CN100368437C - Recombinant antigen protein for diagnosing ox tuberculosis and its prepn process - Google Patents
Recombinant antigen protein for diagnosing ox tuberculosis and its prepn process Download PDFInfo
- Publication number
- CN100368437C CN100368437C CNB2005100050020A CN200510005002A CN100368437C CN 100368437 C CN100368437 C CN 100368437C CN B2005100050020 A CNB2005100050020 A CN B2005100050020A CN 200510005002 A CN200510005002 A CN 200510005002A CN 100368437 C CN100368437 C CN 100368437C
- Authority
- CN
- China
- Prior art keywords
- antigen protein
- gene
- mpb70
- mpb83
- esat
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Abstract
The present invention discloses a novel recombinant antigen protein for diagnosing bovine tuberculosis. The recombinant antigen protein is a fusion protein formed by orderly connecting Mycobacterium bovis MPB70 antigen protein, MPB83 antigen protein and ESAT-6 antigen protein, wherein the MPB70 antigen protein possesses the amino acid sequence as shown in the sequence list of SEQ ID No. 1, the MPB83 antigen protein possesses the amino acid sequence as shown in the sequence list of SEQ ID No. 2, and the ESAT-6 antigen protein possesses the amino acid sequence as shown in the sequence list of SEQ ID No. 3. Experiments show that the recombinant antigen protein has the advantages of high sensitivity and specificity in diagnosing bovine tuberculosis, so that the present invention has a wide application prospect in diagnosing bovine tuberculosis.
Description
Technical field
The present invention relates to a kind of recombinant antigen protein, relate in particular to recombinant antigen protein of a kind of diagnosing ox tuberculosis and preparation method thereof.
Background technology
Tuberculosis is the general name of the various disease that caused by mycobacterium tuberculosis complex, and this compound group comprises bacillus tuberculosis typus humanus, Mycobacterium bovis, mycobacterium africanum and mycobacterium microti.Bovine tuberculosis (bovine tuberculosis) is the chronic expendable transmissible disease of a kind of infecting both domestic animals and human of being caused by Mycobacterium bovis (Mycobacterium bovis) and mycobacterium tuberculosis (Mycobacterium tuberculosis), can infect to human or other animals by ill domestic animal.Bovine tuberculosis all has generation in countries in the world, still be modal multiple disease in China, and bovine tuberculosis has numerous host ranges, almost can infect all warm-blooded vertebrates.The popular sustainable and healthy development that not only seriously has influence on livestock industry of the infection of bovine tuberculosis, more human physical and mental health in serious threat.
Owing to milk cow and people's relation is closer, and the morbidity of bovine tuberculosis is quite high, and therefore, milk cow is to propagate tuberculosis to give the most dangerous human animal, contacts or eats accidentally the people who contains tubercule bacillus milk with sick ox for a long time and all might infect tuberculosis.An external report shows that in 100 tuberculosis patients, it is by animal infected that 26 examples are arranged.Wherein, accounted for 20 examples unexpectedly below 15 years old, they all with drink the milk that contains tubercule bacillus accidentally or contact relevant closely with animal.This shows that bovine tuberculosis is the contagium of other animal tuberculosis maximums.Report: have been found that Mycobacterium bovis can infected person and cause pneumonia and lung infects outward.But bovine tuberculosis infects the special population (being those edible milk preparations without pasteurization) that generally occurs in not too flourishing country and developed country.In 1931 tuberculosis cases in San Diego, 7% isolated strains is confirmed as Mycobacterium bovis.These cases of infection dairy products rough with having eaten disinfectant not has relation.Among these patients 53% are that lung infects outward, and isolating 33% bacterial strain is a Mycobacterium bovis from children.People's infected cattle another kind of source lungy is and the contacting of infection animal, as meatworker, animal doctor and animal training person.In the middle of these workmans that this disease takes place, being confirmed to be with the propagation of spittle form is most probable route of infection.
At those also in the country of popular bovine tuberculosis, the human threat that is subjected to this disease all the time, unless eliminate bovine tuberculosis, human control lungy is that success will follow.Therefore, The World Health Organization (WHO) in 1993 announces that tuberculosis is in the global emergency state.So, fundamentally control the generation of bovine tuberculosis and popular, must strengthen research to this sick diagnostics and comprehensive preventive health measures, thereby for control with eliminate bovine tuberculosis technical support is provided.
The diagnostic method of bovine tuberculosis has bacteriological method, molecular biology method and immunological method etc.Case definition is still clinical symptom and microbial culture and the smear for microscopic examination that depends on the patient at present.But the incubation time of mycobacterium tuberculosis is longer, needed for 5～8 weeks approximately, and culture success ratio also has only about 80%.Though and molecular biology method specificity and susceptibility are higher, only are suitable for laboratory operation and are unsuitable for clinical application.Amynologic diagnostic method comprises that tuberculin skin test (TST) is transformation reactions diagnostic method, ELISA method and complement fixation test (CFT) etc.Early stage tuberculin is to be led in the liquid by glycerine or comprehensive Soviet Union to cultivate, and gets its degerming filtrate concentrating and forms, and this is ot (OT).People in 1932 have found that on the basis of old tuberculin purified tuberculin is purified protein derivative (PPD), has improved the susceptibility of this reaction to a certain extent with this as skin reaction reagent.
Though PPD is called purified protein derivative, it is actually a kind of quite complicated mixture, includes multiple antigenic component.At present, many scholars are being devoted to seek one or more mycobacterium tuberculosis specific antigenss as tuberculosis effective diagnosis reagent.The antigen that has been used at present the tubercule bacillus diagnosis mainly contains ESAT-6, MPT32, Ag85, MPB70, MPB83, MPT51, MTC28, MPT64,19KD antigen, MPT63,38KD antigen, KatG, GroES and 35KD antigen.
The researchist is by having identified and isolated the albumen that a kind of molecular weight is 6KD in the tubercule bacillus culturing filtrate, with its called after ESAT-6.Pollock in 1997 and Andersen confirm that ESAT-6 is the metainfective a kind of important T cellular targets antigen of Mycobacterium bovis, also are the major antigens that stimulates IFN～γ to reply.And confirm that this kind low molecular weight antigen is not present in the environment mycobacterium.Studies have shown that further EAST-6 exists only in mycobacterium tuberculosis group and a few the pathogenic mycobacterium.This proteic gene of encoding lacks (except that mycobacterium kansasii, seawater mycobacterium and Su Jia branch bacillus) in the non-virulent mycobacterium more than 90%, in addition this gene in all BCG, also all lack as.Mortenharboe etc. utilize the monoclonal antibody HYB76-8 of ESAT-6 that 11 different samples are carried out SDS-PAGE and immunoblotting detects, discovery has only mycobacterium tuberculosis H37RV pearl, Mycobacterium bovis AN5 and 3 samples of Ravenel strain the purpose band to occur at the 6KD place, BCG bacterial strain and some other environment mycobacterium different strains to other 8 different sourcess have carried out Souther blotting and pcr analysis, and the result proves that all ESAT-6 antigen is the optimal candidate antigen of difference tubercule bacillus and non-tuberculous mycobacteria.These results of study have promoted the progress of ESAT-6 as the tubercule bacillus diagnostic reagent greatly.
ESAT-6 is one of main target antigen of immunological memory T effector cell, can be at subinfection again early stage, induce it to rise in value rapidly and discharge high-caliber IFN～γ, effective activating macrophage, controlling tuberculosis infects.Recent studies show that, tuberculosis sufferer ox has the immunne response of height to ESAT-6, and has only the IFN～γ of background concentration in the animal blood of fowl type tubercule bacillus sensitization.The application of ESAT-6 has significantly improved the specificity of IFN～γ test, and susceptibility decreases.Compare with PPD-IFN～γ, its susceptibility is about 84～88%, and its specificity is then very high, can reach 99%～100%.IFN～γ is to the no significant difference between tuberculosis patient and healthy BCG immunization person of replying of PPD, and its IFN～γ of healthy person that did not inoculate BCG to replying of PPD be starkly lower than the above two (P＜0.01).Except that ESAT-6, investigators have found a kind of tubercle bacillus specific antigen again in tubercule bacillus filtrate, its molecular weight is 10KD, called after CFP10, the ESAT-6 gene is positioned at the RD1 district, the CFP10 gene also belongs to ESAT-6 gene family member, and the CFP10 gene has identical operon with the ESAT-6 gene.
PPD can not differentiate that the DTH that TB infection, mycobacterium avium sensitization and BCG immunity produce replys, ESAT-6 and CFP10 then can, but compare with ESAT-6, have the minority animal when mycobacterium avium sensitization and BCG immunity, can produce slight non-specific positive DTH reaction CFP10.The response rate that studies show that IFN～γ under stimulating with PPD of Laurens.A.H.Van Pinxteren etc. is 95%, and ESAT-6 and CFP10 are 60%, and the ESAT-6-CFP10 recombinant chou is 70%; Ox then is 75%, and ESAT-6 and CFP10 are respectively 70% and 40%, and the ESAT-6-CFP10 recombinant chou then is 75%, and is close with PPD.IFN～γ replys significant difference between tuberculosis patient and healthy person (P＜0.01) to the ESAT-6-CFP10 recombinant protein.In TB patient, IFN～γ is not remarkable to difference between PPD and reorganization the replying of ESAT-6-CFP10, but in healthy person, and both are replied difference very significantly (P＜0.0001).
Secretory volume with IFN～γ under the antigenic stimulation is a standard greater than 300pg/ml, and the susceptibility of PPD is 91%, but specificity is 0.The specificity of ESAT-6-CFP10 recombinant antigen and susceptibility are respectively 73% and 71%, if is that then susceptibility and specificity are respectively 82% and 7% to standard with the secretory volume of IFN～γ greater than 100pg/ml, ESAT-6-CFP10 then is 73% and 93%, sensitivity differences between PPD and the recombinant antigen is not remarkable thus, and the difference between specificity is very significantly (P＜0.0001) then.As seen tubercle bacillus specific antigen ESAT-6 and CFP10 have incomparable advantages such as other diagnostic reagent such as PPD.
Except that ESAT-6 and CFP10, the antigen of purifying in the tubercule bacillus culturing filtrate also has MPB59, MPB64, MPB70, MPB80, MPB83, Ag85 etc., and wherein research is MPB70 and Ag85 comparatively widely.
MPB70 is that its molecular weight is 22KD by a kind of height bacterial classification specific proteins of separating in the tubercule bacillus culturing filtrate.Wherein a kind of composition among the PPD is MPB70, and it also is a kind of main antigen protein in the Mycobacterium bovis BCG strain in addition.The Mycobacterium bovis tuerculoderma stimulates the immunity system of infection animal,, can make anti-MPB70 antibody horizontal rising rapidly in a short time in the serum under certain condition.Find that in tuerculoderma MPB70 is a kind of Mycobacterium bovis BCG specific antigens of strictness, MPB70 can induce the DTH reaction in the cavy body of Mycobacterium bovis BCG sensitization, then can not induce this reaction in the cavy body of H37RV and mycobacterium kansasii sensitization.This explanation MPB70 has the bacterial classification specificity.The antibody ELISA test at MPB70 of the animal body generation of Mycobacterium bovis, avian tuberculosis mycobacterium, mycobacterium paratuberculosis and Corynebacterium pseudotuberculosis has been infected in contrasts such as Morten Harboe, finds that the MPB70 antibody population is a high special for the animal of infected cattle mycobacterium.The test-results of P.R.Wood etc. shows that the specificity of MPB70--ELISA test is 96.1%, but its susceptibility is lower, has only 18.1%.And specificity and the susceptibility of the IFN～γ that carries out with MPB70 can reach 99.1% and 81.8% respectively.
At present, people mainly concentrate on analysis to its antigen " cocktail " to the multiple antigenic research of tubercule bacillus.Through studies confirm that in a large number: the cocktail tuerculoderma all is eager to excel than any single antigen, and strengthens along with increasing of antigen quantity.With the cavy is the analysis revealed that laboratory animal carries out, and the multiple antigen of using " cocktail " formula is feasible as the tubercule bacillus diagnostic reagent.The T cell quantity that " cocktail " antigen is replied is significantly many than the amount that a kind of antigen is wherein replied.The specific antigens of tubercule bacillus " cocktail " formula can be induced the DTH reaction in mycobacterium bovis BCG BCG immunized mice body, but does not have this reaction in fowl type mycobacterium immunization experiment animal body.
In addition, in the serological method of tubercule bacillus diagnosis, the multiple antigen of " cocktail " formula is used the raising that also helps this method specificity and susceptibility.Serological test need be identified the wherein existence of pathogenic bacterium unlike bacteriological method, only needs the detection body that the immunne response of tubercule bacillus is got final product.Easy, rapid, the required cost of serological method is less, and this method can be differentiated apparent infection and inapparent infection.The understanding that people reply mycobacterium tuberculosis antibody all comes from serological test, finds that in this process single antigen can't produce gratifying serodiagnosis result.The susceptibility of serological test in the positive pulmonary bacillus of phlegm smear as immunodominance antigen 38KD is 80%, and only is 15% in negative case.Maria Laura Gennaro carries out the ELISA test with different single antigen and multiple antigen mixture as envelope antigen, the result shows that the ELISA test of carrying out with single antigen has only a few antigen such as 38KD, 14KD, ESAT-6 and MPT32 to have relative higher susceptibility, and all have higher susceptibility with the ELISA test that multiple antigen mixture carries out, wherein best with 6 kinds of antigen blended results.Proved further that with the advantage place of multiple antigen cocktail this transfers to the emphasis of research on the multiple antigen with regard to forcing people as diagnostic reagent.
Up to the present, OIE (OIE) recommends the diagnostic method of bovine tuberculosis to have only tuberculin (PPD) transformation reactions.This method plays an important role in the diagnosis of bovine tuberculosis and anti-system process, many countries of the U.S. and the European Community utilize this method to eliminate and controlled bovine tuberculosis, to such an extent as to now OIE (OIE) still with this method as the legal quarantine method of bovine tuberculosis.But there are many drawbacks in this diagnostic method, except that physics and factor chemistry, more is the interference of atypia mycobacterium, often causes the generation of non-specific responding.Along with severity, the non-specific responding of this method are more and more heavier, to such an extent as to the specificity of this method greatly reduces.Therefore, the diagnostic antigen of seeking special sensitivity has become the importance of diagnosing bovine tuberculosis technical study.
In the tubercule bacillus serological test, ELISA has vital role as the supplementary test of IT (traditional tubercule bacillus test) for discriminating IT feminine gender and false negative reaction.Some countries in the west, the application of ELISA diagnostic method in tubercule bacillus epidemiology detects reduced greatly to the spending of bovine tuberculosis control with the elimination plan, reports that the susceptibility of ELISA test in the tubercule bacillus diagnosis has only 47.5% but have simultaneously.Carry out the ELISA test with multiple antigen " cocktail " and be expected to improve the susceptibility of its reaction.
Carry out susceptibility and the specificity that diagnosing bovine tuberculosis is expected to improve its reaction with " cocktail " multiple antigen.Use many antigens and carry out the research of diagnostic reagent, multiple antigen need be expressed respectively and purifying (or purifying respectively), not only time-consuming, effort, but also have the problem of cooperation ratio inequality, this might influence the susceptibility and the specific problem of diagnostic method.
Summary of the invention
Technical problem to be solved by this invention is to overcome the deficiencies in the prior art, provides a kind of susceptibility and specificity high diagnosing bovine tuberculosis antigen protein.
Technical problem to be solved by this invention realizes by following technological approaches:
A kind of recombinant antigen protein of diagnosing ox tuberculosis, it is to be connected successively and the fusion rotein that forms by Mycobacterium bovis MPB70 antigen protein, MPB83 antigen protein and ESAT-6 antigen protein, wherein said MPB70 antigen protein has the aminoacid sequence shown in the sequence table SEQ ID NO:1, described MPB83 antigen protein has the aminoacid sequence shown in the sequence table SEQ ID NO:2, and described ESAT-6 antigen protein has the aminoacid sequence shown in the sequence table SEQ ID NO:3.
Described recombinant antigen protein is characterized in that having the connection peptides sequence (SPGS-) between MPB70 antigen protein and the MPB83 antigen protein and between MPB83 antigen protein and the ESAT-6 antigen protein.
Another technical problem to be solved by this invention provides a kind of method for preparing the recombinant antigen protein of described diagnosing ox tuberculosis.
Another technical problem to be solved by this invention realizes by following technological approaches:
A kind of method for preparing the recombinant antigen protein of diagnosing ox tuberculosis, step is as follows:
1) utilizes the nucleotides sequence shown in sequence table SEQ ID NO:5 and the SEQ ID NO:6 to classify primer as, amplify the MPB70 gene; Utilize the nucleotides sequence shown in sequence table SEQ ID NO:7 and the SEQ ID NO:8 to classify primer as, amplify the MPB83 gene; Utilize the nucleotides sequence shown in sequence table SEQ ID NO:9 and the SEQ IDNO:10 to classify primer as, amplify the ESAT-6 gene,
2) classifying primer as with SEQ ID NO:5 and SEQ ID NO:8 nucleotides sequence, is template with MPB70 gene and MPB83 gene, carries out pcr amplification,
3) recycling step 2) pcr amplification product, the pcr amplification product that reclaims is carried out double digestion with restriction enzyme, be connected with the expression vector of cutting processing through same enzyme then, be transformed in the recipient bacterium, obtain to contain the recombinant expression vector of MPB70-MPB83 polyphone gene.
4) be connected, transform and express with the ESAT-6 gene of cutting processing through same enzyme after will containing the recombinant plasmid double digestion of MPB70-MPB83 polyphone gene, promptly expressed recombinant protein collection, purifying.
Among the above-mentioned preparation method, wherein amplification MPB70 gene, MPB83 gene and the used template of ESAT-6 gene are Mycobacterium bovis Vallee strain gene group DNAs in the step 1); In the step 3) MPB70-MPB83 gene that reclaims is carried out enzyme with restriction enzyme KpnI and BamHI respectively and cut, be connected with the expression vector pET32a that cuts processing through same enzyme then, be transformed in the DE3 recipient bacterium; The recombinant plasmid that will contain MPB70-MPB83 polyphone gene in the step 4) with BamHI with after EcoRI carries out double digestion with pass through same enzyme and cut the ESAT-6 gene of processing and be connected.
Above-mentioned preparation method places the expression of contacting of same expression vector with multiple antigen, this has not only solved many antigens and has expressed problems such as, effort time-consuming with purifying respectively, but also solved the problem of proportioning inequality, help improving the susceptibility and the specificity of diagnostic method.Simultaneously, between each antigen gene, added connection peptides, can make each antigen protein independently bring into play function separately and do not influence each other, have susceptibility and specificity advantages of higher so compare with existing diagnosing bovine tuberculosis antigen protein, aspect diagnosing bovine tuberculosis, be with a wide range of applications by the prepared diagnosing bovine tuberculosis recombinant antigen protein of the inventive method.Recombinant protein antigen of the present invention can be used for bovine tuberculosis ELISA and the allergic diagnostic antigen of skin test.
Description of drawings
The pcr amplification result of Fig. 1 MPB70-MPB83 polyphone gene
The pcr amplification product of A:MPB70-MPB83 two gene polyphone, B:DL2000marker.
The enzyme of Fig. 2 MPB70-MPB83 polyphone two gene recombinant plasmid is cut evaluation
A:DL2000marker, the enzyme of B:MPB70-MPB83 polyphone two gene recombinant plasmid is cut.
The enzyme of Fig. 3 MPB70-MPB83-ESAT-6 three genes polyphone recombinant plasmid is cut evaluation
A:DL2000marker, the enzyme of B:MPB70-MPB83-ESAT-6 three genes polyphone recombinant plasmid is cut.
The expression of Fig. 4 three genes polyphone recombinant plasmid
A: molecular weight marker in the protein, B and C: bacterium cracking supernatant, D and E: full bacterium lysate, F:pET32a vehicle Control.
Further describe beneficial effect of the present invention by the following examples, it should be understood that these embodiment only are used for the purpose of illustration, never limit protection scope of the present invention.
Embodiment
The preparation of [embodiment] diagnosing bovine tuberculosis recombinant antigen protein of the present invention
The pcr amplification of MPB70 gene: Mycobacterium bovis Vallee strain gene group DNA (Chinese biological drug inspection office) 1ul, each 1ul (MPB70-F:AGGGTACCATGGAATACGCGGCAGCCAAT of primer MPB70-F and MPB70-R, SEQ ID NO:5, MPB70-R:GGAACCTGGAGACGCCGGAGGCATTAG, SEQ ID NO:6), primer concentration is 20pMol, 10 * TagDNA polysaccharase Buffer5ul, 2.5mM dNTP3ul, pfu TagDNA polysaccharase 0.5ul, supply with water, reaction system is 50ul, carries out pcr amplification then.Amplification PCR products is 483bp.The condition of PCR reaction is: 95 ℃ of sex change 5 minutes, and 94 ℃ of sex change 1 minute, 65 ℃ of annealing 1 minute, 72 ℃ were extended 1 minute, 30 circulations, 72 ℃ were extended 10 minutes.Ward off at 1.5% agar and to carry out electrophoresis on the gel, 100V voltage is observations after 20 minutes.Reclaim test kit with glue then and carry out the recovery of MPB70 gene.
The pcr amplification of MPB83 gene: Mycobacterium bovis Vallee strain gene group DNA 1ul, each 1ul of primer MPB83-F and MPB83-R
(MPB83-F:TCTCCAGGTTCCATCAACGTTCAGGCCAAAC, SEQ IDNO:7, MPB83-R:TGTGGATCCCGGAGACACCGTATCGATCAT, SEQ IDNO:8), primer concentration is 20pMol, and 10 * TagDNA polysaccharase Buffer5ul, 2.5mM dNTP3ul, pfu TagDNA polysaccharase 0.5ul supply with water, reaction system is 50ul, carries out pcr amplification then.Amplification PCR products is 669bp.The condition of PCR reaction is: 95 ℃ of sex change 5 minutes, and 94 ℃ of sex change 1 minute, 65 ℃ of annealing 1 minute, 72 ℃ were extended 1 minute, 30 circulations, 72 ℃ were extended 10 minutes.Ward off at 1.5% agar and to carry out electrophoresis on the gel, 100V voltage is observations after 20 minutes.Use glue recovery test kit then and carry out the recovery of MPB83 gene.
The pcr amplification of ESAT-6 gene: Mycobacterium bovis Vallee strain gene group DNA 1ul, each 1ul of primer ESAT-6-F and ESAT-6-R
(ESAT-6-F:ACGGGATCCGAGCAGCAGTGGAATTTC, SEQ ID NO:9, ESAT-6-R:GCCGAATTCCTATGCGAACATCCCAGTG, SEQ ID NO:10), primer concentration is 20pMol, and 10 * TagDNA polysaccharase Buffer5ul, 2.5mM dNTP3ul, pfuTagDNA polysaccharase 0.5ul supply with water, reaction system is 50ul, carries out pcr amplification then.Amplification PCR products is 288bp.The condition of PCR reaction is: 95 ℃ of sex change 5 minutes, and 94 ℃ of sex change 1 minute, 63 ℃ of annealing 1 minute, 72 ℃ were extended 1 minute, 30 circulations, 72 ℃ were extended 10 minutes.Ward off at 1.5% agar and to carry out electrophoresis on the gel, 100V voltage is observations after 20 minutes.Use glue recovery test kit then and carry out the recovery of ESAT-6 gene.
The polyphone of MPB70 gene and MPB83 gene: the MPB70PCR product of recovery and each 1ul of MPB83PCR product, primer MPB70-F:AGGGTACCATGGAATACGCGGCAGCCAAT, MPB83-R:TGTGGATCCCGGAGACACCGTATCGATCAT, each 1ul of primer, 10 * TagDNA polysaccharase Buffer 5ul, 2.5mM dNTP 3ul, Ex TagDNA polysaccharase 0.5ul, supply with water, reaction system is 50ul, carries out pcr amplification then.Amplification PCR products is 1152bp.The condition of PCR reaction is: 95 ℃ of sex change 5 minutes, and 94 ℃ of sex change 1 minute anneals 1.5 minutes, and 72 ℃ were extended 2 minutes, 30 circulations, 72 ℃ of extensions 10 minutes.Ward off at 1.5% agar and to carry out electrophoresis on the gel, 100V voltage is observations after 20 minutes.Use glue recovery test kit then and carry out the recovery of MPB70-MPB83 gene.The result: pcr amplification goes out the dna segment (see figure 1) of 1152bp, conforms to the size of actual design.
The MPB70-MPB83 digenic molecular cloning of contacting: the MPB70-MPB83 gene that reclaims is carried out enzyme with restriction enzyme KpnI and BamHI respectively cut, be connected then with through the same expression vector pET32a that handles, be transformed in the DE3 recipient bacterium, through the evaluation of plasmid extraction and recombinant plasmid, obtain to contain the recombinant expression vector of MPB70-MPB83 polyphone gene.Result: cut evaluation (see figure 2) and sequencing through enzyme, show to successfully construct and contain the placed in-line recombinant expression vector of two gene.
The trigenic molecular cloning of polyphone of described MPB70 gene, MPB83 gene and ESAT-6 gene:
The recombinant plasmid that will contain MPB70-MPB83 polyphone gene carries out enzyme with BamHI and EcoRI and cuts the back and be connected, transform and express through the same ESAT-6 gene of handling.
Result: cut evaluation (as shown in Figure 3) and sequencing (nucleotide sequence shown in the SEQ ID NO:4) through enzyme, show to successfully construct and contain the placed in-line recombinant expression vector of three genes, process IPTG induces and has carried out expressing (as shown in Figure 4), and the recombinant protein of expression conforms to the size of actual design.Bacterium liquid after IPTG induced carries out ultrasonic treatment through after centrifugal, the washing, collects supernatant liquor behind the high speed centrifugation, uses affinity column and carries out purifying, measures the protein concentration behind the purifying, and the protein concentration of mensuration is: 0.2mg/ml.Albumen behind the purifying places-70 ℃ of preservations.
The diagnosis effect test of [test example] recombinant antigen protein of the present invention
Behind the recombinant protein purification that the embodiment of the invention is expressed, purified recombinant protein can be used as the diagnostic antigen of ELISA, is used for the detection of clinical sample, can reach the multiple antigenic diagnosis effect of " cocktail " formula.
The ELISA trace routine:
1, will wrap by elisa plate (Nunco company) after the carbonate buffer solution dilution of the recombinant antigen behind the purifying with pH9.5,50 μ l/ holes, 4 ℃ are spent the night;
2, get rid of liquid next day, add 3% gelatin (Sigma) and seal, the 37 ℃ of wet box 1h in 100 μ l/ holes;
3, get rid of liquid after the taking-up, use the PBST of pH7.6 to wash the each 3min in 200 μ l/ holes 3 times;
4, add with the serum to be checked after the PBST dilution, the 37 ℃ of wet box 1h in 50 μ l/ holes set up positive control, negative control and blank simultaneously;
5, get rid of liquid after the taking-up, use the PBST of pH7.6 to wash the each 3min in 200 μ l/ holes 3 times;
6, two anti-(the Sigma companies) that add the anti-ox of rabbit of using horseradish peroxidase (HRP) mark, 50 μ l/ holes, 37 ℃ of wet box 1h;
7, get rid of liquid after the taking-up, use the PBST of pH7.6 to wash the each 3min in 200 μ l/ holes 3 times;
8, add substrate 50 μ l/ holes, the lucifuge room temperature is placed the 10min colour developing;
9, add 50 μ l/ hole 2M H2SO4 termination reactions, 495nm measures the OD value.
10, the result judges: OD＞0.5 is positive, and OD＜0.5 is negative
Test-results sees Table 1.
The ELISA diagnosis effect test of table 1 recombinant antigen protein of the present invention
| Ox number only | Positive control | Negative control | Substrate stop buffer blank | For test agent |
| 1 | 1.711 | 0.213 | 0.075 | 0.587 |
| 1 | 1.711 | 0.213 | 0.075 | 0.427 |
| 3 | 1.711 | 0.213 | 0.075 | 0.986 |
| 3 | 1.711 | 0.213 | 0.075 | 0.467 |
| 3 | 1.711 | 0.213 | 0.075 | 0.394 |
| 4 | 1.711 | 0.213 | 0.075 | 0.414 |
| 4 | 1.711 | 0.213 | 0.075 | 0.600 |
| 4 | 1.711 | 0.213 | 0.075 | 0.207 |
| 4 | 1.711 | 0.213 | 0.075 | 0.735 |
| 5 | 1.711 | 0.213 | 0.075 | 0.356 |
| 5 | 1.711 | 0.213 | 0.075 | 0.177 |
| 5 | 1.711 | 0.213 | 0.075 | 0.211 |
| 5 | 1.711 | 0.213 | 0.075 | 0.409 |
| 7 | 1.711 | 0.213 | 0.075 | 0.241 |
| 7 | 1.711 | 0.213 | 0.075 | 0.301 |
| 7 | 1.711 | 0.213 | 0.075 | 0.209 |
| 8 | 1.711 | 0.213 | 0.075 | 0.294 |
| 8 | 1.711 | 0.213 | 0.075 | 0.321 |
| 8 | 1.711 | 0.213 | 0.075 | 0.335 |
| 8 | 1.711 | 0.213 | 0.075 | 0.308 |
| 9 | 1.711 | 0.213 | 0.075 | 0.218 |
| 9 | 1.711 | 0.213 | 0.075 | 0.244 |
| 9 | 1.711 | 0.213 | 0.075 | 0.343 |
Illustrate: the numerical result for test agent is positive more than or equal to 0.5
The result shows: adopt the recombinant expressed protein of the present invention as antigen, available indirect ELISA test method detects bovine tuberculosis, detected result accuracy rate height illustrates that recombinant protein antigen of the present invention has very high specificity and susceptibility, can be used for the serodiagnosis of bovine tuberculosis.In addition, this recombinant antigen also can be used as and is used for the allergic diagnostic antigen of bovine tuberculosis skin test.
Sequence table
SEQUENCE LISTING
＜110〉the Chinese Academy of Agricultural Sciences Harbin veterinary institute
＜120〉recombinant antigen protein of a kind of diagnosing ox tuberculosis and preparation method thereof
<130>20050127
<160>10
<170>PatentIn version 3.3
<210>1
<211>156
<212>PRT
<213>Mycobacterium bovis
<400>1
Gly Thr Glu Tyr Ala Ala Ala Asn Pro Thr Gly Pro Ala Ser Val Gln
1 5 10 15
Gly Met Ser Gln Asp Pro Val Ala Val Ala Ala Ser Asn Asn Pro Glu
20 25 30
Leu Thr Thr Leu Thr Ala Leu Ser Ala Gly Gln Leu Asn Pro Gln Val
35 40 45
Asn Leu Val Asp Thr Leu Asn Ser Gly Gln Tyr Thr Val Phe Ala Arg
50 55 60
Thr Ash Ala Ala Phe Ser Lys Leu Pro Ala Ser Thr Ile Asp Glu Leu
65 70 75 80
Lys Thr Asn Ser Ser Leu Leu Thr Ser Ile Leu Thr Tyr His Val Val
85 90 95
Ala Gly Gln Thr Ser Pro Ala Asn Val Val Gly Thr Arg Gln Thr Leu
100 105 110
Gln Gly Ala Ser Val Thr Val Thr Gly Gln Gly Asn Ser Leu Lys Val
115 120 125
Gly Asn Ala Asp Val Val Cys Gly Gly Val Ser Thr Ala Asn Ala Thr
130 135 140
Val Tyr Met Ile Asp Ser Val Leu Met Pr0 Pr0 Ala
Breathe out beast and grind sequence table
145 150 155
<210>2
<211>213
<212>PRT
<213>Mycobacterium bovis
<400>2
Ile Asn Val Gln Ala Lys Pro Ala Ala Ala Ala Ser Leu Ala Ala Ile
1 5 10 15
Ala Ile Ala phe Leu Ala Gly Cys Ser Ser Thr Lys Pro Val Ser Gln
20 25 30
Asp Thr Ser Pro Lys Pro Ala Thr Ser Pro Ala Ala Pro Val Thr Thr
35 40 45
Ala Ala Met Ala Asp Pro Ala Ala Asp Leu Ile Gly Arg Gly Cys Ala
50 55 60
Gln Tyr Ala Ala Gln Asn Pro Thr Gly Pro Gly Ser Val Ala Gly Met
65 70 75 80
Ala Gln Asp Pro Val Ala Thr Ala Ala Ser Asn Asn Pro Met Leu Ser
85 90 95
Thr Leu Thr Ser Ala Leu Ser Gly Lys Leu Asn Pro Asp Val Asn Leu
100 105 110
Val Asp Thr Leu Asn Gly Gly Glu Tyr Thr Val Phe Ala Pro Thr Asn
115 120 125
Ala Ala Phe Asp Lys Leu Pro Ala Ala Thr Ile Asp Gln Leu Lys Thr
130 135 140
Asp Ala Lys Leu Leu Ser Ser Ile Leu Thr Tyr His Val Ile Ala Gly
145 150 155 160
Gln Ala Ser Pro Ser Arg Ile Asp Gly Thr His Gln Thr Leu Gln Gly
165 170 175
Ala Asp Leu Thr Val Ile Gly Ala Arg Asp Asp Leu Met Val Asn Asn
180 185 190
Ala Gly Leu Val Cys Gly Gly Val His Thr Ala Asn Ala Thr Val Tyr
195 200 205
Met Ile Asp Thr Val
210
<210>3
<211>93
<212>PRT
<213>Mycobacterium bovis
<400>3
Glu Gln Gln Trp Asn Phe Ala Gly Ile Glu Ala Ala Ala Ser Ala Ile
1 5 10 15
Gln Gly Asn Val Thr Ser Ile His Ser Leu Leu Asp Glu Gly Lys Gln
20 25 30
Ser Leu Thr Lys Leu Ala Ala Ala Trp Gly Gly Ser Gly Ser Glu Ala
35 40 45
Tyr Gln Gly Val Gln Gln Lys Trp Asp Ala Thr Ala Thr Glu Leu Asn
50 55 60
Asn Ala Leu Gln Asn Leu Ala Arg Thr Ile Ser Glu Ala Gly Gln Ala
65 70 75 80
Met Ala Ser Thr Glu Gly Asn Val Thr Gly Met Phe Ala
85 90
<210>4
<211>1419
<212>DNA
<213>Mycobacterium bovis
<400>4
ggtaccgaat acgcggcagc caatcccact gggccggcct cggtgcaggg aatgtcgcag 60
gacccggtcg cggtggcggc ctcgaacaat ccggagttga caacgctgac ggctgcactg 120
tcgggccagc tcaatccgca agtaaacctg gtggac8ccc tcaacagcgg tcagtacacg 180
gtgttcgcac ggaccaacgc ggcatttagc aagctgccgg catccacgat cgacgagctc 240
aagaccaatt cgtcactgct gaccagcatc ctgacctacc acgtagtggc cggccaaacc 300
agcccggcca acgtcgtcgg cacccgtcag accctccagg gcgccagcgt gacggtgacc 360
ggtcagggta acagcctcaa ggtcggtaac gccgacgtcg tctgtggtgg ggtgtctacc 420
gccaacgcga cggtgtacat gattgacagc gtgctaatgc ctccggcgtc tccaggttcc 480
atcaacgttc aggccaaacc ggccgcagca gcgagcctcg cagccatcgc gattgcgttc 540
ttagcgggtt gttcgagcac caaacccgtg tcgcaagaca ccagcccgaa accggcgacc 600
agcccggcgg cgcccgttac cacggcggca atggctgacc ccgcagcgga cctgattggt 660
cgtgggtgcg cgcaatacgc ggcgcaaaat cccaccggtc ccggatcggt ggccggaatg 720
gcgcaagacc cggtcgctac cgcggcttcc aacaacccga tgctcagtac cctgacctcg 780
gctctgtcgg gcaagctgaa cccggatgtg aatctggtcg acaccctcaa cggcggcgag 840
tacaccgttt tcgcccccac caacgccgca ttcgacaagc tgccggcggc cactatcgat 900
caactcaaga ctgacgccaa gctgctcagc agcatcctga cctaccacgt gatagccggc 960
caggcgagtc cgagcaggat cgacggcacc catcagaccc tgcaaggtgc cgacctgacg 1020
gtgataggcg cccgcgacga cctcatggtc aacaacgccg gtttggtatg tggcggagtt 1080
cacaccgcca acgcgacggt gtacatgatc gatacggtgt ctccgggatc cgagcagcag 1140
tggaatttcg cgggtatcga ggccgcggca agcgcaatcc agggaaatgt cacgtccatt 1200
cattccctcc ttgacgaggg gaagcagtcc ctgaccaagc tcgcagcggc ctggggcggt 1260
agcggttcgg aggcgtacca gggtgtccag caaaaatggg acgccacggc taccgagctg 1320
aacaacgcgc tgcagaacct ggcgcggacg atcagcgaag ccggtcaggc aatggcttcg 1380
accgaaggca acgtcactgg gatgttcgca taggaattc 1419
<210>5
<211>29
<212>DNA
<213>Artificial
<220>
<223>
<400>5
agggtaccat ggaatacgcg gcagccaat 29
<210>6
<211>27
<212>DNA
<213>Artificial
<220>
<223>
<400>6
ggaacctgga gacgccggag gcattag
<210>7
<211>31
<212>DNA
<213>Artificial
<220>
<223>
<400>7
tctccaggtt ccatcaacgt tcaggccaaa c
<210>8
<211>30
<212>DNA
<213>Artificial
<220>
<223>
<400>8
tgtggatccc ggagacaccg tatcgatcat
<210>9
<211>27
<212>DNA
<213>Artificial
<220>
<223>
<400>9
acgggatccg agcagcagtg gaatttc
<210>10
<211>28
<212>DNA
<213>Artificial
<220>
<223>
<400>10
gccgaattcc tatgcgaaca tcccagtg
Claims (8)
1. the recombinant antigen protein of a diagnosing ox tuberculosis, it is to be connected successively and the fusion rotein that forms by Mycobacterium bovis MPB70 antigen protein, MPB83 antigen protein and ESAT-6 antigen protein, wherein said MPB70 antigen protein is the aminoacid sequence shown in the sequence table SEQ ID NO:1, described MPB83 antigen protein is the aminoacid sequence shown in the sequence table SEQ ID NO:2, and described ESAT-6 antigen protein is the aminoacid sequence shown in the sequence table SEQ ID NO:3; Wherein connect by-SPGS-peptide sequence respectively between MPB70 antigen protein and the MPB83 antigen protein and between MPB83 antigen protein and the ESAT-6 antigen protein.
2. according to the described recombinant antigen protein of claim 1, it is characterized in that: the MPB70 antigen protein is positioned at the aminoterminal of this recombinant antigen protein, and the ESAT-6 antigen protein is positioned at the carboxyl terminal of this recombinant antigen protein.
3. the gene of any described recombinant antigen protein in the claim 1～2 of encoding.
4. according to the described gene of claim 3, it is characterized in that described gene is the nucleotide sequence shown in the sequence table SEQ IDNO:4.
5. prepare the method for any described recombinant antigen protein in the claim 1～2, step is as follows:
1) utilizes the nucleotides sequence shown in sequence table SEQ ID NO:5 and the SEQ ID NO:6 to classify primer as, amplify the MPB70 gene; Utilize the nucleotides sequence shown in sequence table SEQ ID NO:7 and the SEQ ID NO:8 to classify primer as, amplify the MPB83 gene; Utilize the nucleotides sequence shown in sequence table SEQ ID NO:9 and the SEQ IDNO:10 to classify primer as, amplify the ESAT-6 gene,
2) classifying primer as with SEQ ID NO:5 and SEQ ID NO:8 nucleotides sequence, is template with MPB70 gene and MPB83 gene, carries out pcr amplification,
3) recycling step 2) pcr amplification product, the pcr amplification product that reclaims is carried out double digestion with restriction enzyme, be connected with the expression vector of cutting processing through same enzyme then, be transformed in the recipient bacterium, acquisition contains the recombinant expression vector of MPB70-MPB83 polyphone gene
4) be connected, transform and express with the ESAT-6 gene of cutting processing through same enzyme after will containing the recombinant plasmid double digestion of MPB70-MPB83 polyphone gene, promptly expressed recombinant protein collection, purifying.
6. according to the described preparation method of claim 5, it is characterized in that: in the step 3) MPB70-MPB83 gene that reclaims is carried out enzyme with restriction enzyme KpnI and BamHI respectively and cut, be connected with the expression vector pET32a that cuts processing through same enzyme then, be transformed in the DE3 recipient bacterium.
7. according to the described preparation method of claim 5, it is characterized in that: the recombinant plasmid that will contain MPB70-MPB83 polyphone gene in the step 4) with BamHI with after EcoRI carries out double digestion with pass through same enzyme and cut the ESAT-6 gene of processing and be connected.
8. the purposes of the arbitrary described recombinant antigen protein of claim 1～2 in preparation diagnosing ox tuberculosis medicine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100050020A CN100368437C (en) | 2005-01-28 | 2005-01-28 | Recombinant antigen protein for diagnosing ox tuberculosis and its prepn process |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100050020A CN100368437C (en) | 2005-01-28 | 2005-01-28 | Recombinant antigen protein for diagnosing ox tuberculosis and its prepn process |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1810838A CN1810838A (en) | 2006-08-02 |
| CN100368437C true CN100368437C (en) | 2008-02-13 |
Family
ID=36843972
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2005100050020A Active CN100368437C (en) | 2005-01-28 | 2005-01-28 | Recombinant antigen protein for diagnosing ox tuberculosis and its prepn process |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100368437C (en) |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101533017B (en) * | 2009-04-13 | 2013-04-03 | 中国农业科学院北京畜牧兽医研究所 | Mycobacterium bovis infection detection kit meditated by recombined fusion protein and method thereof |
| CN101732732B (en) * | 2009-12-17 | 2012-10-31 | 中国兽医药品监察所 | Bovine type tuberculin standard substance and preparation method thereof |
| CN102707052B (en) * | 2012-05-11 | 2015-03-11 | 中国农业科学院北京畜牧兽医研究所 | Bovine tuberculosis detection reagent containing recombinant protein mixture |
| CN103333251B (en) * | 2013-04-11 | 2014-08-20 | 广西壮族自治区动物疫病预防控制中心 | Gamma-interferon sandwich ELISA detection method based on recombinant fusion antigen protein |
| CN105181963B (en) * | 2015-07-30 | 2017-08-01 | 西北农林科技大学 | A kind of preparation method of the ELISA detection kit of the pseudo- mycobacterium tuberculosis antibody of goat |
| CN106706906A (en) * | 2016-12-12 | 2017-05-24 | 深圳市绿诗源生物技术有限公司 | Mycobacterium bovis and brucella abortus dual detection card and preparation method thereof |
| CN109813576B (en) * | 2019-03-25 | 2021-04-02 | 中国动物卫生与流行病学中心 | Blood collector for preparing bovine tuberculosis stimulating supernatant |
| CN110596382A (en) * | 2019-09-16 | 2019-12-20 | 南京拜睿生物科技有限公司 | Tuberculosis diagnostic kit and preparation method thereof |
| CN116082514B (en) * | 2021-11-05 | 2024-02-13 | 安博智联(北京)生物科技有限公司 | Mycobacterium tuberculosis specific recombinant fusion protein EM and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1304451A (en) * | 1998-04-07 | 2001-07-18 | 科里克萨公司 | Fusion proteins of i(mycobacterium tuberuculosis) antigens and their uses |
| CN1388378A (en) * | 2002-06-17 | 2003-01-01 | 四川大学 | Tubercle mycobaterium detecting reagent |
| WO2004099771A1 (en) * | 2003-05-08 | 2004-11-18 | Statens Serum Institut | A new specific epitope based immunological diagnosis of tuberculosis |
-
2005
- 2005-01-28 CN CNB2005100050020A patent/CN100368437C/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1304451A (en) * | 1998-04-07 | 2001-07-18 | 科里克萨公司 | Fusion proteins of i(mycobacterium tuberuculosis) antigens and their uses |
| CN1388378A (en) * | 2002-06-17 | 2003-01-01 | 四川大学 | Tubercle mycobaterium detecting reagent |
| WO2004099771A1 (en) * | 2003-05-08 | 2004-11-18 | Statens Serum Institut | A new specific epitope based immunological diagnosis of tuberculosis |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1810838A (en) | 2006-08-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN100368437C (en) | Recombinant antigen protein for diagnosing ox tuberculosis and its prepn process | |
| Aagaard et al. | Detection of bovine tuberculosis in herds with different disease prevalence and influence of paratuberculosis infection on PPDB and ESAT-6/CFP10 specificity | |
| Ayoub et al. | Evaluation of the streptococcal desoxyribo-nuclease b and diphosphopyridine nucleotidase antibody tests in acute rheumatic fever and acute glomerulonephritis | |
| Monteville et al. | Fibronectin-facilitated invasion of T84 eukaryotic cells by Campylobacter jejuni occurs preferentially at the basolateral cell surface | |
| CN101221173A (en) | ELISpot tuberculosis infection diagnostic reagent kit and its application | |
| Diaz et al. | Use of the immunodominant 18-kiloDalton small heat shock protein as a serological marker for exposure to Mycobacterium ulcerans | |
| CN102735851A (en) | Mycoplasma hyopneumoniae multi-recombination antigen ELISA (enzyme-linked immunosorbent assay) detection kit | |
| Jones et al. | Simultaneous measurement of antigen-stimulated interleukin-1β and gamma interferon production enhances test sensitivity for the detection of Mycobacterium bovis infection in cattle | |
| CN101294964A (en) | Reagent and method for detecting active tuberculosis and tuberculosis dormant infection | |
| Shin et al. | Mycobacterium tuberculosis HBHA protein reacts strongly with the serum immunoglobulin M of tuberculosis patients | |
| Naseri et al. | Prevalence of the most common virulence-associated genes among Brucella Melitensis isolates from human blood cultures in Hamadan Province, West of Iran | |
| CN101182350A (en) | Micrococcus pyogenes alpha-hemolysin and coded sequence thereof | |
| Dernivoix et al. | Field performance of six Mycobacterium avium subsp. paratuberculosis antigens in a 20 h interferon gamma release assay in Belgium | |
| CN101493454A (en) | Tuberculosis antigen specific whole blood IFN-gamma diagnosis kit, method for producing the same and method for using same | |
| Elnaker et al. | Seroprevalence and molecular characterization of Mycobacterium bovis infection in camels (Camelus dromedarius) in the Delta region, Egypt | |
| CN101492497A (en) | Expression purification process for tubercle bacillus differential recombinant protein and uses thereof | |
| CN107141341B (en) | Antigen polypeptide pool for detecting mycobacterium tuberculosis infection and application | |
| WO1991014448A1 (en) | New proteins, peptides and corresponding dna or rna sequences and probes useful for diagnosing tuberculosis | |
| Mon et al. | Evaluation of cocktails with recombinant proteins of Mycobacterium bovis for a specific diagnosis of bovine tuberculosis | |
| Kawaji et al. | Evaluation of the immunogenicity of Mycobacterium avium subsp. paratuberculosis (MAP) stress-associated recombinant proteins | |
| Hall et al. | A comparative study of Fusobacterium necrophorum strains from human and animal sources by phenotypic reactions, pyrolysis mass spectrometry and SDS-PAGE | |
| CN101805723A (en) | Anti-glutamate dehydrogenase protein monoclonal antibody, preparation method thereof and use thereof | |
| CN102692509B (en) | Method for diagnosing bovine tuberculosis mediated by recombinant protein mixture and regent thereof | |
| Corner et al. | Identification of Mycobacterium bovis isolates using a monoclonal antibody | |
| KR100968069B1 (en) | Protein antigen for diagnosis of Bovine tuberculosis and its purification method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |