CN104215775A - Method for preparing detection kit based on penicillin-binding protein PBP6 beta-lactam antibiotic receptor assay and detection method thereof - Google Patents

Abstract

The invention aims to provide a method for preparing a rapid detection kit based on penicillin-binding protein PBP6 beta-lactam antibiotic receptor assay as well as a used detection method, aiming at solving the problem of sieve leakage in the process of detecting beta-lactam medicines in a traditional ELISA method. The invention discloses a method for preparing a detection kit based on penicillin-binding protein PBP6 beta-lactam antibiotic receptor assay as well as an indirect competitive receptor assay method for detecting the content of beta-lactam drugs in milk by adopting the detection kit based on penicillin-binding protein PBP6 beta-lactam antibiotic receptor assay. The methods have the beneficial effects that by utilizing the characteristic that the penicillin-binding protein 6 can be specifically bound to the beta-lactam drugs, the drugs can be specifically identified in a buffer liquid system or a sample matrix extracting solution and are not influenced by other antibiotics such as macrolides, quinolones and tetracyclines.

Description

The beta-lactam antibiotic receptor method detection kit preparation method of PBP PBP6 and detection method

Technical field

The invention belongs to biological technical field, particularly Applied Biotechnology detects residue of veterinary drug field, relate to a kind of beta-lactam antibiotic receptor method quick detection kit based on PBP PBP6.

Background technology

Beta-lactam antibiotic (β-Lactam antibiotics) is the microbiotic that a large class contains beta-lactam ring structure.According to beta-lactam ring structure difference, such microbiotic mainly comprises penicillins, cephalosporins, cephamycin-type, Carbapenems and monobactams etc., wherein penicillins and cephalosporins with the fastest developing speed, be most widely used.

Beta-lactam medicine sticks peptide synthetase mainly through T suppression cell wall, and namely PBP is active, stops the synthesis of whole cell peptidoglycan, makes microorganism break and produce antibacterial action.Due to the acellular wall of mammalian cell, therefore this type of medicine is general without Special Influence to people, animal etc., less to bacterial host toxicity.

Because such medicine effect is given prominence to, also there are some problems during application aborning, such as drug abuse, not in accordance with off-drug period drug withdrawal, the random compatibility of different pharmaceutical etc., cause curative effect of medication to reduce, also hidden danger is caused to relevant animal food security.The maximum at present problem of Beta-lactam medicine is exactly the allergic reaction causing part to be not suitable with crowd, causes health impaired even dead etc., and such as carcinogenic, teratogenesis, mutagenesis etc. also studies have reported that in addition.

Owing to there is various potential hazard, all strict regulations are done to the residue limits of Beta-lactam medicine in animal derived food in current world wide, wherein European Union, the U.S., Japan and Chinese limitation require substantially similar, as most of at 4 μ g/L to the requirement of penicillin medicine.

Belt-lactam antibiotics residues detection technique all has report from initial micro-biological process, thin-layered chromatography, large-scale instrument analytic approach by now such as gas chromatography and gas chromatography mass spectrometry method, high performance liquid chromatography and Liquid Chromatography/Mass Spectrometry and capillary electrophoresis and immune analysis method etc.In recent years, microbiological sensor, electrochemical sensor technology and biosensor technology etc. are also progressively applied to this research.

PBP (Penicillin binding proteins, PBPs) is a kind of memebrane protein being extensively present in bacterium surface, is the Main Function target position of beta-lactam antibiotic.Its contamination of different bacterium is all not identical.But the PBPs of various bacterial classification has again many similar structure and fuction, play a significant role in bacterial growth, breeding.The change of PBPs structure and quantity is the important mechanisms producing bacterial resistance.Due to can with penicillin specific binding, be thus also widely used in the residue detection of beta-lactam antibiotic.Application number is the Chinese invention patent etc. of CN201010139088.7 and CN201110057523.6 is all establish corresponding detection method based on PBP 2 (PBP2), and to utilize PBP 6 (PBP6) to set up detection method at publication number be disclose test strip and paper box in CN203376330U, CN203385734U and CN203376317U, but its method for making is disclosed.

Summary of the invention

The object of this invention is to provide a kind of preparation method of the beta-lactam antibiotic receptor method quick detection kit based on PBP PBP6, and use detection method, to solve the problem that conventional ELISA method detects Beta-lactam medicine hourglass sieve.

Technical scheme of the present invention is as follows:

The beta-lactam antibiotic receptor method detection kit preparation method that sequence is the PBP PBP6 shown in SEQ ID NO.1, step is as follows:

1) structure of the recombinant expression carrier of PBP 6 and protein expression

Prof. Du Yucang PBP 6 gene order, according to gene order design and synthesis pair of primers, restriction enzyme site NdeI and XhoI is introduced in primer, with the gene of synthesis for template, gene magnification is carried out with the primer of synthesis, amplification program is as follows: 94 DEG C of denaturation 2min, 94 DEG C of sex change 30s, 55 DEG C of annealing 30s, 72 DEG C extend 1min30s, 30 circulations, and 72 DEG C extend 5min, the gene amplification product obtained 1% agarose gel electrophoresis, reclaims kit by glue after electrophoresis and reclaims amplified production.

The PCR primer reclaimed and prokaryotic expression carrier pET28a use NdeI and XhoI 37 DEG C of double digestion 2h respectively, and enzyme is cut rear glue recovery kit and reclaimed; The gene outcome reclaimed is connected 2h with pET28a T4 ligase 16 DEG C, product full dose will be connected and transform DH5 α competent cell, and dull and stereotyped upper 37 DEG C of the LB be applied to containing that penicillin of card is inverted incubated overnight; Picking monoclonal bacterium colony carries out PCR qualification, positive monoclonal is extracted plasmid and carries out double digestion qualification, double digestion is identified correct monoclonal carries out DNA sequencing, compares to sequencing result, completely the same with required DNA.

By in recombinant plasmid transformed expression strain BL21 (DE3), picking monoclonal bacterial strain shakes bacterium, carries out abduction delivering with IPTG, SDS-PAGE electrophoresis detection expression of results; With ni-sepharose purification after great expression, the albumen desalination of purifying is frozen in liquid nitrogen for subsequent use.

2) preparation of PBP 6 monoclonal antibody specific

By PBP 6 good for purifying with the amount immunity Balb/C small white mouse of 50 μ g/ time, during initial immunity and Freund's complete adjuvant (sigma, F5881) mixed in equal amounts, by PBP6 and incomplete Freund's adjuvant (sigma, F5506) mixed in equal amounts during follow-up immunization; To take a blood sample after 3 immunity mensuration serum titer, all gather determination of serum after follow-up each immunity and tire; Be greater than after 1:1000 (OD450nm>1.5) until serum titer, booster immunization is carried out with 100 μ g/ time/PBP6 only, and after booster immunization in 72 hours by sacrifice, collect its splenocyte and SP2/0 cell line merges, preparation can secrete the hybridoma cell strain of PBP6 monoclonal antibody;

Use PBP6 to screen positive cell strain, select the good cell line of colour developing to produce ascites antibody with intracorporal method, and carry out purifying with affinity chromatography, the antibody collected after purifying is in store for;

3) preparation of horseradish peroxidase-labeled PBP 6 monoclonal antibody specific

Adopt glutaraldehyde method horseradish peroxidase (HRP) and PBP6 monoclonal antibody to be marked, concrete operations are as follows:

(1) taking HRP25mg is dissolved in 1.25% glutaraldehyde solution, room temperature hold over night;

(2) reacted enzyme solutions is through SephadexG-25 chromatographic column, uses physiological saline wash-out; Flow control, at 1ml/min, collects brown efflux; As volume is greater than 5ml, be then concentrated into 5ml with PEG; Place in 25ml small beaker, slowly stir;

(3) by antibody 12.5mg normal saline dilution to be marked to 5ml, dropwise add in enzyme solutions under stirring;

(4) with 1MpH9.5 carbonic acid buffer 0.25ml, stirring 3 hours is continued;

(5) add 0.2M lysine 0.25ml, after mixing, put room temperature 2 hours;

(6) under agitation dropwise add equal-volume saturated ammonium sulfate, put 4 DEG C 1 hour;

(7) 3000rpm centrifugal half an hour, supernatant is abandoned; Sediment semi-saturation ammonium sulfate washes secondary, and last sediment is dissolved in the PBS of a small amount of 0.15MPH7.4;

(8) above-mentioned solution is loaded in bag filter, the PB buffer saline of 0.15MPH7.4 is dialysed, (detect with Nai Shi reagent) after removing ammonium ion, 10,000rpm removes precipitation in centrifugal 30 minutes, and supernatant is HRP-PBP6, after packing, stored frozen;

4) glutaraldehyde method synthesis coating antigen ampicillin and bovine serum albumin(BSA) conjugate (AMP-BSA) is adopted;

5) the beta-lactam antibiotic receptor method quick detection kit of PBP PBP6 is made

By AMP-BSA with bag be buffered liquid, its pH value is 9.6, and concentration is 0.05M carbonate buffer solution, is diluted to 10 μ g/ml, joins in ELISA Plate with the 100 every holes of μ l, 37 DEG C hatch 2 hours after, 4 DEG C are spent the night; Dry the coating buffer in ELISA Plate, with lavation buffer solution, its pH7.4, concentration is 0.1M phosphate buffer, containing 0.05% polysorbas20, after washing plate 3 times, pats dry for subsequent use;

6) kit is assembled

Component in kit is as follows:

Standard solution: dissolve with PBS and the ampicillin solution diluted, concentration is 0,0.05,0.2,0.8,2.4 and 9.6 μ g/L;

PBP 6 solution: with the PBP6 of pH7.40.1M phosphate buffer dilution, protein concentration is 0.1mg/ml;

Horseradish peroxidase-labeled PBP6 monoclonal antibody solution: dilute 3000 times with PBS, and containing 0.05% Sodium azide as antiseptic;

One-component tmb substrate liquid;

Stop buffer: 1M sulfuric acid solution;

The present invention also comprises a kind of indirect competition receptor method detection method of beta-lactam antibiotic receptor method detection kit to the content of beta-lactam medicine in milk adopting PBP PBP6, and concrete steps are as follows:

1) standard items/milk sample is added: drawing 50 μ l samples or standard items with pipettor, to join ELISA Plate be aerial, is placed in horizontal table top gently after concussion;

2) add PBP 6: continue to add 50 μ l PBP 6 solution, shake ELISA Plate gently, make dissolution homogeneity mixing wherein;

3) enzyme-added labeled monoclonal antibody: enzyme marker added after in ELISA Plate hole with the 50 every holes of μ l, shake ELISA Plate gently, makes dissolution homogeneity mixing wherein;

4) hatch, wash plate: ELISA Plate cover plate membrane cover is placed on well 37 DEG C of incubators, hatches 30min; After taking-up, get rid of liquid in hole, wash plate 3 times, drain;

5) nitrite ion is added, cessation reaction: every hole adds one-component chromogenic substrate 100 μ l, gently after concussion, covers ELISA Plate, is placed in 37 DEG C of incubators, hatches 15min; After, with 50 μ l stop buffer cessation reactions;

6) reading: read data, using 630nm as reference wavelength with microplate reader 450nm;

7) interpretation of result: with Logit-Log double logarithmic curve Criterion curve, and analyze sample detection result.

The invention has the beneficial effects as follows make use of PBP 6 can with the feature of Beta-lactam medicine specific binding, such medicine can be identified specifically in buffer solution system or sample matrix extract, not be subject to the impact of other antibiotics as macrolides, quinolones, Tetracyclines.

The present invention's PBP 6 that utilized gene recombination method to prepare, it can be combined with beta-lactam antibiotic wide spectrum, and sensitivity is higher; (2) establish receptor method beta-lactam antibiotic quick detection kit based on PBP 6 and be applied to such medicament residue detection in food.This kit can detect the 12 kinds of beta-lactam antibiotics comprising 7 kinds of penicillin and 5 kinds of Cephalosporins, detection sensitivity is high, easy and simple to handle, the Large-scale Screening that can be used for the beta-lactam antibiotic in varieties of food items detects, and is very suitable for basic unit and detects use.

The receptor method method for quick utilizing the characteristic of this specific recognition to set up has feature that is highly sensitive, high specificity, requires lower to sample pre-treatments, and processing procedure is simple, and energy is check processing batch samples simultaneously.

Receptor method quick detection kit provided by the present invention is compared with traditional ELISA kit, detection of drugs kind is many, overcome the risk that conventional ELISA method detects Beta-lactam medicine hourglass sieve, guaranteeing will play a significant role in relevant animal derived food safety.

Embodiment

The present invention is further described below in conjunction with embodiment.Advantage and disadvantage of the present invention will be more clear along with description, but these embodiments are only exemplary in nature, do not form any restriction to scope of the present invention.It will be understood by those skilled in the art that and can modify to the details of technical solution of the present invention and form or replace down without departing from the spirit and scope of the present invention, but these amendments and replacement all fall into protection scope of the present invention.

The beta-lactam antibiotic receptor method detection kit preparation method of embodiment one, PBP PBP6

1) structure of the recombinant expression carrier of PBP 6 and protein expression PBP 6 sequence derive from Genebank (numbering P08506.2) or other homologous sequence, first the Prof. Du Yucang of gene order is carried out, according to the sequences Design pair of primers of synthesis, in primer, introduce restriction enzyme site NdeI and XhoI, primer sequence is as follows:, upstream primer P1:5 ' GGAATTC cATATGgCGGAACAAACCGTT 3 '

Downstream primer P2:5 ' CCG cTCGAG TTAAGAGAACCAGCTGCCGA 3 '

With the gene of synthesis for masterplate carries out pcr amplification, amplification program is as follows: 94 DEG C of denaturation 2min, 94 DEG C of sex change 30s, 55 DEG C of annealing 30s, 72 DEG C extend 1min30s, 30 circulations, and 72 DEG C extend 5min, the gene amplification product obtained 1% agarose gel electrophoresis, reclaims kit by glue after electrophoresis and reclaims amplified production.

The PCR primer reclaimed and prokaryotic expression carrier pET28a use NdeI and XhoI 37 DEG C of double digestion 2h respectively, and enzyme is cut rear glue recovery kit and reclaimed; The gene outcome reclaimed is connected 2h with pET28a T4 ligase 16 DEG C, product full dose will be connected and transform DH5 α competent cell, and dull and stereotyped upper 37 DEG C of the LB be applied to containing that penicillin of card is inverted incubated overnight; Picking monoclonal bacterium colony carries out PCR qualification, positive monoclonal is extracted plasmid and carries out double digestion qualification, double digestion is identified correct monoclonal carries out DNA sequencing, compares to sequencing result, completely the same with required DNA.

By the recombinant plasmid transformed that successfully constructs to E. coli expression strains BL21 (DE3), be inverted incubated overnight for 37 DEG C, picking monoclonal shakes bacterium and does detection of expression, and the monoclonal bacterial strain high by SDS-PAGE glue qualification expression preserves glycerol stock.Glycerol stock is seeded to 50ml with the ratio of 1:1000 to be contained in the LB fluid nutrient medium of 50 μ g/ml Kan, 37 DEG C of 210rpm incubated overnight, 5000rpm 10min collected by centrifugation thalline, resuspended with 5ml LB fluid nutrient medium, then join 37 DEG C of 210rpm in the 1L LB fluid nutrient medium containing 50 μ g/ml Kan to be cultured to OD600 and to reach 0.6, add final concentration 1mM IPTG 20 DEG C of 195rpm and to spend the night abduction delivering.5000rpm 10min collected by centrifugation thalline, the thalline 50mM Hepes 500mM NaCl 5mM imidazoles pH 7.4 of collection is resuspended for subsequent use.

Bacteria suspension is added protease inhibitors, ultrasonication under condition of ice bath, solution 4 DEG C of 18000rpm 30min centrifugal segregation precipitations of ultrasonication, supernatant is for subsequent use with 0.22 μm of membrane filtration.By the method purifying of albumen by affinity chromatography, Buffer A used (50mM Hepes 500mM NaCl 5mM imidazoles pH 7.4), Buffer B (50mM Hepes 500mM NaCl 500mM imidazoles pH 7.4).The albumen desalination of final purifying is frozen in liquid nitrogen for subsequent use.

2) preparation of PBP 6 monoclonal antibody specific

By PBP 6 good for purifying with the amount immunity Balb/C small white mouse of 50 μ g/ time, during initial immunity and Freund's complete adjuvant (sigma, F5881) mixed in equal amounts, by PBP6 and incomplete Freund's adjuvant (sigma, F5506) mixed in equal amounts during follow-up immunization.To take a blood sample after 3 immunity mensuration serum titer, all gather determination of serum after follow-up each immunity and tire.Be greater than after 1:1000 (OD450nm>1.5) until serum titer, booster immunization is carried out with 100 μ g/ time/PBP6 only, and after booster immunization in 72 hours by sacrifice, collect its splenocyte and SP2/0 cell line merges, preparation can secrete the hybridoma cell strain of PBP6 monoclonal antibody.

Use PBP6 to screen positive cell strain, select the good cell line of colour developing to produce ascites antibody with intracorporal method, and carry out purifying with affinity chromatography, the antibody collected after purifying is in store for.

3) preparation of horseradish peroxidase-labeled PBP 6 monoclonal antibody specific

Adopt glutaraldehyde method horseradish peroxidase (HRP) and PBP6 monoclonal antibody to be marked, concrete operations are as follows:

(1) taking HRP25mg is dissolved in 1.25% glutaraldehyde solution, room temperature hold over night.

(2) reacted enzyme solutions is through SephadexG-25 chromatographic column, uses physiological saline wash-out.Flow control, at 1ml/min, collects brown efflux.As volume is greater than 5ml, be then concentrated into 5ml with PEG.Place in 25ml small beaker, slowly stir.

(3) by antibody 12.5mg normal saline dilution to be marked to 5ml, dropwise add in enzyme solutions under stirring.

(4) with 1MpH9.5 carbonic acid buffer 0.25ml, stirring 3 hours is continued.

(5) add 0.2M lysine 0.25ml, after mixing, put room temperature 2 hours.

(6) under agitation dropwise add equal-volume saturated ammonium sulfate, put 4 DEG C 1 hour.

(7) 3000rpm centrifugal half an hour, supernatant is abandoned.Sediment semi-saturation ammonium sulfate washes secondary, and last sediment is dissolved in the PBS of a small amount of 0.15MPH7.4.

(8) above-mentioned solution is loaded in bag filter, the PB buffer saline of 0.15MPH7.4 is dialysed, (detect with Nai Shi reagent) after removing ammonium ion, 10,000rpm removes precipitation in centrifugal 30 minutes, and supernatant is HRP-PBP6, after packing, stored frozen.

4) preparation of coating antigen ampicillin and bovine serum albumin(BSA) conjugate (AMP-BSA)

Adopt glutaraldehyde method synthesis AMP-BSA.

5) the beta-lactam antibiotic receptor method quick detection kit of PBP PBP6 is made

AMP-BSA is buffered liquid (pH9.60.05M carbonate buffer solution) is diluted to 10 μ g/ml with bag, joins in ELISA Plate with the 100 every holes of μ l, 37 DEG C hatch 2 hours after, 4 DEG C are spent the night.Dry the coating buffer in ELISA Plate, after washing plate 3 times with lavation buffer solution (pH7.40.1M phosphate buffer, containing 0.05% polysorbas20), pat dry for subsequent use.

Other component in kit is as follows:

Standard solution: dissolve with PBS and the ampicillin solution diluted, concentration is 0,0.05,0.2,0.8,2.4 and 9.6 μ g/L;

PBP 6 solution: with the PBP6 of pH7.40.1M phosphate buffer dilution, protein concentration is 0.1mg/ml;

Horseradish peroxidase-labeled PBP6 monoclonal antibody solution: dilute 3000 times with PBS, and containing 0.05% Sodium azide as antiseptic;

One-component tmb substrate liquid: commercialization finished product;

Stop buffer: 1M sulfuric acid solution.

The indirect competition receptor method detection method of the content of beta-lactam medicine in embodiment two, milk

For milk sample, need not any pre-treatment during detection, directly to ELISA Plate.Concrete steps are as follows:

(1) standard items/sample is added: drawing 50 μ l samples or standard items with pipettor, to join ELISA Plate be aerial, is placed in horizontal table top gently after concussion.

(2) add PBP 6: continue to add 50 μ l PBP 6 solution, shake ELISA Plate gently, make dissolution homogeneity mixing wherein;

(3) enzyme-added labeled monoclonal antibody: enzyme marker added after in ELISA Plate hole with the 50 every holes of μ l, shake ELISA Plate gently, makes dissolution homogeneity mixing wherein;

(4) hatch, wash plate: ELISA Plate cover plate membrane cover is placed on well 37 DEG C of incubators, hatches 30min.After taking-up, get rid of liquid in hole, wash plate 3 times, drain;

(5) nitrite ion is added, cessation reaction: every hole adds one-component chromogenic substrate 100 μ l, gently after concussion, covers ELISA Plate, is placed in 37 DEG C of incubators, hatches 15min.After, with 50 μ l stop buffer cessation reactions.

(6) reading: read data, using 630nm as reference wavelength with microplate reader 450nm.

(7) interpretation of result: with Logit-Log double logarithmic curve Criterion curve, and analyze sample detection result.

The accuracy of embodiment three, kit and precision test

Get 20 parts blank, milk sample, to wherein add benzyl penicillin standard items, its concentration is made to reach 4 μ g/L, operate by operation instructions with preparing beta-lactam receptor method kit, detect benzyl penicillin content wherein, the calculation sample recovery as the measurement result of accuracy, simultaneously using the coefficient of variation of measurement result as the precision of kit.Concrete measurement result is as shown in the table.

Table 1 accuracy and precision measurement result

Sample number into spectrum	Measurement result	Measurement result	Measurement result	Measurement result
					No. 1-No. 5	92.5％	105.0％	90.0％	70.0％
No. 6-No. 10	67.5％	85.0％	102.5％	72.5％
					No. 11-No. 15	107.5％	80.0％	92.5％	90.0％
No. 16-No. 20	100.0％	90.0％	95.0％	105.0％
					Average recovery rate	90.3％	The coefficient of variation	13.9％	?

Can be known by table, kit is to the detection of milk sample when interpolation 4 μ g/L benzyl penicillin, and the recovery is 67.5% ~ 107.5%, and average recovery rate is 90.3%, and the coefficient of variation is 13.9%.

The foregoing is only preferred embodiment of the present invention, not in order to limit the present invention, all any amendments done within the spirit and principles in the present invention, equivalent replacement and improvement etc., all should be included within protection scope of the present invention.

Claims (2)

1. the sequence beta-lactam antibiotic receptor method detection kit preparation method that is the PBP PBP6 shown in SEQ ID NO.1, step is as follows:

1) structure of the recombinant expression carrier of PBP 6 and protein expression

(1) way syncillin associated proteins 6 sequence of gene chemical synthesis is adopted, according to the sequences Design pair of primers of synthesis, restriction enzyme site NdeI and XhoI is introduced in primer, with the gene of synthesis for masterplate carries out pcr amplification, the gene amplification product obtained 1% agarose gel electrophoresis, reclaims kit by glue after electrophoresis and reclaims amplified production.

(2) PCR primer reclaimed and prokaryotic expression carrier pET28a use NdeI and XhoI 37 DEG C of double digestion 2h respectively, and enzyme is cut rear glue recovery kit and reclaimed; The gene outcome reclaimed is connected 2h with pET28a T4 ligase 16 DEG C, product full dose will be connected and transform DH5 α competent cell, and dull and stereotyped upper 37 DEG C of the LB be applied to containing that penicillin of card is inverted incubated overnight; Picking monoclonal bacterium colony carries out PCR qualification, positive monoclonal is extracted plasmid and carries out double digestion qualification, double digestion is identified correct monoclonal carries out DNA sequencing.

(3) by the recombinant plasmid transformed that successfully constructs to E. coli expression strains BL21 (DE3), be inverted incubated overnight for 37 DEG C, picking monoclonal shakes bacterium and does detection of expression, and the monoclonal bacterial strain high by SDS-PAGE glue qualification expression preserves glycerol stock.Glycerol stock is expanded and cultivates, after abduction delivering, collect expression thalline for subsequent use.

(4) bacteria suspension is added protease inhibitors, collect and express thalline, add protease inhibitors, after ultrasonication, remove precipitation, with Ni affinity column purifying after supernatant membrane filtration, collect the destination protein of purifying, detect purity with SDS-PAGE glue.Freeze in liquid nitrogen for subsequent use after purity being greater than the destination protein dialyzed overnight concentrating and desalinating of 90%.

2) preparation of PBP 6 monoclonal antibody specific:

By PBP 6 good for purifying with the amount immunity Balb/C small white mouse of 50 μ g/ time, during initial immunity and Freund's complete adjuvant (sigma, F5881) mixed in equal amounts, by PBP6 and incomplete Freund's adjuvant (sigma, F5506) mixed in equal amounts during follow-up immunization; To take a blood sample after 3 immunity mensuration serum titer, all gather determination of serum after follow-up each immunity and tire; Be greater than after 1:1000 (OD450nm>1.5) until serum titer, booster immunization is carried out with 100 μ g/ time/PBP6 only, and after booster immunization in 72 hours by sacrifice, collect its splenocyte and SP2/0 cell line merges, preparation can secrete the hybridoma cell strain of PBP6 monoclonal antibody;

Use PBP6 to screen positive cell strain, select the good cell line of colour developing to produce ascites antibody with intracorporal method, and carry out purifying with affinity chromatography, the antibody collected after purifying is in store for;

3) preparation of horseradish peroxidase-labeled PBP 6 monoclonal antibody specific:

Adopt glutaraldehyde method horseradish peroxidase (HRP) and PBP6 monoclonal antibody to be marked, concrete operations are as follows:

(1) taking HRP25mg is dissolved in 1.25% glutaraldehyde solution, room temperature hold over night;

(2) reacted enzyme solutions is through SephadexG-25 chromatographic column, uses physiological saline wash-out; Flow control, at 1ml/min, collects brown efflux; As volume is greater than 5ml, be then concentrated into 5ml with PEG; Place in 25ml small beaker, slowly stir;

(3) by antibody 12.5mg normal saline dilution to be marked to 5ml, dropwise add in enzyme solutions under stirring;

(4) with 1MpH9.5 carbonic acid buffer 0.25ml, stirring 3 hours is continued;

(5) add 0.2M lysine 0.25ml, after mixing, put room temperature 2 hours;

(6) under agitation dropwise add equal-volume saturated ammonium sulfate, put 4 DEG C 1 hour;

(7) 3000rpm centrifugal half an hour, supernatant is abandoned; Sediment semi-saturation ammonium sulfate washes secondary, and last sediment is dissolved in the PBS of a small amount of 0.15MPH7.4;

(8) above-mentioned solution is loaded in bag filter, the PB buffer saline of 0.15MPH7.4 is dialysed, (detect with Nai Shi reagent) after removing ammonium ion, 10,000rpm removes precipitation in centrifugal 30 minutes, and supernatant is HRP-PBP6, after packing, stored frozen;

4) glutaraldehyde method synthesis coating antigen ampicillin and bovine serum albumin(BSA) conjugate (AMP-BSA) is adopted;

5) the beta-lactam antibiotic receptor method quick detection kit of PBP PBP6 is made

By AMP-BSA with bag be buffered liquid, its pH value is 9.6, and concentration is 0.05M carbonate buffer solution, is diluted to 10 μ g/ml, joins in ELISA Plate with the 100 every holes of μ l, 37 DEG C hatch 2 hours after, 4 DEG C are spent the night; Dry the coating buffer in ELISA Plate, with lavation buffer solution, its pH7.4, concentration is 0.1M phosphate buffer, containing 0.05% polysorbas20, after washing plate 3 times, pats dry for subsequent use;

6) kit is assembled

Component in kit is as follows:

Standard solution: dissolve with PBS and the ampicillin solution diluted, concentration is 0,0.05,0.2,0.8,2.4 and 9.6 μ g/L;

PBP 6 solution: with the PBP6 of pH7.40.1M phosphate buffer dilution, protein concentration is 0.1mg/ml;

Horseradish peroxidase-labeled PBP6 monoclonal antibody solution: dilute 3000 times with PBS, and containing 0.05% Sodium azide as antiseptic;

One-component tmb substrate liquid;

Stop buffer: 1M sulfuric acid solution.

2. adopt the indirect competition receptor method detection method of beta-lactam antibiotic receptor method detection kit to the content of beta-lactam medicine in milk of PBP PBP6, concrete steps are as follows:

1) standard items/milk sample is added: drawing 50 μ l samples or standard items with pipettor, to join ELISA Plate be aerial, is placed in horizontal table top gently after concussion;

2) add PBP 6: continue to add 50 μ l PBP 6 solution, shake ELISA Plate gently, make dissolution homogeneity mixing wherein;

3) enzyme-added labeled monoclonal antibody: enzyme marker added after in ELISA Plate hole with the 50 every holes of μ l, shake ELISA Plate gently, makes dissolution homogeneity mixing wherein;

4) hatch, wash plate: ELISA Plate cover plate membrane cover is placed on well 37 DEG C of incubators, hatches 30min; After taking-up, get rid of liquid in hole, wash plate 3 times, drain;

5) nitrite ion is added, cessation reaction: every hole adds one-component chromogenic substrate 100 μ l, gently after concussion, covers ELISA Plate, is placed in 37 DEG C of incubators, hatches 15min; After, with 50 μ l stop buffer cessation reactions;

6) reading: read data, using 630nm as reference wavelength with microplate reader 450nm;

7) interpretation of result: with Logit-Log double logarithmic curve Criterion curve, and analyze sample detection result.