PCR and BamHI and HindIII double enzyme digestion identification, wherein a positive result indicates that the expression vector is successfully constructed to obtain a recombinant human TSG-6 recombinant bacterium; the PCR amplification and double digestion products show a single band around 800bp by agarose gel electrophoresis lane 1, as shown in FIGS. 1 and 2;

the PCR identification primer is:

F1：GGATCCTGGGGTTTTAAAGATGGC(BamHⅠ)；

R1：AAGCTT TTACAGATGACTAAAGCGAC(HindⅢ)。

(3) Selecting recombinant human TSG-6 recombinant bacteria, carrying out shake culture in an LB culture medium containing 100 mu g/mL ampicillin, carrying out amplification culture in the LB culture medium containing 100 mu g/mL ampicillin for 2-3 h, adding 1.0mM IPTG at the final concentration when the OD value is measured to be 0.6-0.8, carrying out induced expression for 5h at 30 ℃, and collecting bacteria; through SDS-PAGE electrophoretic analysis, as shown in figure 3, the mycoprotein after IPTG induced expression for 5 hours can see a dominant expression band at the position of 45.0kD, and the expression amount reaches 60 percent; identified by Western blot, as shown in figure 5, the mycoprotein after being induced and expressed for 5 hours by IPTG can generate specific reaction with rabbit anti-human TSG-6 polyclonal antibody, and a specific band appears at about 45kD, and the specificity is high;

the Western blot identification method comprises the following steps: rabbit anti-human TSG-6 polyclonal antibody from Abcam was used as a primary antibody (1.

(4) Resuspending the thallus collected in the step (3) by using 200mL of PBS, and ultrasonically breaking the bacterial precipitate at 4 ℃, wherein the ultrasonic conditions are as follows: power: 400W, 3S of work, 3S of interval, 6min of ultrasound, and 3-4 times of repetition; centrifuging at 12000r/min for 20min to separate supernatant and precipitate, washing, denaturing and renaturing the separated inclusion body precipitate to obtain the renatured product, i.e. the recombinant human TSG-6 protein crude product.

The method for washing, denaturation and renaturation comprises the following steps:

(1) washing: resuspending the inclusion bodies (10 g) in a 1: 20 wet weight to volume ratio using a wash buffer (50 mmol/L Tris,100mmol/L NaCl,2mol/L urea, 1mmol/L EDTA,0.5% Triton X-100, pH 8.0), washing for 2h, centrifuging at 12000r/min for 20min to take the pellet, and repeating the washing once more;

(2) denaturation: weighing the washed precipitate wet weight (4.8 g), then resuspending the precipitate (240 ml) in a lysis buffer (50 mmol/L Tris,100mmol/L NaCl,7mol/L guanidine hydrochloride, 0.1% beta-mercaptoethanol, pH 8.45) at a wet weight to volume ratio of 1:50, placing on a magnetic stirrer overnight, and fully lysing;

(3) and (3) dilution renaturation: renaturation buffer (50 mmol/L Tris,100mmol/L NaCl,1mmol/L GSH,0.2mmol/L GSSG, pH8.0) is prepared for renaturation. Taking the dissolved protein solution, centrifuging at 12000r/min for 20min, taking the supernatant, adding an isovolumetric renaturation buffer solution (adding 250ml renaturation buffer solution), and standing for 3h at 4 ℃; then adding renaturation buffer solution to dilute to 4 times of the original volume (adding 500ml of renaturation buffer solution), and standing for 3h at 4 ℃; finally, renaturation buffer is added to dilute the solution to 5 times of the original volume (250 ml of renaturation buffer is added), and the solution is kept stand for 3 hours at 4 ℃.

The precipitate, supernatant and thallus were separately collected and examined by SDS-PAGE electrophoresis, as shown in FIG. 4. The recombinant protein is expressed as inclusion body through SDS-PAGE electrophoretic analysis.

(5) Filtering the crude product of the recombinant human TSG-6 protein, passing the crude product through a His-tag affinity chromatographic column, performing gradient Elution by using an Elution buffer (50 mM Tris-Cl and 500mM imidazole, pH 8.0), collecting the protein showing the ultraviolet absorption peak of the recombinant human TSG-6 protein, dialyzing the protein in a Tris-HCl buffer solution with the volume of 10 times for more than 6 hours at 4 ℃, dialyzing twice to remove high-concentration imidazole, adjusting the pH to 5.0, passing the eluate of 1M NaCl through an anion exchange chromatographic column to collect a flow-through solution, namely rhTSG-6 complete antigen, and detecting the flow-through solution by SDS-PAGE, wherein the result is shown in figure 6, and the purity of the obtained protein is more than 90 percent.

The preparation method of the rhTSG-6 protein standard substance comprises the following steps:

mixing the rhTSG-6 complete antigen obtained in the step (5) with a freeze-drying protective agent according to the equal volume of 1:1, and then freezing and drying to obtain the recombinant human TSG-6 protein standard substance with the specification of 40 mu g/per branch (namely, the amount of the rhTSG-6 complete antigen contained in each branch is 40 mu g); the lyoprotectant is PBS mixed solution of glycerol, mannitol and sucrose, and the final concentrations of the three in 10mmol/L PBS buffer solution are 100mL/L of glycerol, 0.12g/mL of mannitol and 0.025g/mL of sucrose.

The preparation of the enzyme-labeled rhTSG-6 recombinant antigen adopts a sodium periodate improvement method, and comprises the following specific steps:

(a) Preparing 10mg/ml aqueous solution of horseradish peroxidase by using deionized water, preparing 12.8mg/ml aqueous solution of sodium periodate, and immediately using the aqueous solution after preparation;

(b) Mixing the prepared horseradish peroxidase aqueous solution and sodium periodate in equal volume in a suitable container, and reacting for 30min at 4 ℃ in a dark place.

(c) 0.16mol/L glycol solution is prepared by 0.05M carbonate buffer solution, the equal volume of the glycol solution is added into the reaction container and mixed evenly, and the mixture is reacted for 30min at 4 ℃ in a dark place.

(d) And (3) adding the rhTSG-6 recombinant antigen solution with the concentration of more than 4mg/ml and the solution obtained in the step (c) into the container in a mass ratio of 1.

(e) Preparing 1mg/ml sodium borohydride solution with deionized water, adding into a reaction container, mixing, adding 40 μ g sodium borohydride per 1mg horseradish peroxidase, and reacting at 4 deg.C in dark for 2h.

(f) Dialyzed against 20mM phosphate buffer for 24h.

(g) The solution after the preliminary dialysis was passed through Sephacryls-100 gel chromatography column (GE) and eluted with CBS at a flow rate of 0.6ml/min.

(8) BSA was added to the purified solution at 1% and after filtration, 50% sterile glycerol was added thereto, and the mixture was stored at-20 ℃ after packaging.

The preparation method of the enzyme label plate for the anti-rhTSG-6 polyclonal antibody comprises the following steps: the rhTSG-6 recombinant antigen was used to immunize Balb/c mice after being diluted to a protein concentration of 2.0mg/mL using 0.01mol/L phosphate buffer (pH 7.0). The immunization is carried out 1 time by adopting Freund complete adjuvant, 2 times by adopting Freund incomplete adjuvant and 2 times by adopting no adjuvant. The antibody titer detected by the acquired antiserum immune double diffusion method is not less than 1. The antiserum is subjected to coarse purification by a saturated ammonium sulfate method and fine purification by an affinity chromatography method to obtain an anti-rhTSG-6 polyclonal antibody, and then sterile glycerol with the volume of 50% is added by filtration. And (5) standby. The known anti-rhTSG-6 polyclonal antibody is diluted to a determined concentration by 0.05mol/L carbonate buffer solution (pH 9.6), and added to the wells of the enzyme-labeled plate at a concentration of 100. Mu.l/well. Standing at 4 deg.C overnight, sealing with 0.01mol/L phosphate buffer solution containing 10% calf serum at pH 7.0 for 60min, washing with waste solution, draining, vacuum packaging, and storing at 4 deg.C.

The sample diluent is a phosphate buffer solution with pH of 7.0 and volume fraction of 0.01mol/L and containing 10% of calf serum;

the washing solution is a phosphate buffer solution containing 0.01mol/L of 0.05% Tween-20 by volume fraction in pH 7.0;

the color developing solution A is a solution added with hydrogen peroxide;

the color development liquid B is a solution added with tetramethyl benzidine (TMB);

the stop solution is a 2mol/L sulfuric acid solution.

Example 2

The method for quantitatively detecting the recombinant human tumor necrosis factor alpha-inducing protein 6 by using the kit in the embodiment 1 comprises the following steps:

(1) Diluting 40 mu g/branch rhTSG-6 protein standard solution into rhTSG-6 protein standard solution with the serial concentrations of 400, 200, 100, 50, 25, 12.5 and 6.25ng/ml by sample diluent;

(3) Adding 100 mul of the mixed solution obtained in the step (2) into each hole of the enzyme label plate pre-coated with the anti-rhTSG-6 polyclonal antibody, and reacting for 30min at 37 ℃;

(4) Adding 200 mul/hole of washing solution, washing for 5 times, and drying;

(6) Stop solution 50. Mu.l/well was added to stop the reaction, and the absorbance at 450nm was immediately measured on a microplate reader.

(7) And (3) drawing a standard curve by taking the negative logarithm of the concentration of the rhTSG-6 protein standard solution as an abscissa and the absorbance value B as an ordinate, solving a linear regression equation as shown in figure 8, and substituting the absorbance value in the hole of the sample to be detected into the standard curve to obtain the concentration of the rhTSG-6 in the sample to be detected.

Minimum detection amount: 10 rhTSG-6 standard substances with different concentrations are selected, each rhTSG-6 standard substance is subjected to 3 horizontal repetitions, the negative logarithm of the concentration of rhTSG-6 is taken as an abscissa, and B/B at each concentration is taken as a B/B ₀ Drawing a standard curve with the value as the ordinate, establishing a curve equation, and calculating the B without rhTSG-6 inhibition ₀ Mean and Standard Deviation (SD). With B ₀ The rhTSG-6 concentration corresponding to the value of-3 SD on the regression curve is the minimum detection quantity of the kit. Calculate B ₀ Has an average value of 1.30275 and a standard deviation of 0.03836. Therefore, the minimum detection limit is 1.1536ng/ml.

Precision: applying the quantitative detection rhTSG-6 kit produced in the same batch, continuously detecting one standard substance every day for 7 days, performing 3 horizontal repetitions, measuring a light absorption value, and detecting a variation coefficient in batch; and detecting 3 levels of rhTSG-6 standard substances at the same time by using 7 batches of rhTSG-6 kits, repeating the three levels, measuring light absorption values, and calculating the inter-batch variation coefficient. The final average intra-batch coefficient of variation was 1.38% and the average inter-batch coefficient of variation was 9.55%.

Specificity: determining the specificity of the kit by using the cross reaction rate as an index, preparing rhTSG-6, mouse, rat and rabbit TSG-6 into different concentrations, and respectively determining IC by using the kit ₅₀ Values, three replicates per drug, cross-reactivity calculated (%) = IC ₅₀ (rhTSG-6)/IC ₅₀ (other substances). Times.100%.

The cross-reactivity is shown in table 1:

TABLE 1 kit specificity of the invention Using polyclonal antibodies

Analyte	Cross reaction Rate (%)
		Human TSG-6	100
Mouse TSG-6	<0.1
		Rat TSG-6	<0.1
Rabbit source TSG-6	<0.1

And (3) recovery rate: diluting the prepared rhTSG-6 mother solution (1 mg/ml) to 100ng/ml, respectively adding the diluted rhTSG-6 mother solution to 5ml of sample diluent to make the final concentration of the sample diluent to be 3ng/ml, 6ng/ml and 12ng/ml respectively, randomly selecting 5 batches with three concentrations in each batch, repeating the concentration for 3 times, measuring the rhTSG-6 concentration in the sample diluent according to the measuring program of the kit, and calculating the recovery rate and the coefficient of variation:

recovery (%) = measured concentration/added concentration × 100%

The recovery rate is 90-110%, and the batch variation coefficients are less than 15%, which shows that the kit has accurate and reliable measurement results and stable results.

Storage period: the storage condition of the kit is 2-8 ℃, and the maximum light absorption value (zero addition), the concentration of 50% inhibitor and the measured value of the rhTSG-6 added actual sample of the kit are all within the normal range after 3 months of measurement. Considering that abnormal storage conditions occur in the transportation and use processes, the kit is placed for 1 day under the storage condition of 37 ℃ for accelerated stability experiments, and the results show that all indexes of the kit completely meet the requirements. In consideration of the occurrence of the freezing condition of the kit, the kit is frozen at the temperature of-20 ℃ for 7 days, and the determination result also shows that all index parameters of the kit are completely normal. From the above results, it was found that the kit could be stored at 2-8 ℃ for more than 6 months.

The above detailed description of the rhTSG-6 direct competition ELISA kit and the method of use and application thereof with reference to the examples is illustrative and not restrictive, and several examples can be cited according to the limited scope, and thus, variations and modifications thereof without departing from the general concept of the present invention are within the scope of the present invention.

SEQUENCE LISTING

<110> turnip lake Tianming Biotechnology Limited

<120> rhTSG-6 direct competition ELISA quantitative detection kit, and use method and application thereof

<130> 1

<160> 3

<170> PatentIn version 3.3

<210> 1

<211> 780

<212> DNA

<213> TSG-6 Gene before optimization

<400> 1

tggggattca aggatggaat ttttcataac tccatatggc ttgaacgagc agccggtgtg 60

taccacagag aagcacggtc tggcaaatac aagctcacct acgcagaagc taaggcggtg 120

tgtgaatttg aaggcggcca tctcgcaact tacaagcagc tagaggcagc cagaaaaatt 180

ggatttcatg tctgtgctgc tggatggatg gctaagggca gagttggata ccccattgtg 240

aagccagggc ccaactgtgg atttggaaaa actggcatta ttgattatgg aatccgtctc 300

aataggagtg aaagatggga tgcctattgc tacaacccac acgcaaagga gtgtggtggc 360

gtctttacag atccaaagca aatttttaaa tctccaggct tcccaaatga gtacgaagat 420

aaccaaatct gctactggca cattagactc aagtatggtc agcgtattca cctgagtttt 480

ttagattttg accttgaaga tgacccaggt tgcttggctg attatgttga aatatatgac 540

agttacgatg atgtccatgg ctttgtggga agatactgtg gagatgagct tccagatgac 600

atcatcagta caggaaatgt catgaccttg aagtttctaa gtgatgcttc agtgacagct 660

ggaggtttcc aaatcaaata tgttgcaatg gatcctgtat ccaaatccag tcaaggaaaa 720

aatacaagta ctacttctac tggaaataaa aactttttag ctggaagatt tagccactta 780

<210> 2

<211> 783

<212> DNA

<213> optimized TSG-6 Gene

<400> 2

tggggtttta aagatggcat ttttcataat agcatctggc tggaacgcgc cgccggcgtt 60

tatcatcgtg aagcccgtag tggcaaatat aaactgacct atgcagaagc caaagcagtg 120

tgcgaatttg aaggcggtca tctggcaacc tataaacagc tggaagcagc ccgtaaaatt 180

ggctttcatg tgtgcgcagc cggttggatg gccaaaggtc gcgtgggcta tccgattgtg 240

aaaccgggcc cgaattgcgg ttttggcaaa accggtatta ttgattatgg tattcgtctg 300

aatcgtagtg aacgttggga tgcctattgt tataatccgc atgcaaaaga atgcggtggc 360

gtttttaccg atccgaaaca gatttttaaa agcccgggct ttccgaatga atatgaagat 420

aatcagatct gctactggca tattcgtctg aaatatggtc agcgcattca tctgagtttt 480

ctggattttg atctggaaga tgatccgggc tgcctggcag attatgttga aatctatgat 540

agctatgacg atgttcatgg ttttgtgggt cgctattgtg gtgacgaact gccggatgat 600

attattagta ccggcaatgt gatgaccctg aaatttctga gtgatgccag cgtgaccgca 660

ggcggttttc agattaagta tgttgcaatg gaccctgtga gcaaaagcag ccagggcaaa 720

aataccagta ccaccagtac cggtaataag aattttctgg ccggtcgctt tagtcatctg 780

taa 783

<210> 3

<211> 260

<212> PRT

<213> amino acid sequence of recombinant human TSG-6

<400> 3

Trp Gly Phe Lys Asp Gly Ile Phe His Asn Ser Ile Trp Leu Glu Arg

1 5 10 15

Ala Ala Gly Val Tyr His Arg Glu Ala Arg Ser Gly Lys Tyr Lys Leu

20 25 30

Thr Tyr Ala Glu Ala Lys Ala Val Cys Glu Phe Glu Gly Gly His Leu

35 40 45

Ala Thr Tyr Lys Gln Leu Glu Ala Ala Arg Lys Ile Gly Phe His Val

50 55 60

Cys Ala Ala Gly Trp Met Ala Lys Gly Arg Val Gly Tyr Pro Ile Val

65 70 75 80

Lys Pro Gly Pro Asn Cys Gly Phe Gly Lys Thr Gly Ile Ile Asp Tyr

85 90 95

Gly Ile Arg Leu Asn Arg Ser Glu Arg Trp Asp Ala Tyr Cys Tyr Asn

100 105 110

Pro His Ala Lys Glu Cys Gly Gly Val Phe Thr Asp Pro Lys Gln Ile

115 120 125

Phe Lys Ser Pro Gly Phe Pro Asn Glu Tyr Glu Asp Asn Gln Ile Cys

130 135 140

Tyr Trp His Ile Arg Leu Lys Tyr Gly Gln Arg Ile His Leu Ser Phe

145 150 155 160

Leu Asp Phe Asp Leu Glu Asp Asp Pro Gly Cys Leu Ala Asp Tyr Val

165 170 175

Glu Ile Tyr Asp Ser Tyr Asp Asp Val His Gly Phe Val Gly Arg Tyr

180 185 190

Cys Gly Asp Glu Leu Pro Asp Asp Ile Ile Ser Thr Gly Asn Val Met

195 200 205

Thr Leu Lys Phe Leu Ser Asp Ala Ser Val Thr Ala Gly Gly Phe Gln

210 215 220

Ile Lys Tyr Val Ala Met Asp Pro Ala Ser Lys Ser Ser Gln Gly Lys

225 230 235 240

Asn Thr Ser Thr Thr Ser Thr Gly Asn Tyr Asn Phe Leu Ala Gly Arg

245 250 255

Phe Ser His Leu

260

Claims

1. A recombinant human tumor necrosis factor alpha-induced protein 6 direct competition ELISA method quantitative detection kit is characterized by comprising an ELISA plate coated with anti-rhTSG-6 polyclonal antibody, an enzyme-labeled rhTSG-6 recombinant antigen, rhTSG-6 protein standard, sample diluent, a washing solution, a developing solution A, a developing solution B and a stop solution;

the rhTSG-6 recombinant antigen has the gene SEQUENCE shown in SEQUENCE testing 400 (2).

2. The kit for the quantitative detection of the recombinant human tumor necrosis factor-alpha-induced protein 6 by the direct competitive ELISA method according to claim 1, wherein the enzyme-labeled rhTSG-6 antigen is a rhTSG-6 recombinant antigen labeled by horseradish peroxidase.

3. The kit for the quantitative detection of the recombinant human tumor necrosis factor alpha-induced protein 6 by the direct competition ELISA method according to claim 1, wherein the preparation method of the ELISA plate coated with the anti-rhTSG-6 polyclonal antibody comprises the following steps: diluting the anti-rhTSG-6 polyclonal antibody by 0.05M carbonate buffer solution, coating the diluted antibody on an enzyme label plate, standing overnight at 4 ℃, sealing by 0.01mol/L phosphate buffer solution containing 10% by volume of calf serum and having pH of 7.0, washing, drying, filling into a packaging bag, and vacuumizing for storage.

4. The kit for the quantitative detection of the recombinant human tumor necrosis factor-alpha-induced protein 6 by the direct competitive ELISA method according to claim 3, wherein the anti-rhTSG-6 polyclonal antibody is obtained by purifying antiserum obtained by immunizing a Balb/c mouse with rhTSG-6 recombinant antigen.

5. The kit for the quantitative detection of the recombinant human tumor necrosis factor-alpha-induced protein 6 by the direct competitive ELISA method according to claim 1, wherein the rhTSG-6 protein standard is prepared by mixing rhTSG-6 recombinant antigen with a freeze-drying protective agent and freeze-drying the mixture.

6. The kit for quantitative determination of recombinant human tumor necrosis factor-alpha-induced protein 6 by direct competition ELISA method according to claim 1, wherein the sample diluent is 0.01mol/L phosphate buffer solution containing 10% by volume of calf serum at pH 7.0; the washing solution is 0.01mol/L phosphate buffer solution containing 0.05 percent of Tween-20 by volume fraction in pH 7.0.

7. The kit for quantitative determination of recombinant human tumor necrosis factor-alpha-induced protein 6 by direct competition ELISA method according to claim 1, wherein the developing solution A is a solution to which hydrogen peroxide is added; the color development liquid B is a solution added with tetramethyl benzidine; the stop solution is a 2mol/L sulfuric acid solution.

8. The method for using the recombinant human tumor necrosis factor alpha-inducing protein 6 direct competition ELISA quantitative detection kit of any one of claims 1-7 for non-diagnostic purposes, which comprises the following steps:

(2) Respectively mixing the rhTSG-6 protein standard solution, the sample to be detected and the enzyme-labeled rhTSG-6 recombinant antigen in equal volume to obtain a mixed solution;

(3) Adding 100 mul of the mixed solution in the step (2) into each hole of the enzyme label plate pre-coated with the anti-rhTSG-6 polyclonal antibody, and placing the mixed solution at 37 ℃ for reaction for 30min;

(4) Discarding the liquid in the plate, adding 200 mu l/hole of washing liquid, washing for 5 times, and then drying by beating;

(5) Adding 50 mul/hole of color development liquid B, adding 50 mul/hole of color development liquid A, tapping the plate frame, mixing uniformly, and reacting for 10min at room temperature in a dark place;

(6) Adding 50 mul/hole of stop solution to stop reaction, and immediately measuring the absorbance value at 450nm on an enzyme-linked immunosorbent assay (ELISA) instrument;

(7) And drawing a standard curve by taking the negative logarithm of the concentration of the rhTSG-6 protein standard solution as an abscissa and the absorbance value as an ordinate, solving a linear regression equation, and substituting the absorbance value in the hole of the sample to be detected into the standard curve to obtain the concentration of the rhTSG-6 in the sample to be detected.

9. A non-diagnostic quantitative detection method of recombinant human tumor necrosis factor alpha-induced protein 6, characterized in that, the recombinant human tumor necrosis factor alpha-induced protein 6 direct competition ELISA quantitative detection kit of any claim 1-7 is used for detection.