CN111273029B - rhTSG-6 double-antibody sandwich ELISA quantitative detection kit and use method and application thereof - Google Patents

Abstract

The invention discloses a rhTSG-6 double-antibody sandwich ELISA quantitative detection kit and a use method and application thereof, wherein the kit comprises an ELISA plate coated with an anti-rhTSG-6 polyclonal antibody, an enzyme-labeled anti-rhTSG-6 polyclonal antibody, an rhTSG-6 protein standard, a sample diluent, a washing solution, a developing solution A solution, a developing solution B solution and a stop solution; by antigen-antibody specific reaction and based on enzyme immunity technology, methodology and commercialized kit for detecting rhTSG-6 in fermentation liquor, semi-finished products, finished products and the like and tissue cell samples by direct quantitative competitive ELISA method are established and developed, and research and development of corresponding products and specific detection of clinical sample samples can be realized. The method has the advantages that the lowest detection limit can reach 1.2ng/ml, the intra-batch difference is less than 5 percent, and the inter-batch difference is less than 10 percent; the recovery rate of rhTSG-6 quantitative detection in a sample by using the method of the invention is between 90% and 110%, and the kit is shown to have important commercial development value for product quality control and clinical specimen detection of production enterprises.

Description

rhTSG-6 double-antibody sandwich ELISA quantitative detection kit and use method and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a rhTSG-6 double-antibody sandwich ELISA quantitative detection kit, and a use method and application thereof.

Background

Tumor necrosis factor alpha-stimulated gene 6 (TSG-6) is an inflammation-related secretory protein, is generated by mesenchymal stem cells or stromal cells (MSCs) in response to inflammatory signals, and is highly expressed in various inflammatory diseases or inflammatory-like pathological processes. It is known that TSG-6 mediates many immune regulation and tissue repair processes, has anti-inflammatory and tissue protective effects, and is a functional protein that is upregulated.

A large number of researches show that the TSG-6 protein has the functions of inhibiting the expression of inflammatory factors TNF-alpha, IL-1 beta, IL-6 and the like, inhibiting neutrophil infiltration and the like, and has stronger anti-inflammatory effect. With the progress of related research, the efficacy of TSG-6 protein has been gradually emphasized by the field of biomedicine. However, no corresponding kit directly used for rhTSG-6 product and clinical specimen detection exists in the current market. The invention discovers for the first time that recombinant human TSG-6 (recombinant human TSG-6, rhTSG-6) has antiviral activity in vitro and in vivo. And the rhTSG-6 double-antibody sandwich ELISA quantitative detection kit is developed based on the discovery, and the blank in the field is filled.

Disclosure of Invention

The invention provides a rhTSG-6 double-antibody sandwich ELISA quantitative detection kit, a using method and application thereof, and the kit has the characteristics of simplicity, rapidness, low cost, high specificity and sensitivity and the like.

The technical scheme adopted by the invention is as follows:

the development of a recombinant human tumor necrosis factor alpha-induced protein 6 double-antibody sandwich ELISA quantitative detection kit comprises an ELISA plate coated with an anti-rhTSG-6 polyclonal antibody, an enzyme-labeled rhTSG-6 anti-polyclonal antibody, an rhTSG-6 protein standard, a sample diluent, a washing solution, a developing solution A, a developing solution B and a stop solution.

Furthermore, the anti-rhTSG-6 polyclonal antibody is a refined antibody obtained by purifying antiserum obtained by immunizing a Balb/c mouse with the rhTSG-6 recombinant antigen for multiple times.

The rhTSG-6 recombinant antigen gene SEQUENCE is shown as SEQUENCE LISTING 400 <2 >, and is obtained by performing codon optimization on a recombinant human TSG-6 gene shown as SEQUENCE LISTING 400 <1 >, the Codon Adaptation Index (CAI) before optimization is 0.73, the CAI after optimization is 0.97, and the high-efficiency expression of recombinant human TSG-6 antigen protein can be realized by the codon optimization, and the expression amount reaches more than 30%.

The rhTSG-6 recombinant antigen has the amino acid SEQUENCE shown in SEQ ID NO 400 (3).

The enzyme-labeled anti-rhTSG-6 polyclonal antibody is obtained by purifying antiserum obtained by immunizing a Balb/c mouse with rhTSG-6 recombinant antigen by affinity chromatography and then labeling the antiserum with horseradish peroxidase (HRP).

The preparation method of the enzyme label plate coated with the anti-rhTSG-6 polyclonal antibody comprises the following steps: diluting the refined anti-rhTSG-6 polyclonal antibody with 0.05M carbonate buffer solution, coating the diluted antibody in an enzyme label plate, standing overnight at 4 ℃, sealing and sealing with 0.01mol/L phosphate buffer solution containing 10% by volume of calf serum and pH 7.0, washing, drying, packaging into a packaging bag, and vacuumizing for storage.

The rhTSG-6 protein standard is prepared by mixing rhTSG-6 recombinant antigen with a freeze-drying protective agent and freeze-drying.

The sample diluent is 0.01mol/L phosphate buffer solution with pH 7.0 and containing calf serum with volume fraction of 10%; the washing solution is 0.01mol/L phosphate buffer solution containing 0.05% Tween-20 by volume at pH 7.0.

The developing solution A is added with hydrogen peroxide solution; the color development liquid B is added with a Tetramethylbenzidine (TMB) solution; the stop solution is a 2mol/L sulfuric acid solution.

The invention also provides a using method of the recombinant human tumor necrosis factor alpha-induced protein 6 double-antibody sandwich ELISA kit, which comprises the following steps:

(1) Diluting the rhTSG-6 protein standard substance into rhTSG-6 protein standard substance solutions with serial concentrations by using sample diluent;

(2) Adding rhTSG-6 protein standard solution and sample solution to be detected into the ELISA plate coated with the anti-rhTSG-6 polyclonal antibody respectively, and adding the mixture into the microporous ELISA plate according to 100 mul/hole; standing in 37 deg.C incubator for 30min; discarding the solution, adding 200 μ l/hole of washing solution, washing for 5 times, and drying;

(3) Adding 100 mul/hole of enzyme-labeled anti-rhTSG-6 polyclonal antibody diluted by 1; discarding the solution, adding 200 μ l/hole of washing solution, washing for 5 times, and drying;

(4) Adding 50 mul/hole of color development liquid B, adding 50 mul/hole of color development liquid A, tapping the plate frame, mixing uniformly, and reacting for 10min at room temperature in a dark place;

(5) Adding 50 mul/hole of stop solution to stop reaction, and immediately measuring the absorbance value at 450nm on an enzyme-linked immunosorbent assay (ELISA) instrument;

(6) And drawing a standard curve by taking the negative logarithm of the concentration of the rhTSG-6 protein standard solution as an abscissa and the logarithm of the absorbance value as an ordinate, solving a linear regression equation, and substituting the absorbance value in the hole of the sample to be detected into the standard curve to obtain the concentration of the rhTSG-6 in the sample to be detected.

The invention also provides a quantitative detection method of the recombinant human tumor necrosis factor alpha-induced protein 6, and the detection is carried out by using the recombinant human tumor necrosis factor alpha-induced protein 6 double-antibody sandwich ELISA method kit according to the using method.

The invention develops the double-antibody sandwich ELISA method kit suitable for rhTSG-6 quantitative detection for the first time, namely, the codon optimization is carried out on rhTSG-6 genes in a gene bank to improve the adaptation index of the codon, and the genetic engineering prokaryotic expression technology is adopted to quickly produce the rhTSG-6 in a large scale and high efficiency, so that the purity and the cost are low, and the yield is improved by more than 100 times compared with the yield of the existing recombinant protein prokaryotic expression rhTSG-6. The antiserum of a Balb/c mouse immunized by the self-developed rhTSG-6 recombinant antigen is purified by an affinity chromatography method to obtain a pure rhTSG-6 polyclonal antibody; fixing the pure polyclonal antibody on an enzyme label plate as a primary antibody for capturing a specific antigen; then using a certain amount of horseradish peroxidase labeled anti-rhTSG-6 polyclonal antibody as a second antibody for capturing specific antigen; when a sample to be detected is added, highly specific antigen-antibody reaction can be generated in the enzyme label plate so as to quantitatively detect the existence and the content of the corresponding rhTSG-6 in the sample. The enzyme-labeled conjugate is preserved by adding 50% glycerol, and can be preserved for two years at 4 ℃.

Compared with the prior art, the double-antibody sandwich ELISA method kit for quantitatively detecting rhTSG-6 is convenient to use, has the characteristics of high specificity, high sensitivity, high accuracy and the like, and can quickly and quantitatively detect the TSG-6 in a sample.

The invention develops and establishes a rhTSG-6 double-antibody sandwich ELISA method through antigen-antibody specific reaction and based on an enzyme immunization technology, can directly quantitatively detect rhTSG-6 in fermentation liquor, semi-finished products, finished products and the like and tissue cell samples, can be used as a commercialized kit, and can be used for developing corresponding products and carrying out specific detection on clinical sample samples. The method has the lowest detection limit of 1.2ng/ml, the intra-batch difference is less than 5 percent, and the inter-batch difference is less than 10 percent. The recovery rate of rhTSG-6 quantitative detection in the sample by using the method of the invention is between 90% and 110%. The method has important commercial development value for detecting clinical specimens and controlling product quality of manufacturing enterprises. To fill the gap in the field.

Drawings

FIG. 1 shows the result of PCR identification of the optimized recombinant human TSG-6 gene, wherein the ratio of lane M: DNA Marker DL2000; lane 1: negative control; lanes 2-5: the PCR identification result of the optimized recombinant human TSG-6 gene is obtained;

FIG. 2 shows the results of double restriction enzyme identification of recombinant plasmid pET32 a-rhTSG-6; wherein M is DNA Marker DL2000; lane 1 shows the results of BamHI and HindIII double digestion of the recombinant plasmid pET32a-rhTSG-6, lanes 2 and 3 show the results of single digestion of the recombinant plasmid pET32a-rhTSG-6 with BamHI and HindIII respectively, and lane 4 shows the negative control of the recombinant plasmid pET32 a-rhTSG-6;

FIG. 3 shows SDS-PAGE results of recombinant human TSG-6 protein induced by 1.0mM IPTG expression at 30 ℃; wherein M is a protein marker, a lane 1 is empty carrier thallus total protein obtained by induction under the same condition, and a lane 2 is total protein expressed by thallus after the recombinant human TSG-6 engineering bacteria are induced for 5 hours; lane 3 is the precipitate after the thallus is broken after being induced by the recombinant human TSG-6 engineering bacteria for 5h, and lane 4 is the supernatant after the thallus is broken after being induced by the recombinant human TSG-6 engineering bacteria for 5 h.

FIG. 4 shows the detection result of recombinant human TSG-6 protein expression mode, wherein M is protein marker, lane 1 is the total protein of empty vector thallus induced under the same conditions, lane 2 is the supernatant after thallus is broken after 5h of induction by recombinant human TSG-6 engineering bacteria, lane 3 is the precipitate after thallus is broken after 5h of induction by recombinant human TSG-6 engineering bacteria;

FIG. 5 shows the result of Western Blot to identify recombinant human TSG-6 protein; wherein M is a protein marker, a lane 1 is total protein obtained by crushing empty vector thalli, and a lane 2 is a recombinant human TSG-6 protein sample;

FIG. 6 shows the SDS-PAGE result after the purification of the recombinant human TSG-6 protein; wherein M is protein marker, lane 2 is recombinant human TSG-6 protein solution before purification, lane 3 is recombinant human TSG-6 protein standard after purification;

FIG. 7 is a step of quantitative determination of rhTSG-6 using rhTSG-6 double antibody sandwich ELISA kit;

FIG. 8 is a standard curve of the double antibody sandwich ELISA method.

Detailed Description

The present invention will be described in detail with reference to examples.

Example 1

The development of a recombinant human tumor necrosis factor alpha-induced protein double-antibody sandwich ELISA kit comprises an ELISA plate coated with an anti-rhTSG-6 polyclonal antibody, an enzyme-labeled rhTSG-6 polyclonal antibody, an rhTSG-6 protein standard product, a sample diluent, a washing solution, a developing solution A, a developing solution B and a stop solution.

The preparation method of the rhTSG-6 recombinant antigen comprises the following steps:

(1) The recombinant human TSG-6 gene shown in SEQUENCE LISTING 400 (1) reported in Genebank is subjected to codon optimization, and the recombinant human TSG-6 gene shown in SEQUENCE LISTING 400 (2) is obtained by using a chemical synthesis method, wherein the Codon Adaptation Index (CAI) before optimization is 0.73, and the CAI after optimization is 0.97. The amino acid SEQUENCE of the recombinant human TSG-6 protein encoded by the recombinant human TSG-6 gene shown in SEQUENCE LISTING 400 (2) is shown in SEQUENCE LISTING 400 (3).

(2) Subcloning the recombinant human TSG-6 gene obtained in the step (1) into a pET-32a expression vector and converting the expression vector into BL21 escherichia coli, coating an LB plate containing ampicillin for overnight culture, selecting a single colony on the LB plate for PCR and BamHI and HindIII double enzyme digestion identification, wherein a positive result indicates that the construction of the expression vector is successful, and the recombinant human TSG-6 recombinant bacteria are obtained; the PCR amplification and double digestion products show a single band near 800bp by agarose gel electrophoresis No. 1 lane, as shown in FIGS. 1 and 2;

the PCR identification primer is:

F1：GGATCCTGGGGTTTTAAAGATGGC(BamHⅠ)；

R1：AAGCTT TTACAGATGACTAAAGCGAC(HindⅢ)。

(3) Selecting recombinant human TSG-6 recombinant bacteria, carrying out shake culture in an LB culture medium containing 100 mu g/mL ampicillin, carrying out amplification culture in the LB culture medium containing 100 mu g/mL ampicillin for 2-3 h, adding 1.0mM IPTG at the final concentration when the OD value is measured to be 0.6-0.8, carrying out induced expression for 5h at 30 ℃, and collecting bacteria; through SDS-PAGE electrophoretic analysis, as shown in figure 3, the mycoprotein after IPTG induction expression for 5h can see a dominant expression strip at the position of 45kD, and the expression amount reaches 50%; identified by Western blot, as shown in figure 5, the mycoprotein after being induced and expressed for 5 hours by IPTG can generate specific reaction with rabbit anti-human TSG-6 polyclonal antibody, and a specific band appears at about 45kD, and the specificity is high;

the Western blot identification method comprises the following steps: rabbit anti-human TSG-6 polyclonal antibody (Abcam) was used as a primary antibody (1.

(4) Resuspending the thallus collected in the step (3) by using 200mL of PBS, and ultrasonically breaking the bacterial precipitate at 4 ℃, wherein the ultrasonic conditions are as follows: power: 400W, working for 3S, performing ultrasonic treatment for 6min at an interval of 3S, and repeating for 3-4 times; centrifuging at 12000r/min for 20min to separate supernatant and precipitate, washing, denaturing and renaturing the separated inclusion body precipitate to obtain the renaturated product, i.e. the recombinant human TSG-6 protein crude product. The precipitate, supernatant and thallus were separately collected and examined by SDS-PAGE electrophoresis, as shown in FIG. 4. The recombinant protein is expressed as inclusion body through SDS-PAGE electrophoretic analysis.

The method for washing, denaturation and renaturation comprises the following steps:

(1) washing: resuspending inclusion bodies (10 g) in a 1: 20 wet weight to volume ratio using a wash buffer (50 mmol/L Tris,100mmol/L NaCl,2mol/L urea, 1mmol/L EDTA,0.5% Triton X-100, pH 8.0), washing for 2h, centrifuging at 12000r/min for 20min to take the pellet, and repeating the washing once more;

(2) denaturation: weighing the washed precipitate wet weight (4.8 g), then resuspending the precipitate (240 ml) in a lysis buffer (50 mmol/L Tris,100mmol/L NaCl,7mol/L guanidine hydrochloride, 0.1% beta-mercaptoethanol, pH 8.45) at a wet weight to volume ratio of 1:50, placing on a magnetic stirrer overnight, and fully lysing;

(3) and (3) dilution renaturation: preparing renaturation buffer solution (50 mmol/L Tris,100mmol/L NaCl,1mmol/L GSH,0.2mmol/L GSSG, pH8.0) for renaturation. Taking the dissolved protein solution, centrifuging at 12000r/min for 20min, taking the supernatant, adding an isovolumetric renaturation buffer solution (adding 250ml renaturation buffer solution), and standing for 3h at 4 ℃; then adding renaturation buffer solution to dilute to 4 times of the original volume (adding 500ml of renaturation buffer solution), and standing for 3h at 4 ℃; finally, renaturation buffer is added to dilute the solution to 5 times of the original volume (250 ml of renaturation buffer is added), and the solution is kept stand for 3 hours at 4 ℃.

(5) Filtering the crude product of the recombinant human TSG-6 protein, passing the crude product through a His-tag affinity chromatographic column, performing gradient Elution by using an Elution buffer (50 mM Tris-Cl and 500mM imidazole, pH 8.0), collecting the protein showing the ultraviolet absorption peak of the recombinant human TSG-6 protein, dialyzing the protein in a 10-fold volume of Tris-HCl buffer solution at 4 ℃ for more than 6 hours, dialyzing twice to remove high-concentration imidazole, adjusting the pH value to pH5.0, passing a 1M NaCl eluent through an anion exchange chromatographic column to collect a flow-through solution, namely rhTSG-6 complete antigen, and detecting the rhTSG-6 complete antigen by SDS-PAGE, wherein the result is shown in figure 6, and the purity of the obtained protein is more than 90 percent.

The preparation method of the rhTSG-6 protein standard substance comprises the following steps:

mixing the rhTSG-6 complete antigen obtained in the step (5) with a freeze-drying protective agent according to the equal volume of 1:1, and then freezing and drying to obtain the recombinant human TSG-6 protein standard product with the specification of 40 mu g/per unit (namely, the rhTSG-6 complete antigen content in each recombinant human TSG-6 protein standard product is 40 mu g); the lyoprotectant is PBS mixed solution of glycerol, mannitol and sucrose, and the final concentrations of the three in 10mmol/L PBS buffer solution are 100mL/L of glycerol, 0.12g/mL of mannitol and 0.025g/mL of sucrose.

The preparation method of the anti-rhTSG-6 polyclonal antibody comprises the following steps: the protein concentration of the rhTSG-6 recombinant antigen is diluted to 2.0mg/mL by using 0.01mol/L phosphate buffer solution (pH 7.0), balb/c mice are immunized, the first immunization is performed for 1 time by using Freund's complete adjuvant, the subsequent immunization is performed for 2 times by using Freund's incomplete adjuvant, and the subsequent immunization without adjuvant is performed for 2 times. The detection titer of the obtained corresponding specific antiserum by an immune double diffusion method is not less than 1. The antiserum is subjected to coarse purification by a saturated ammonium sulfate method and fine purification by an affinity chromatography method to obtain a refined rhTSG-6 polyclonal antibody, and sterile filtration is performed, then sterile glycerol with the volume of 50 percent is added, and the mixture is kept at-20 ℃ for later use.

The preparation of the enzyme-labeled rhTSG-6 polyclonal antibody adopts a sodium periodate improvement method, and comprises the following specific steps:

(a) Preparing 10mg/ml aqueous solution of horseradish peroxidase by using deionized water, preparing 12.8mg/ml aqueous solution of sodium periodate, and immediately using the aqueous solution after preparation;

(b) Mixing the prepared horseradish peroxidase aqueous solution and sodium periodate in equal volume in a suitable container, and reacting for 30min at 4 ℃ in a dark place.

(c) 0.16mol/L glycol solution is prepared by 0.05M carbonate buffer solution, the equal volume of the glycol solution is added into the reaction container and mixed evenly, and the mixture is reacted for 30min at 4 ℃ in a dark place.

(d) Adding the rhTSG-6 polyclonal antibody solution with the concentration of more than 4mg/ml and the solution obtained in the step c into the container in a mass ratio of 1.

(e) Preparing 1mg/ml sodium borohydride solution with deionized water, adding the solution into a reaction container, mixing uniformly, adding 40 mu g sodium borohydride into every 1mg horse radish peroxidase, and reacting for 2 hours at 4 ℃ in a dark place.

(f) Dialyzed against 20mM phosphate buffer for 24h.

(g) The solution after the preliminary dialysis was passed through Sephacryls-100 gel chromatography column (GE) and eluted with CBS at a flow rate of 0.6ml/min.

(8) BSA was added to the purified solution at 1% and after filtration, 50% sterile glycerol was added thereto, and the mixture was stored at-20 ℃ after packaging.

The preparation method of the enzyme label plate coating of the rhTSG-6 polyclonal antibody comprises the following steps: diluting a known and quantitative anti-rhTSG-6 polyclonal antibody by 0.05mol/L carbonate buffer solution (pH 9.6), adding an enzyme label plate according to 100 mu L/hole, and standing at 4 ℃ overnight; sealing with 0.01mol/L phosphate buffer solution with pH 7.0 containing volume fraction of 10% calf serum for 60min, washing with waste solution, drying, vacuum packaging, and storing at 4 deg.C.

The sample diluent is 0.01mol/L phosphate buffer solution with pH 7.0 and containing calf serum with volume fraction of 10%;

the washing solution is 0.01mol/L phosphate buffer solution containing 0.05% of Tween-20 by volume fraction in pH 7.0;

the color developing solution A is added with hydrogen peroxide solution;

the color development liquid B is a Tetramethylbenzidine (TMB) solution;

the stop solution is a 2mol/L sulfuric acid solution.

Example 2

The method for quantitatively detecting the recombinant human tumor necrosis factor alpha-induced protein 6 by using the kit in the embodiment 1 comprises the following steps:

(1) Diluting 40 mu g/branch rhTSG-6 protein standard solution into rhTSG-6 protein standard solution with the serial concentration of 400, 200, 100, 50, 25, 12.5 and 6.25ng/ml by sample diluent, setting blank (zero standard), and repeating 2 wells;

(2) Adding rhTSG-6 protein standard solution and sample solution to be detected into the ELISA plate coated with the anti-rhTSG-6 polyclonal antibody respectively, and adding the mixture into the microporous ELISA plate according to 100 mul/hole; standing in an incubator at 37 ℃ for 30min; discarding the solution, adding 200 μ l/hole of washing solution, washing for 5 times, and drying;

(3) Adding 100 mul/hole of enzyme-labeled rhTSG-6 polyclonal antibody diluted by 1; discarding the solution, adding 200 μ l/hole of washing solution, washing for 5 times, and drying;

(4) Adding 50 mul/hole of the color development liquid B, adding 50 mul/hole of the color development liquid A, tapping the plate frame to mix evenly, and reacting for 10min at room temperature in a dark place;

(5) Adding 50 mul/hole of stop solution to stop reaction, and immediately measuring the absorbance value at 450nm on an enzyme-linked immunosorbent assay (ELISA) instrument;

(6) Average duplicate readings for each standard and sample, and subtract the zero standard average absorbance value (B) ₀ ) And obtaining the absorbance value B of the standard substance and the sample with each concentration.

(7) The negative logarithm of the rhTSG-6 protein standard solution concentration is used as the abscissa, the logarithm of the absorbance value B is used as the ordinate, a standard curve is drawn, and a linear regression equation is solved, as shown in FIG. 8. And (4) bringing the absorbance value B in the sample hole to be detected into a standard curve, and obtaining the concentration of the rhTSG-6 in the sample to be detected.

Minimum detection amount: selecting 10 rhTSG-6 standard substances with different concentrations, performing 3 horizontal repetitions each, drawing a standard curve by taking the negative logarithm of the rhTSG-6 concentration as a horizontal coordinate and the logarithm of the absorbance value B at each concentration as a vertical coordinate, establishing a curve equation, and calculating B without the rhTSG-6 ₀ Mean and Standard Deviation (SD). With B ₀ The rhTSG-6 concentration corresponding to the value of-3 SD on the regression curve is the minimum detection quantity of the kit. The minimum detection limit was calculated to be 1.2ng/ml.

Precision: applying the quantitative detection rhTSG-6 kit produced in the same batch, continuously detecting one standard substance every day for 7 days, performing 3 horizontal repetitions, measuring a light absorption value, and detecting an intra-batch variation coefficient; and detecting 3 levels of rhTSG-6 standard substances at the same time by using 7 batches of rhTSG-6 kits, repeating the three levels, measuring the absorbance value, and calculating the batch variation coefficient. The final average intra-batch coefficient of variation was 2.05% and the average inter-batch coefficient of variation was 8.71%.

Specificity: determining the specificity of the kit by using the cross reaction rate as an index, preparing rhTSG-6 and mouse, rat and rabbit TSG-6 into different concentrations, and respectively determining IC by using the kit ₅₀ Values, three replicates per drug, cross-reactivity calculated (%) = IC ₅₀ (rhTSG-6)/IC ₅₀ (other substances). Times.100%.

The cross-reactivity is shown in table 1:

TABLE 1 kit specificity of the invention Using polyclonal antibodies

And (3) recovery rate: diluting the prepared rhTSG-6 mother solution (1 mg/ml) to 100ng/ml, respectively adding the diluted rhTSG-6 mother solution to 5ml of sample diluent to make the final concentration of the sample diluent to be 3ng/ml, 6ng/ml and 12ng/ml respectively, randomly selecting 5 batches with three concentrations in each batch, repeating the concentration for 3 times, measuring the rhTSG-6 concentration in the sample diluent according to the measuring program of the kit, and calculating the recovery rate and the coefficient of variation:

recovery (%) = measured concentration/added concentration × 100%

The recovery rate is 90-110%, and the batch variation coefficients are less than 15%, which shows that the kit has accurate and reliable measurement results and stable results.

Storage period: the storage condition of the kit is 2-8 ℃, and the maximum absorbance value (zero addition), the concentration of 50% inhibitor and the measured value of the rhTSG-6 addition actual sample of the kit are all within the normal range after 3 months of measurement. Considering that abnormal storage conditions occur in the transportation and use processes, the kit is placed for 1 day under the storage condition of 37 ℃ for accelerated stability experiments, and the results show that all indexes of the kit completely meet the requirements. In consideration of the occurrence of the freezing condition of the kit, the kit is frozen at the temperature of-20 ℃ for 7 days, and the determination result also shows that all index parameters of the kit are completely normal. The above results show that the kit can be stored at 2-8 ℃ for more than 6-12 months.

The above detailed description of the rhTSG-6 double antibody sandwich ELISA quantitative detection kit and the method of use and application thereof with reference to the embodiments is illustrative and not restrictive, and several embodiments can be listed according to the limited scope, therefore, variations and modifications without departing from the general concept of the present invention shall fall within the protection scope of the present invention.

SEQUENCE LISTING

<110> Wu lake Tianming Biotechnology Limited

<120> rhTSG-6 double-antibody sandwich ELISA quantitative detection kit and use method and application thereof

<130> 1

<160> 3

<170> PatentIn version 3.3

<210> 1

<211> 780

<212> DNA

<213> TSG-6 Gene before optimization

<400> 1

tggggattca aggatggaat ttttcataac tccatatggc ttgaacgagc agccggtgtg 60

taccacagag aagcacggtc tggcaaatac aagctcacct acgcagaagc taaggcggtg 120

tgtgaatttg aaggcggcca tctcgcaact tacaagcagc tagaggcagc cagaaaaatt 180

ggatttcatg tctgtgctgc tggatggatg gctaagggca gagttggata ccccattgtg 240

aagccagggc ccaactgtgg atttggaaaa actggcatta ttgattatgg aatccgtctc 300

aataggagtg aaagatggga tgcctattgc tacaacccac acgcaaagga gtgtggtggc 360

gtctttacag atccaaagca aatttttaaa tctccaggct tcccaaatga gtacgaagat 420

aaccaaatct gctactggca cattagactc aagtatggtc agcgtattca cctgagtttt 480

ttagattttg accttgaaga tgacccaggt tgcttggctg attatgttga aatatatgac 540

agttacgatg atgtccatgg ctttgtggga agatactgtg gagatgagct tccagatgac 600

atcatcagta caggaaatgt catgaccttg aagtttctaa gtgatgcttc agtgacagct 660

ggaggtttcc aaatcaaata tgttgcaatg gatcctgtat ccaaatccag tcaaggaaaa 720

aatacaagta ctacttctac tggaaataaa aactttttag ctggaagatt tagccactta 780

<210> 2

<211> 783

<212> DNA

<213> optimized TSG-6 Gene

<400> 2

tggggtttta aagatggcat ttttcataat agcatctggc tggaacgcgc cgccggcgtt 60

tatcatcgtg aagcccgtag tggcaaatat aaactgacct atgcagaagc caaagcagtg 120

tgcgaatttg aaggcggtca tctggcaacc tataaacagc tggaagcagc ccgtaaaatt 180

ggctttcatg tgtgcgcagc cggttggatg gccaaaggtc gcgtgggcta tccgattgtg 240

aaaccgggcc cgaattgcgg ttttggcaaa accggtatta ttgattatgg tattcgtctg 300

aatcgtagtg aacgttggga tgcctattgt tataatccgc atgcaaaaga atgcggtggc 360

gtttttaccg atccgaaaca gatttttaaa agcccgggct ttccgaatga atatgaagat 420

aatcagatct gctactggca tattcgtctg aaatatggtc agcgcattca tctgagtttt 480

ctggattttg atctggaaga tgatccgggc tgcctggcag attatgttga aatctatgat 540

agctatgacg atgttcatgg ttttgtgggt cgctattgtg gtgacgaact gccggatgat 600

attattagta ccggcaatgt gatgaccctg aaatttctga gtgatgccag cgtgaccgca 660

ggcggttttc agattaagta tgttgcaatg gaccctgtga gcaaaagcag ccagggcaaa 720

aataccagta ccaccagtac cggtaataag aattttctgg ccggtcgctt tagtcatctg 780

taa 783

<210> 3

<211> 260

<212> PRT

<213> amino acid sequence of recombinant human TSG-6

<400> 3

Trp Gly Phe Lys Asp Gly Ile Phe His Asn Ser Ile Trp Leu Glu Arg

1 5 10 15

Ala Ala Gly Val Tyr His Arg Glu Ala Arg Ser Gly Lys Tyr Lys Leu

20 25 30

Thr Tyr Ala Glu Ala Lys Ala Val Cys Glu Phe Glu Gly Gly His Leu

35 40 45

Ala Thr Tyr Lys Gln Leu Glu Ala Ala Arg Lys Ile Gly Phe His Val

50 55 60

Cys Ala Ala Gly Trp Met Ala Lys Gly Arg Val Gly Tyr Pro Ile Val

65 70 75 80

Lys Pro Gly Pro Asn Cys Gly Phe Gly Lys Thr Gly Ile Ile Asp Tyr

85 90 95

Gly Ile Arg Leu Asn Arg Ser Glu Arg Trp Asp Ala Tyr Cys Tyr Asn

100 105 110

Pro His Ala Lys Glu Cys Gly Gly Val Phe Thr Asp Pro Lys Gln Ile

115 120 125

Phe Lys Ser Pro Gly Phe Pro Asn Glu Tyr Glu Asp Asn Gln Ile Cys

130 135 140

Tyr Trp His Ile Arg Leu Lys Tyr Gly Gln Arg Ile His Leu Ser Phe

145 150 155 160

Leu Asp Phe Asp Leu Glu Asp Asp Pro Gly Cys Leu Ala Asp Tyr Val

165 170 175

Glu Ile Tyr Asp Ser Tyr Asp Asp Val His Gly Phe Val Gly Arg Tyr

180 185 190

Cys Gly Asp Glu Leu Pro Asp Asp Ile Ile Ser Thr Gly Asn Val Met

195 200 205

Thr Leu Lys Phe Leu Ser Asp Ala Ser Val Thr Ala Gly Gly Phe Gln

210 215 220

Ile Lys Tyr Val Ala Met Asp Pro Ala Ser Lys Ser Ser Gln Gly Lys

225 230 235 240

Asn Thr Ser Thr Thr Ser Thr Gly Asn Tyr Asn Phe Leu Ala Gly Arg

245 250 255

Phe Ser His Leu

260

Claims (9)

1. A recombinant human tumor necrosis factor alpha-induced protein 6 double-antibody sandwich ELISA method quantitative detection kit is characterized by comprising an ELISA plate coated with an anti-rhTSG-6 polyclonal antibody, an enzyme-labeled rhTSG-6 polyclonal antibody, an rhTSG-6 protein standard product, a sample diluent, a washing solution, a developing solution A, a developing solution B and a stop solution;

the rhTSG-6 recombinant antigen has the gene SEQUENCE shown in SEQUENCE LISTING 400 <2 >.

2. The kit for quantitative detection by recombinant human tumor necrosis factor-alpha-induced protein 6 double-antibody sandwich ELISA as claimed in claim 1, wherein the rhTSG-6 polyclonal antibody is a refined antibody obtained by purifying antiserum obtained by immunizing Balb/c mice with rhTSG-6 recombinant antigen for multiple times.

3. The kit for quantitative detection of recombinant human tumor necrosis factor-alpha induced protein 6 by the double-antibody sandwich ELISA method according to claim 1, wherein the enzyme-labeled rhTSG-6 polyclonal antibody is antiserum obtained by immunizing a Balb/c mouse with rhTSG-6 recombinant antigen, purified by affinity chromatography, and labeled with horseradish peroxidase (HRP).

4. The kit for quantitatively detecting the recombinant human tumor necrosis factor alpha-induced protein 6 by the double-antibody sandwich ELISA method according to claim 1, wherein the preparation method of the ELISA plate coated with the anti-rhTSG-6 polyclonal antibody comprises the following steps: diluting the refined rhTSG-6 polyclonal antibody with 0.05M carbonate buffer solution, coating the diluted antibody on an enzyme label plate, standing overnight at 4 ℃, sealing the enzyme label plate with 0.01mol/L phosphate buffer solution containing 10% by volume of calf serum and having pH of 7.0, washing, drying, packaging in a packaging bag, and vacuumizing for storage.

5. The kit for quantitatively detecting the recombinant human tumor necrosis factor alpha-induced protein 6 by the double-antibody sandwich ELISA method according to claim 1, wherein the rhTSG-6 protein standard is prepared by mixing rhTSG-6 recombinant antigen with a freeze-drying protective agent and freeze-drying the mixture.

6. The kit for quantitative detection by double-antibody sandwich ELISA as claimed in claim 1, wherein the sample diluent is phosphate buffer solution 0.01mol/L containing 10% by volume of calf serum at pH 7.0; the washing solution is 0.01mol/L phosphate buffer solution containing 0.05 percent of Tween-20 by volume fraction in pH 7.0.

7. The kit for quantitatively detecting the recombinant human tumor necrosis factor alpha-induced protein 6 by the double-antibody sandwich ELISA method according to claim 1, wherein the solution A of the color-developing solution is a solution added with hydrogen peroxide; the color development liquid B is added with a tetramethyl benzidine solution; the stop solution is a 2mol/L sulfuric acid solution.

8. The method for using the recombinant human tumor necrosis factor alpha-inducing protein 6 double-antibody sandwich ELISA quantitative detection kit of any one of claims 1-7 for non-diagnostic purposes, which comprises the following steps:

(1) Diluting the rhTSG-6 protein standard into rhTSG-6 protein standard solutions with a series of concentrations by using a sample diluent;

(2) Adding an hTSG-6 protein standard solution and a sample solution of a sample to be detected into an enzyme label plate coated with a refined rhTSG-6 polyclonal antibody respectively, and adding the hTSG-6 protein standard solution and the sample solution of the sample to be detected into a microporous enzyme label plate according to 100 mu l/hole; standing in 37 deg.C incubator for 30min; discarding the solution, adding 200 μ l/hole of washing solution, washing for 5 times, and drying;

(3) Adding 100 mul/hole of enzyme-labeled anti-rhTSG-6 polyclonal antibody diluted by 1; discarding the solution, adding 200 μ l/hole of washing solution, washing for 5 times, and drying;

(4) Adding 50 mul/hole of color development liquid B, adding 50 mul/hole of color development liquid A, tapping the plate frame, mixing uniformly, and reacting for 10min at room temperature in a dark place;

(5) Adding 50 mul/hole of stop solution to stop reaction, and immediately measuring the absorbance value at 450nm on an enzyme-linked immunosorbent assay (ELISA) instrument;

(6) And drawing a standard curve by taking the negative logarithm of the concentration of the rhTSG-6 protein standard solution as an abscissa and the logarithm of the absorbance value as an ordinate, solving a linear regression equation, and substituting the absorbance value in the hole of the sample to be detected into the standard curve to obtain the concentration of the rhTSG-6 in the sample to be detected.

9. A non-diagnostic purpose recombinant human tumor necrosis factor alpha-induced protein 6 quantitative detection method, characterized in that, the recombinant human tumor necrosis factor alpha-induced protein 6 double antibody sandwich ELISA quantitative detection kit of any claim 1-7 is used for quantitative detection.

Images