CN102363785A

CN102363785A - Cotton mitosis S-phase kinase protein related gene SKP1 and application thereof

Info

Publication number: CN102363785A
Application number: CN2011103396261A
Authority: CN
Inventors: 唐灿明; 胡德龙; 陈全战; 张朝军
Original assignee: Nanjing Agricultural University
Current assignee: Nanjing Agricultural University
Priority date: 2011-10-31
Filing date: 2011-10-31
Publication date: 2012-02-29
Anticipated expiration: 2031-10-31
Also published as: CN102363785B

Abstract

The invention belongs to the field of molecular biology and relates to a cotton cell S-phase (DNA synthesis phase) kinase protein related gene SKP1 and application thereof. The gene has a cDNA sequence shown as SEQ ID NO.4 and a DNA sequence shown as SEQ ID NO.6; and the amino acid sequence of a gene coding product is shown as SEQ ID NO.5. Construction of a gene overexpression vector, genetic transformation of an overexpression vector plasmid and application are provided. According to research, the gene takes part in formation of a stem cell factor (SCF) complex, regulates and controls plant male meiosis and the physical development process of auxin, gibberellins, abscisic acid, jasmonic acid, ethylene and the like, and has close relationship with growth and development of plants. Therefore, the invention has important significance for research on influence of the gene on growth and development of the plants.

Description

White genes involved SKP1 of cotton mitotic division S phase kinase-associated protein and application thereof

Technical field

The invention belongs to biology field, (DNA synthesis phase) kinase protein genes involved SKP1 and the application thereof that relate to the cotton cells S phase.

Background technology

The title of SCF complex body comes from three integral part: SKP1 (DNA synthesis phase kinase-associated protein), Culin/CDC53 (cell cycle protein dependent kinase) and the F-box (F box) of discovery at first.In vivo, the selectivity protein degradation is a kind of important function regulation mechanism.And in the eukaryote, ubiquitin/26S proteasome is to understand many a kind of degradation pathway at present, and the SCF complex body is the moity of ubiquitin ligase E3 in the degradation pathway.Therefore the SCF complex body plays a part important in ubiquitin/26S proteasome degradation pathway.

SKP1, promptly (S-PHASE KINASE-ASSOCIATED PROTEIN1 SKP1), is a ubiquitous proteinoid in the eukaryote to S phase kinase-associated protein 1, is the core unit of ubiquitin ligase SCF complex body.SKP1 participates in the formation of SCF complex body, also participates in a plurality of pathways metabolisms of biological development process, is regulating and control to comprise hormone metabolism processes such as plant reduction division process and growth hormone, Plant hormones regulators,gibberellins, jasmonic, ethene and dormin.

Research to this gene in the Arabidopis thaliana shows that the male sterile two mutants can appear in the disappearance of SKP1 gene function.At present, the research to this gene does not have report as yet in the domestic and international cotton.Therefore, to the research of this gene function, lay a good foundation in the cotton for further creating the male sterile two mutants.

Summary of the invention

Technical problem to be solved by this invention provides the white genes involved SKP1 of cotton mitotic division S phase kinase-associated protein.For the biological effect of research SKP1 in cotton laid a good foundation.

The technical problem that the present invention also will solve provides the application of said gene SKP1.

For solving the problems of the technologies described above, the technical scheme that the present invention adopts is following:

The one white genes involved SKP1 of mitotic division S phase kinase-associated protein that grows cotton, this gene source has cDNA sequence and the dna sequence dna shown in SEQ ID NO.6 shown in SEQ ID NO.4 in upland cotton (Gossypium hirsutum L.).

Encode the aminoacid sequence of the white genes involved SKP1 of above-mentioned cotton mitotic division S phase kinase-associated protein shown in SED ID NO.5.This albumen is small molecular weight protein; Its main biological function is to participate in the formation of SCF ((synaptonemal complex)) complex body; Be the core subunit of SCF complex body, thus the protein degradation of ubiquitin mediation in the regulation and control organism, and participate in many-sided biological development process.

The overexpression vector of said gene SKP1 is for containing the plant expression vector PBI121 of said gene SKP1.

Said gene SKP1 expression amount in the sterile strain stamen of cotton sterile male line is higher than the application in its hetero-organization.

The overexpression vector of said gene SKP1 and said gene SKP1 is suppressing the tobacco seed sprouting, suppressing the growth of tobacco main root and is improving the application in the tobacco hormone-content.

Beneficial effect:

The present invention has been cloned into the white 1 genes involved SKP1 of cotton S phase kinase-associated protein with the RACE method, and grow cotton white 1 gene order of S phase kinase-associated protein and a coded protein sequence and an application is provided.1. this gene expression amount sterile strain stamen of anti-A in cotton sterile male line is higher than and can educates the strain stamen, and same plant stamen expression amount is higher than gynoecium, explains that this gene is very possible relevant with the male sterile of cotton.2. expression amount explains that than higher growing of this gene and plant has certain relation in the more intense tissue of differentiation abilities such as stamen, radicle, young root, young stem.

The present invention has made up the 35S:SKP1 recombinant expression vector, through agriculture bacillus mediated genetic transformation mode transformation of tobacco authentication function.For the biological effect of research SKP1 in cotton laid a good foundation.For analysis, in whole germination process, the overexpression of SKP1 has delayed the sprouting of seed, has reduced germination rate through transgene tobacco T1.The variation of amount has appearred in certain hormone or chemical substance in the transgenic line after sprouting 50 hours.Transgenic line main root length all is shorter than wild-type CK, and SKP1 gene overexpression has influenced the root growth and development process of tobacco.Overexpression SKP1 has also influenced the variation of various hormone-contents in the plant body.

Description of drawings

The extraction of Fig. 1 cotton RNA.

Fig. 2 SKP1 intermediate segment PCR, M:Marker2000,1 is the purpose fragment.

Figure 33 '-RACE fragment PCR, M:Marker2000.

Figure 45 ' RACE fragment PCR, M:Marker2000.

Fig. 5 cDNA total length PCR, M:Marker2000,2 is the purpose fragment.

Fig. 6 genome total length PCR, M:Marker2000,1 is the purpose fragment.

The positive colony of Fig. 7 plant overexpression vector.

Fig. 8 recombinant expression vector PCR detects.

Fig. 9 recombinant expression vector enzyme is cut evaluation, No. 1 swimming lane enzyme incision, and No. 2 swimming lanes are contrast.

Figure 10 transgene tobacco T1 is for resistance screening, and the plant that has changed over to can healthy growth.

Figure 11 transgene tobacco T1 detects for PCR, and 1-7 is a transfer-gen plant, Marker2000, and CK is transfer-gen plant not.

The spatial and temporal expression of Figure 12 SKP1 in male sterile line.

Figure 13 transfer-gen plant T1 adds up for seed germination.

Figure 14 transfer-gen plant main root is shorter than the non-transgenic plant.

Figure 15 transfer-gen plant T1 is for the main root measurement of length.

Figure 16 a transfer-gen plant T1 is for hormone ABA Determination on content.

Figure 16 b transfer-gen plant T1 is for hormone IAA Determination on content.

Figure 16 c transfer-gen plant T1 is for hormone GA Determination on content.

Figure 16 d transfer-gen plant T1 is for hormone ZR Determination on content.

Embodiment

According to following embodiment, can understand the present invention better.Yet, those skilled in the art will readily understand that the described content of embodiment only is used to explain the present invention, and the present invention that should also can not limit in claims to be described in detail.

Embodiment 1: the extraction of upland cotton (Gossypium hirsutum L.) cotton DNA and RNA.

The extraction of cotton DNA is with reference to people's such as FANG DNA extraction method [FANG G; Hammar S; Grumet R.A quick and inexpensive method for removing polysaccharides from plant genomic DNA [J] .Biotechniques; 1992,13:52-56.];

The extraction of cotton RNA with reference to Jiang build male and the improved CTAB method of Zhang Tianzhen extract total RNA [Jiang Jianxiong, Zhang Tianzhen. utilize the CTAB/ acid phenol method extraction total RNA of cotton tissue [J]. cotton journal, 2003,15 (3): 166-167].

The preparation of embodiment 2:cDNA.

With reference to The first-strand cDNA Synthesis Kit test kit specification sheets (TaKaRa, Japan).

The acquisition of embodiment 3:RT-PCR intermediate segment.

(1) according to Arabidopis thaliana SKP1 gene conservative district design degenerated primer (estimating size about 350bp).

Before (A/G/T) (A/T/C) (A/G/T/C) TT (C/T) GAGGT-3 of primer: 5-GA (T/C) GG (C/T) GA (G/A);

Back primer: 5-ATCTC (T/C) TC (A/G/C/T) GG (A/T/G) GT (T/C) TT (C/G/T) CC-3.

(2) the 25ul reaction system is: preceding primer 1ul, back primer 1ul, d NTP (2.5mM) 2ul, 10X damping fluid 3ul, MgCl2 2ul, template 1ul, ddH2O 14.8ul, Taq enzyme 0.2ul

(3) RT-PCR response procedures (Fig. 2): 94 ℃, 3m; 94 ℃, 30s; 51 ℃, 45s; 72 ℃, 70s, 35 circulations; 72 ℃, 10min.

(4) serve Hai Shenggong order-checking, sequencing result such as SED ID NO.1.

(5) sequencing result is compared on NCBI, and is very high with the SKP1 dna homolog property of a plurality of species such as castor-oil plant, tobacco, willow, Arabidopis thaliana.

Embodiment 4:3 ' RACE (3 ' the segmental acquisition).

(1) primer:

3’CDS(12uM)：5′-AAGCAGTGGTATCAACGCAGAGTAC(T)30V?N-3′；

(N＝A，C，G，or?T；V＝A，G，or?C)；

NUP：NUP(10μM))：5′-AAGCAGTGGTATCAACGCAGAGT-3′；

3′GSP：5′-GGGACGCTGACTTTGTCAAGGTCG-3′；

3′NGSP：5′-ATTCTGGCAGCGAACTATTTGAACATC-3′；

10X UPM (universal primer mixture);

0.4 μ M long primer:

5′-CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT-3′；

2 μ M short primers:

5′-CTAATACGACTCACTATAGGGC-3′；

The preparation of (2) 3 '-RACE-Ready cDNA:

With reference to the SMARTTM RACE cDNA amplification kit operation instructions of TaKaRa company (TaKaRa, Japan).

(3) 3 '-RACE (rapid amplifying 3 ' terminal cDNA fragment):

1. the preparation of mixture 1: water 34.5ul, damping fluid 5ul, dNTP (10mM) 1ul, polysaccharase 1ul.

2. mixing is briefly centrifugal.

3. add 3 ' cDNA2.5ul respectively, UPM5ul, 3 ' GSP (10 μ M) 1ul and said mixture 41.5ul.

4. mixing is briefly centrifugal.

5. 25 circulations: 94 ℃, 30sec (second); 68 ℃, 30sec; 72 ℃, 3min.The PCR product is as the template of next reaction.

6. nest-type PRC: primer is NUP and 3NGSP, and template is above-mentioned 5. PCR product.

Program: 94 ℃, 3min; 94 ℃, 30s; 58 ℃, 45s; 72 ℃, 70s, 35 circulations; 72 ℃ of 10min; The result sees Fig. 3.

7. serve the Hai Shenggong order-checking, sequencing result such as SED ID NO.2.

8. successive A has appearred in sequencing result, and promptly the poly of mRNA (A) tail is explained 3 ' the end total length that obtains this gene.

Embodiment 5:5 ' RACE (5 ' the segmental acquisition).

(1) primer:

5 ' CDS (12u M): 5 '-(T) 25V N-3 ' (N=A, C, G, or T; V=A, G, or C)

SMART(12μM)：5′-AAGCAGTGGTATCAACGCAGAGTACGCGGG-3′

5GSP：5′-CGAATGCCCACTGGTTCTCCCGACG-3′

5NGSP：5′GAAAGTCTTCCTGATCTCTTCTGGGG3′

The preparation of (2) 5 '-RACE-Ready cDNA:

(3)5’-RACE：

2. mixing is briefly centrifugal.

3. add 5 ' cDNA2.5ul respectively, UPM5ul, 5 ' GSP (10 μ M) 1ul and mixture 41.5ul 1..

4. brief centrifugal collection liquid.

5. 25 circulations: 94 ℃, 30s; 68 ℃, 30s; 72 ℃, 3min.

6. nest-type PRC: primer NUP, 5NGSP; Template is a PCR product 5..

Program: 94 ℃, 3min; 94 ℃, 30s; 60 ℃, 45s; 72 ℃, 50s; 32 circulations, 72 ℃, 5min.Result such as Fig. 4.

7. serve the Hai Shenggong order-checking, sequencing result such as SED ID NO.3.

8. BLAST comparison behind the 3 ' fragment assembly of the intermediate segment of this sequencing result and embodiment 3 (5) and embodiment 4 (3) contains complete encoder block, can know the full length sequence that has obtained Ben Jiyin.

The pcr amplification of embodiment 6:SKP1 full length gene.

Design specific primers is a template with upland cotton (Gossypium hirsutum L.) genomic dna (being obtained by embodiment 1) and cDNA (being obtained by embodiment 2) respectively, the dna sequence dna and the cDNA sequence of amplification SKP1 gene.

(1) design of primers:

SKP1-F1:5- TCGTCGTCGGGGAG-3,17 TM:56.3 positions: 73

SKP1-R2:5-CACTCGAAATTGACCCT

-3,20TM:55.8 position: 560

The PCR program: 94 ℃, 3m; 94 ℃, 30s; 61 ℃, 45s; 72 ℃, 70s, 32 circulations; 72 ℃, 5mim.

(2) acquisition of ORF (ORFs):

PCR result such as Fig. 5.

Sequencing result such as SED ID NO.4.

(3) acquisition of genome total length:

PCR result such as Fig. 6.

Sequencing result such as SED ID NO.6.

(4) interpretation of result

The ORF sequence one of the SKP1 that cDNA that amplifies (SED ID NO.4) and embodiment 5 (3) 8. splice

Cause, and SKP1 has only an intron (SED ID NO.5), size is 1395bp.Embodiment 7: fluorescent quantitative PCR technique detects the expression pattern analysis of SKP1 in cotton.

(1) reaction system:

Add ddH in the 25 μ l reaction systems ₂O 14.75 μ l, 10x buffer 2.5 μ L, each 1 μ l of upstream and downstream primer, dNTP1 μ l; TaqE 1 μ l, SYBR Green I dyestuff 2.5 μ l, template DNA 1 μ l; Magnesium chloride 0.25 μ l, all samples are all adding on ice, and wherein TaqE keeps the activity of enzyme at last.

(2) reaction conditions:

94 ℃, 5min; 94 ℃, 30s; 64 ℃, 30s; 72 ℃, 1min; 40 circulations, last circulation is extended 10min for 72 ℃, 4 ℃ of preservations, and, confirm whether it coincide with the amplification curve result to the reaction product electrophoretic analysis.

(3) primer sequence:

p?rimer1：5’-ACGGGATACCGTTGCCTAATG-3’；

p?rimer2：5’-GCGGATCGATCGTCTGTCTT-3’。

(4) formulate typical curve:

According to the amplification curve of the plasmid standard of different concns, system generates typical curve automatically under SDS software, through the typical curve equation, can calculate the gene relative content of testing sample.

(5) interpretation of result (Figure 12):

1. this gene expression amount sterile strain stamen of anti-A in cotton nuclear male sterile line is higher than and can educates the strain stamen, and same plant stamen expression amount is higher than gynoecium, explains that this gene maybe be relevant with the fertility of cotton.

2. relative expression quantity explains that than higher (quantitative fluorescent PCR) growing of this gene and plant has certain relation in the more intense tissue of differentiation abilities such as stamen, radicle, young root, young stem.

The structure and the evaluation of embodiment 8:35S:SKP1 binary expression vector.

(1) structure of 35S:SKP1 binary expression vector:

1. primer: SKP1-Xbal 5-CGC TCTAG AATGTCGTCGTCGGGGAG-3;

SKP?1-BamH1?5-CGC?GGATCCCTCGAAATTGACCCTACA-3。

The PCR program: 94 ℃, 3min; 94 ℃, 30s; 61 ℃, 45s; 72 ℃, 70s, 32 circulations; 72 ℃, 5min.

2. give birth to worker's order-checking through Shanghai, this carrier has successfully been introduced Xbal and two restriction enzyme sites of BamH1, and order correct (SED ID NO.7).

3. the purpose fragment is received in the enzyme switchback:

The cloning vector and the plant expression vector PBI121 that contain SKP1 respectively with Xbal and BamH1 double digestion reclaim purpose fragment and the big fragment of PBI121 that contains SKP1 respectively.

4. connect:

Connect and transformed into escherichia coli DH5 α acquisition positive colony (Fig. 7) with the fragment of T4 ligase enzyme above-mentioned 3. two recovery.

(2) PCR of 35S:SKP1 binary expression vector identifies:

1. primer:

SKP1-Xbal 5-CGC?TCTAGA ATGTCGTCGTCGGGGAG-3

SKP1-BamH1 5-CGC?GGATCC CTCGAAATTGACCCTACA-3

The PCR program:

94 ℃, 3min; 94 ℃, 30s; 61 ℃, 45s; 72 ℃, 70s, 32 circulations; 72 ℃, 5min.

2. extract the plasmid of above-mentioned positive colony and do template, be used for PCR to detect result such as Fig. 8.

3. estimate that segmental size is about 500bp, the band about 500bp has appearred estimating in the result in Fig. 8.

(3) double digestion of recombinant expression vector PBI121-35S-SKP1 is identified:

1. enzyme is cut system:

X-baI 1ul, BamH I 1ul, damping fluid 1ul, 17ul plasmid

Total system is 20ul, 37 ℃, and 3h.

2. result such as Fig. 9.

3. interpretation of result:

No. 1 is X-bal and BamH I double digestion plasmid result, and the plasmid of cutting for enzyme not for No. 2 explain that plasmid has cut, and tentatively restriction enzyme site has successfully been introduced in explanation.

(4) recombinant expression vector PBI121-35S-SKP1 order-checking is identified:

Result such as SED ID NO.7, order-checking back restriction enzyme site, protection base, the inner sequence of gene are not all undergone mutation; Can carry out transgenic experiments.

Embodiment 9: the acquisition of transgene tobacco.

Tobacco genetic transformation method [the Horsch RB of Agrobacterium (Agrobacterium tumefacjens) mediation; Fry JE; Hoffman NL; Et al.A simple and general method for transferring gene into plants.Science, 1985,227 (4691): 1229-1231] be the gene transformation approach that research is maximum at present, theoretical mechanism is the clearest, technological method is the most skilled.So far, be to utilize this system to produce more than 80% in nearly 200 kinds of transgenic plant.

Infect the chemism of vegetable cell according to Agrobacterium: infect and start from injured vegetable cell some phenols of secretion and carbohydrate chemical substance; Agrobacterium is attracted (chemotaxis of VirA and VirG gene mediated in the Ti-plasmids) by these chemical signals; These chemical substances get into Agrobacterium and induce the genetic expression of Ti-plasmids, thus the activation of playing.

(1) the genetically modified preparation work of tobacco:

1. the cultivation of aseptic seedling:

Get this plug Mu Shi tobacco (gifting) seed by the Zhang Bianjiang of Nanjing Xiaozhuang College; Alcohol immersion 30s with 30%; Sterile water wash is 3 times then, goes to 0.1% mercuric chloride the inside again and takes off bacterium 7min, uses sterile water wash at last 5 times; Be tiled in the MS solid medium, treat that the tobacco seedling grows to 6 true leaves and promptly can be used for infecting.

2. the preparation of Agrobacterium bacterium liquid cultivation.

3. the configuration of MS1, MS2, MS3 substratum:

Minimum medium MS1:MS

Division culture medium MS2:MS+6-BA 1ug/ml+Cef (cephamycin) 500ug/ml

Root media MS3:1/2MS+Kan (card receive mycin) 100ug/ml+IAA 0.2g/l, wherein 1/2MS is meant that macroelement and molysite reduce by half, other is constant.

4. reagent configuration: 70% ethanol, 0.1% living mercury.

In addition; Prepare pure water (2-3 liter), petridish (filter paper is housed), punch tool, scalpel, seal film (d=2-5mm), instrument such as tweezers (2-4); Rifle head, centrifuge tube (50ml), be used to join antibiotic special-purpose sterilized water, all these needs sterilization in the recent period.

(2) agriculture bacillus mediated leaf dish transformation approach:

1. EHA105 (Tiangen; Beijing)/and PBI121 (TaKaRa, Japan) (bacterial strain in-80 ℃ of preservations, uses preceding on the YEB substratum in glycerine; Under 28 ℃ and 37 ℃) activated after; Single colony inoculation shakes overnight cultures respectively at 28 ℃ and 37 ℃ in 2ml YEB liquid nutrient medium (card that adds Rifampin and the 25ug/ml of 50ug/ml respectively receive mycin), rotating speed is respectively 220rpm and 165rpm

2. be inoculated in 100ml LB liquid nutrient medium (Tryptones 10g/L, yeast extracts 5g/L, sodium-chlor 5g/L) (kan 50ug/ml, Rif 25ug/ml) with 1% inoculum size, concussion is cultured to logarithmic growth (OD in mid-term ₆₀₀=0.5).

3. under the sterile state, the centrifugal 10min of 4000rpm.

4. after deposition was washed with 20ml MS1 liquid nutrient medium, the centrifugal 10min of 4000rpm suspended with 20ml MS1 liquid nutrient medium.

5. win complete unfolded blade from tobacco seedling (greenhouse or complete incubator cultivation plant); Blade is cleaned 2-3 time with zero(ppm) water earlier; Use 70% alcohol immersion 45 seconds again; Behind 30% Youxiaolin or 0.1% the living mercury sterilization 6-8min, use aseptic washing blade 5 times again, blot redundant moisture with aseptic filter paper at last.

6. with beat the tobacco leaf of punch tool after surface sterilization about leaf dish diameter 2cm.The leaf dish is put into the bacterium liquid of step 5, and vortex mixed 4-5min makes bacterium fully contact with leaf dish tissue wounds position.The leaf dish is taken out from bacterial suspension, place sterilization to blot on the filter paper, place MS1 substratum (being the MS substratum) to go up (shiny surface of blade up) then,, in 25 ℃ culturing room, cultivated altogether 2 days with sealing after film seals.

7. be transferred to division culture medium MS2 (MS+6-BA 1ug/ml+Km 100ug/ml+Cp500ug/ml) to the leaf dish on the MS1 substratum, cultivate 2-3 week at 25 ℃ of periodicity of illumination 14h (2000lux), every subculture that changed at a distance from 5 days, promptly whenever once at a distance from switching in 4 days.Notice in the switching process and will the edge of leaf dish be invaded in the substratum that so that the leaf dish absorbs nutrition, and the mode of switching will be always according to beginning in the middle of the switching time the shiny surface of blade up.

8. after treating the callus seedling differentiation, cut whole plantlet with scalper and change in the triangular flask that division culture medium MS2 is housed, continue to cultivate.

9. after plant grew up, the plant of excising the unnecessary whole strain of callus reservation changed among the MS3 in the root media (1/2MS+Km 100ug/ml+IAA 0.2mg/l), lets it take root.

10. wait to regenerate after the seedlings root prosperity, uncap and cultivated 2-3 days.After strengthening plant, take out plant, the agar of washing the seedling root with sterilized water off is transplanted in the basin alms bowl of sterilization soil again, is positioned in the room temperature and cultivates.

Note observing the upgrowth situation of whole process transgene tobacco, note watering switch lamp etc.

Embodiment 10: the screening of transgene tobacco and evaluation.

(1) through the resistance preliminary screening:

Utilize the resistant gene of expression vector, transfer-gen plant is carried out preliminary screening, plant that the concentration foundation of kantlex is different and different vegetative period are different and different.The transfer-gen plant that contains goal gene, the growth of can in the resistance substratum, growing up strong and sturdy.Otherwise, even will not sprout or sprouted, also can slowly wither chrysanthemum and death.

What this experiment was adopted is the PBI121 expression vector, and kalamycin resistance is arranged; The plant of transgene can be in containing the substratum of kantlex healthy growth (like Figure 10).

(2) Molecular Identification:

1. primer:

SKP1-F1：5’-

TCGTCGTCGGGGAG-3’；

SKP?1-R2：5’-CACTCGAAATTGACCCT

-3’。

The PCR program:

2. genome PCR identifies:

Like Figure 11,1 to 7 is transfer-gen plants, and the purpose band about 500bp is all arranged, and CK is the not contrast of transfer-gen plant, does not detect the purpose band, therefore can explain tentatively that 7 plant have all successfully imported goal gene SKP1.

Embodiment 11: through the function of transgene tobacco T1 for analysis SKP1.

(1) T1 postpones for seed germination:

1. experimental technique:

Cut-off footpath 10cm petridish, layer overlay filter paper; Add water in the article of cultivation with wash bottle, till soaking into fully; Spread 100 tobacco seeds in each petridish; 23 ℃ of placements in the greenhouse, 12 hour photoperiod.With transgene tobacco not is contrast, amounts to choose 7 transgenic lines, and three repetition are done by each strain system, average, and add up the germination rate of seed.Be regarded as the sprouting standard with prominent the breaking in the seed coat of embryo.

Seed germination rate=(sprouting number/sum) X100%.

2. interpretation of result (Figure 13):

After sprouting 48 hours, the germination rate of wild type seeds has reached 68.82%, and maximum germination rate just 49.78% in this moment 7 transgenic lines.Continue to sprout after 54 hours, the wild type seeds germination rate is 92.85%, and this moment, the germination rate of 7 transgenic lines all was lower than 85.00%.Continue to sprout after 63 hours, the seed germination rate of wild type seeds and 7 transgenic lines all reaches about 95%, and tends to balance again, but for wild-type, the transgenic line seed germination rate obviously postpones.In all transgenic lines, the sprouting speed of 150,278 and 280 3 strain systems is slower than other strain systems.This explanation, in whole germination process, the overexpression of SKP1 has delayed the sprouting of seed, has reduced germination rate.

After sprouting 50 hours, transfer-gen plant has germination rate the phenomenon that increases suddenly to occur, explain that the variation of amount has appearred in certain hormone in the transgenic line after this or chemical substance, but not transgenic line does not have this phenomenon.

(2) T1 is for strain owner root length:

1. measuring method

Treating that transgene tobacco grew to about 20 days, is contrast with the wild-type, measures main root length, and 100 plant are got by each strain system, and three repetitions are measured by each strain system, statistics main root length.

2. interpretation of result (Figure 14 and Figure 15)

Find that wild-type contrast and 7 transgenic line main root length are respectively 0.51 ± 0.054cm (CK); 0.34 ± 0.014cm (T150), 0.29 ± 0.018cm (T241), 0.30 ± 0.021em (T255); 0.2 ± 0.005cm (T276); 0.46 ± 0.087cm (T278), 0.44 ± 0.036cm (T280), 0.41 ± 0.049cm (T283).The result shows that 7 transgenic line main root length all are shorter than wild-type CK.This explanation SKP1 gene overexpression has influenced the root growth and development process of tobacco.

(3) the transgene tobacco hormone-content changes:

1. measuring method:

Choose respectively and sprout 45 hours, 52 hours and 60 hours seed and the blade of shoot, accurately take by weighing the 0.1g sample with analytical balance, each sample repeats for 3 times, and sample was put into the freeze pipe liquid nitrogen flash freezer 10-15 minute, places-70 degree refrigerators subsequent use.Testing sample is delivered to China Agricultural University control laboratory, use ELISA (ELSA) to measure the content (the every gram fresh weight of ng) of IAA (growth hormone), GA3 (Plant hormones regulators,gibberellins 3), ZR (zein) and ABA (dormin) respectively.Experimental data is carried out statistical study with SAS8.0 software.

3. interpretation of result (Figure 16 a～d):

Content at seed germination stage wild-type and 7 transgenic line ABA is almost consistent, and to the equal rapid drawdown of content of seedling stage wild-type and 7 transgenic line ABA, and the content basically identical.IAA content all presents downtrending at seed germination to vegetative growth phase, and 7 transgenic lines and the wild-type tobacco IAA content content in each stage does not have to change basically.At seed germination and vegetative growth phase, the content of GA does not almost have anything to change, but the content of transgene tobacco GA generally is higher than wild-type tobacco.The content of zein ZR in seed germination process and vegetative growth phase also is almost not have anything to change, but 7 transgenic lines at the content of whole process all apparently higher than wild-type tobacco (Figure 16 a～d).This explanation overexpression SKP1 has influenced the variation of various hormone-contents in the plant body.

Claims

1. the white genes involved SKP1 of cotton mitotic division S phase kinase-associated protein is characterized in that, this gene source is in upland cotton (Gossypium hirsutum L.), and its cDNA sequence is shown in SEQ ID NO.4, and its dna sequence dna is shown in SEQ IDNO.6.

2. the aminoacid sequence of the said gene SKP1 of coding claim 1 is shown in SEQ ID NO.5.

3. the overexpression vector of the said gene SKP1 of claim 1 is characterized in that, contains the plant expression vector PBI121 of the said gene SKP1 of claim 1.

4. the said gene SKP1 of claim 1 expression amount in the sterile strain stamen of cotton sterile male line is higher than the application in its hetero-organization.

5. the said gene SKP1 of claim 1 is suppressing the tobacco seed sprouting, suppressing the growth of tobacco main root and is improving the application in the tobacco hormone-content.

6. the said overexpression vector of claim 3 is suppressing the tobacco seed sprouting, suppressing the growth of tobacco main root and is improving the application in the tobacco hormone-content.