CN102268424B - Beta-ketothiolase related to 3-HV monomer synthesis of PHBV, coding gene thereof, and application thereof - Google Patents

Abstract

The invention provides a research and an application of beta-ketothiolase in extreme halophilic archaeon, wherein beta-ketothiolase is related to 3-HV monomer synthesis of a biodegradable material PHBV. The protein provided by the invention is a protein showed by the following description (1) or (2): (1) a protein composed of an amino acid sequence represented by a sequence 1 in the sequence table; (2) a protein formed after the amino acid sequence represented by the sequence 1 is processed after substitutions and/or deletions and/or additions of one or more amino acid residues, wherein the obtained protein is derived from the protein represented by (1), and is PHBV and/or 3-HV related. As a result of experiments, when the coding gene of the poly(3-hydrobutyrate-co-3-hydroxyvalerate) and/or 3-hydroxyalkanoate synthesis related protein is introduced into host bacteria, the molar ratio of generated 3-HV monomer for synthesizing PHBV is greater than 3-HV generated from the host bacteria.

Description

A kind of β-ketothiolase and encoding gene and the application synthetic relevant with the 3-HV monomer of PHBV

Technical field

The present invention relates to research and the application of β-ketothiolase synthetic relevant with the 3-HV monomer of degradation material PHBV in a kind of extremely halophilic archaea.

Background technology

Many prokaryotic organism comprise bacterium and some extremely halophilic archaea, and are excessive in carbon source, under the culture condition of the elements such as nitrogen phosphate and sulfur, oxygen restriction, and can accumulating poly hydroxy fatty acid (PHA) in the born of the same parents.PHA is the biological polyester that a class is comprised of 3-hydroxy fatty acid (3HA), mainly as the Stored Matter of carbon source, the energy and reducing power.PHA has the physico-chemical property similar with traditional petrochemical complex plastics such as polyethylene, polypropylene, and it has fully biodegradable and utilizes the synthetic characteristics of renewable resources, be considered to a kind of environmentally friendly " biodegradable plastic ", can alleviate to a certain extent " white pollution " problem that the oil plastics cause.PHA at present known Application Areas comprises biodegradable wrapping material, the medical materials such as operating sutures, drug release carrier, polymer support with and the application of chiral monomer in the medicine building-up process etc.

In various PHA, because the restriction of production cost only has PHB (poly butyric ester) and PHBV (polyhydroxybutyrate hydroxyl valerate) to realize half business-like production at present in bacterium.PHB is member the simplest in the PHA family, that research is the most thorough.Although its character is similar to thermoplastics, the shortcoming such as that PHB has is frangible, thermostability is not high, plasticity-and mechanical property are relatively poor, thereby limited its widespread use.Compare with PHB, PHBV is owing to 3-hydroxypentanoic acid (3-HV) monomer mixes, and its performance has had very large improvement, therefore has more widely application prospect.But, produce PHBV with bacterium and need to add the related substrates such as expensive propionic acid, valeric acid the 3-HV monomer is provided, and the related substrates of high density can suppress the growth of thalline.Compare with bacterium, extremely halophilic archaea can reduce its production cost to a great extent as the production bacterial strain of PHA, can be in the situation that do not add the synthetic PHBV of the relevant carbon source such as organic acid, and the PHBV that is synthesized is better than the PHBV of bacterial origin in performance.

In the bacterium, the biosynthesizing of above-mentioned two kinds of short chain PHA is by β-ketothiolase (PhaA), 'beta '-ketoester acyl-CoA reductase enzyme (PhaB) and the catalysis of PHA synthase (PhaC) institute.β-ketothiolase and 'beta '-ketoester acyl-CoA reductase enzyme are responsible for providing PHA synthetic precursor 3-HB-CoA and 3-HV-CoA.At present, in the world the research of extremely halophilic archaea PHA is also mainly concentrated on the optimization aspect of zymotechnique, and it is relatively less to the research of PHA synthesis related gene in this quasi-microorganism, in open report, have no the report of having a liking for the synthetic β-ketothiolase (PhaA) of being correlated with of ancient salt bacterium PHA, more without being similar in the bacterium these genes involveds are transformed the report of seeking the better PHA of performance and realizing the low cost production of PHA by genetic engineering technique.Therefore, the transformation of the discovery of β-ketothiolase gene and the gene engineering in extremely halophilic archaea thereof in the extremely halophilic archaea, exploitation has very important significance for the biotechnology of extremely halophilic archaea PHA.

Summary of the invention

An object of the present invention is to provide a kind of β-ketothiolase and the encoding gene thereof synthetic relevant with the 3-HV monomer of PHBV.

Protein provided by the invention, name is called PhaAl, derives from extremely halophilic archaea (Haloferax sp.) XH1001CGMCC No.3822, protein:

1) protein that is formed by the aminoacid sequence shown in the sequence in the sequence table 1;

2) with the aminoacid sequence of sequence 1 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and synthetic with polyhydroxybutyrate hydroxyl valerate (PHBV) and/or 3-hydroxy fatty acid (3-HV) is synthetic relevant by 1) protein that derives.

The replacement of above-mentioned one or several amino-acid residue and/or disappearance and/or interpolation refer to be no more than replacement and/or disappearance and/or the interpolation of 10 amino-acid residues.

Wherein, sequence 1 is comprised of 383 amino acids residues in the sequence table.

The encoding gene of above-mentioned albumen (phaA1) also belongs to protection scope of the present invention.

Described encoding gene is following 1), 2), 3) or 4) shown in gene:

1) in the sequence table sequence 2 from the dna molecular shown in 5 ' the terminal 955-2106 position Nucleotide;

2) in the sequence table sequence 2 from the dna molecular shown in 5 ' the terminal 791-2119 position Nucleotide;

3) can be with 1 under stringent condition) or 2) dna molecule hybridize that limits and the dna molecular of and/or 3-hydroxy fatty acid synthesis associated protein synthetic with the polyhydroxybutyrate hydroxyl valerate;

4) with 1) or 2) dna sequence dna that limits has 90% homology at least, and coding synthesizes with the polyhydroxybutyrate hydroxyl valerate and/or the dna molecular of 3-hydroxy fatty acid synthesis associated protein.

Described stringent condition can be at 0.1 * SSPE and (or in the solution of 0.1 * SSC), 0.1%SDS, 65 ℃ of lower hybridization, and washes film with this solution.

Wherein, sequence 2 is comprised of 2995 deoxynucleotides in the sequence table, open reading frame is from 5 ' terminal 955-2106 position nucleotide sequence, classifies the terminator codon of phaA1 as from 5 ' terminal 2104-2106 position nucleotides sequence, the amino acid residue sequence that coding has sequence 1 in the sequence table; Classify the promoter region of described encoding gene as from 5 ' terminal 914-954 position nucleotides sequence, wherein 924-931 position nucleotides sequence is classified the promotor core sequence as.

The recombinant vectors, transgenic cell line and the recombinant bacterium that contain said gene also belong to protection scope of the present invention; The bacterium that contains above-mentioned encoding gene also belongs to the scope of protection of the invention, and described bacterium is preferably extremely halophilic archaea (Haloferaxsp.) XH1001 CGMCC No.3822.

Extremely halophilic archaea of the present invention (Haloferax sp.) XH1001 CGMCC No.3822 is preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center on May 11st, 2010 and (is called for short CGMCC, address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, postcode 100101).

Described recombinant vectors is for to insert the recombinant vectors that described encoding gene obtains in the multiple clone site of carrier pWL102.

Described recombinant bacterium is that described encoding gene is imported the recombinant bacterium that Host Strains obtains.

Described Host Strains is extremely halophilic archaea, be preferably extremely halophilic archaea (Haloarcula hispanica) or extremely halophilic archaea (Haloferax mediterranei), especially be preferably extremely halophilic archaea (Haloarcula hispanica) CGMCC No.1.2049.

Another object of the present invention provides a kind of application of synthesizing relevant β-ketothiolase with the 3-HV monomer of PHBV.

Provided by the inventionly be applied as the application of described albumen in synthetic polyhydroxybutyrate hydroxyl valerate and/or 3-hydroxy fatty acid, or the application of described encoding gene in synthetic polyhydroxybutyrate hydroxyl valerate and/or 3-hydroxy fatty acid.

The method for preparing the polyhydroxybutyrate hydroxyl valerate also is the scope of protection of the invention; be specially the described recombinant bacterium of fermentation; obtain the polyhydroxybutyrate hydroxyl valerate, in the described polyhydroxybutyrate hydroxyl valerate molar percentage of 3-hydroxy fatty acid be higher than 3-hydroxy fatty acid in the polyhydroxybutyrate hydroxyl valerate that obtains of the described Host Strains of fermentation molar percentage.

The method of described fermentation is: 1) described recombinant bacterium is inoculated in the AS-168 substratum, is cultured to logarithmic phase at 37 ℃, obtain the logarithmic phase bacterial strain; Every liter of AS-168 substratum is prepared as follows: with 5.0g acid hydrolysis casein, 5.0g yeast extract, 1.0g Sodium Glutamate, 3.0g Trisodium Citrate, 200g NaCl, 20g MgSO ₄7H ₂O, 2.0g KCl, 0.36g FeSO ₄4H ₂O and 0.36mg MnCl ₂4H ₂O is soluble in water, and water is supplied volume; The pH value of described AS-168 substratum is 7.2;

2) more described logarithmic phase inoculation is arrived the MG substratum, cultivated 3 days at 37 ℃, obtain the polyhydroxybutyrate hydroxyl valerate; Every liter of described MG substratum is prepared as follows: with 200g NaCl, and 20g MgSO ₄7H ₂O, 2.0g KCl, 1g Sodium Glutamate, 37.5mg KH ₂PO ₄, 50mg FeSO ₄7H ₂O, 0.36mg MnCl ₂4H ₂O, 1g yeast extract and 20g glucose are soluble in water, and water is supplied volume; The pH value of described MG substratum is 7.2.

The present invention experimental results show that, the encoding gene of albumen that will be synthetic relevant with polyhydroxybutyrate hydroxyl valerate and/or 3-hydroxy fatty acid imports the 3-HV monomer that can produce synthetic PHBV in the Host Strains, and the molar percentage that produces 3-HV is greater than described Host Strains generation 3-HV.Mutant strain (Haloferax sp.) Δ phaA1 in the experiment can be used as the function that a strain Host Strains is verified the phaA1 gene that comes from other extremely halophilic archaeas simultaneously, for screening can efficiently provide the β-ketothiolase of 3HV that platform is provided in the extremely halophilic archaea field in the future.

Description of drawings

Fig. 1 is the agarose electrophoresis figure of phaA1 gene RT-PCR

Fig. 2 is the structure schematic diagram of integrative vector pUBPDA

Fig. 3 is the agarose electrophoresis figure of the mutant bacteria Haloferax sp. Δ phaA1 of PCR checking disappearance phaA1 gene

Fig. 4 is the gas chromatographic detection result of strain for accumulating polyhydroxyalkanoate (PHA)

Fig. 5 is the gas chromatographic detection result of heterogenous expression phaA1 accumulating poly hydroxybutyric acid valeric acid copolyesters (PHBV)

Embodiment

Employed experimental technique is ordinary method if no special instructions among the following embodiment.

Used material, reagent etc. if no special instructions, all can obtain from commercial channels among the following embodiment.

The acquisition of embodiment 1, β-ketothiolase and encoding gene thereof

Isolated strains from the salt pond bed mud in seawater saltern, Tianjin, separating the substratum that adopts is that (every liter contains the AS-168 substratum: 5.0g acid hydrolysis casein (casamino acids), 5.0g yeast extract (yeast extract), 1.0g Sodium Glutamate (sodium glutamate), 3.0g Trisodium Citrate, 200g NaCl, 20g MgSO ₄7H ₂O, 2.0g KCl, 0.36g FeSO ₄4H ₂O and 0.36mg MnCl ₂4 H ₂O, pH 7.2).Separate and obtain an extremely halophilic archaea strain X H1001.This bacterial strain can form the blush bacterium colony in the upper growth of AS-168 agarose plate (AS-168+1.2% agarose).Bacterium colony is opaque, the smooth of the edge.This bacterium Gram-negative, the electron microscopic observation cell is wide 1 to 2 μ m usually, long 2 to 3 μ m.Carry out physical and chemical experiment and find, XH1001 the most suitable growth NaCl concentration is 20%～25%, still can grow in 10% NaCl concentration; Growth pH scope is 5.2～8.0; Aerobic; Can utilize glucose, starch, amino acid etc. to synthesize a large amount of PHBV.Experiment is found through Molecular, the 16S rDNA gene (sequence 3) of this bacterium and 16S rDNA (GenBankNo.D11107) homology of HaloferaxmediterraneiATCC33500 are more than 99%, so called after Haloferax sp.XH1001.

Haloferax sp.XH1001 is preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center on May 11st, 2010 (is called for short CGMCC, address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, postcode 100101), preserving number is CGMCC No.3822.

By extremely halophilic archaea (Haloferax sp.) XH1001 CGMCC No.3822 genome is carried out shotgun sequencing, obtain a β-ketothiolase gene, be PhaA1 with this unnamed gene, its nucleotides sequence classify as sequence 2 in the sequence table from 5 ' terminal 955-2106 position nucleotide sequence, proteins encoded is PhaA1, and the aminoacid sequence of this albumen is shown in the sequence 1.

The Function Identification of embodiment 2, phaA1

One, the situation of transcribing of gene phaA1 in the fermention medium

1, the extraction of the total RNA of Haloferax sp.XH1001 CGMCC No.3822 thalline in the fermention medium

1) (every liter contains: 5.0g acid hydrolysis casein (casamino acids) at the AS-168 substratum with Haloferax sp.XH1001 CGMCC No.3822,5.0g yeast extract (yeast extract), 1.0g Sodium Glutamate (sodiumglutamate), 3.0g Trisodium Citrate, 200g NaCl, 20g MgSO ₄7H ₂O, 2.0g KCl, 0.36g FeSO ₄4H ₂O and 0.36mg MnCl ₂4H ₂O, all the other are water, pH 7.2) in 37 ℃ cultivated 3-4 days, make it enter logarithmic phase.

2) by 5% inoculum size, (Haloferax sp.) XH1001 CGMCC No.3822 is seeded in MG, and (every liter contains: 200g NaCl, 20g MgSO ₄7H ₂O, 2.0g KCl, 1g Sodium Glutamate (sodium glutamate), 37.5mg KH ₂PO ₄, 50mg FeSO ₄7H ₂O, 0.36mg MnCl ₂4H ₂O, 1g yeast extract (yeastextract), 20g glucose (glucose), pH 7.2) in the substratum 37 ℃ continue to cultivate 2 days, make it enter logarithmic growth mid-term, EP pipe with twice of autoclaving is collected 3-5mL thalline, 12,000rpm, the centrifugal 1min of room temperature, abandon supernatant, centrifugal drying once exhausts supernatant with liquid-transfering gun.

3) will extract total RNA in the above-mentioned collection thalline with adding 1ml TRIzol reagent (invitrigen) in each EP pipe, and total RNA will be dissolved in the 20-30 μ L DEPC water.

2, the mensuration of RNA concentration and purity

The 1.5 μ L RNA solution of getting above-mentioned acquisition join in the 300 μ L TE solution, measure its concentration with BECKMAN DU800, and contrast is that 300 μ L TE add 1.5 μ L DEPC water.Recording OD260/280 is 2.05, illustrates that the purity of RNA meets next step requirement of experiment.The concentration that records RNA is 5.6 μ g/ μ L.

3, RNA is digested with DNase

The total RNA 15 μ g that extract are processed with RNase-free RQ1DNase (Promega), 50 μ L systems (DNase buffer 5 μ L, DNase 5 μ L, 15 μ g RNA, DEPC water complements to 50 μ L), 37 ℃ were reacted 4-5 hour.

4、RT-PCR

According to the nucleotide sequence of phaA1, designed a pair of RT-PCR primer phaARTF/phaARTR, primer sequence is as follows:

phaARTF：5′CGCCGTTCCTGTGATTCT3′

phaARTR：5′GCCCCCGCAAGTGTAGAC3′

Take the postdigestive RNA of DNase as template, utilize OneStep RT-PCR test kit (Qiagen company), carry out RT-PCR according to the step on the specification sheets.Program was divided into for two steps: the first step, utilize primer phaARTR behind the RT-PCR, and take total RNA as template, purpose RNA reverse transcription is become cDNA; Second step utilizes RT-PCR primer phaARTF/phaARTR, and the cDNA that reverse transcription becomes in the first step carries out PCR as template.In second step, make negative control with the postdigestive total RNA of Dnase, make positive control with the DNA of extremely halophilic archaea (Haloferax sp.) XH1001CGMCC No.3822.The result is as shown in Figure 1: swimming lane 1 is the RT-PCR band among Fig. 1; Swimming lane 2 is the positive control of template for DNA; The negative control that swimming lane 3 is template for the postdigestive total RNA of Dnase; Swimming lane M is 100bp marker.As can be seen from Figure 1, the band of swimming lane 1 is consistent with the band of positive control (swimming lane 2), proves: the phaA1 gene is at the fermention medium transcription.

Two, the function of gene phaA1

(1), verifies by the mutant strain Haloferax sp. Δ phaA1 that makes up missing gene phaA1

1, knocks out the structure of the homologous recombination integrated plasmid pUBPDA of phaA1 gene

The building process of pUBPDA as shown in Figure 2, concrete steps are as follows:

1) is used for knocking out the amplification of the homologous recombination double exchange arm of phaA1

According to the nucleotide sequence of phaA1, designed amplimer N1/N2 and the C1/C2 of two pairs of double exchange arms:

N1:5 ' ATC AAGCTTTGCCACCGACCCAATACG 3 ' (sequence with underscore is the HindIII recognition site)

N2:5 ' ATA GGATCCCGCCGAAGGTGGGGAAGG 3 ' (sequence with underscore is the BamHI recognition site)

C1:5 ' ATA GGATCCCCGGGAAGGTCGTTACGT 3 ' (sequence with underscore is the BamHI recognition site)

C2:5 ' ATA GGTACCCGGTGACGGCATAGAGAT 3 ' (sequence with underscore is the KpnI recognition site)

Take the DNA that obtained by embodiment 1 as template, destroy the double exchange left arm (pha-L) of phaA1 with primer pair N1/N2 amplification, the pcr amplification program is: 94 ℃ of 3min denaturations; Then 94 ℃ of 30s, 54 ℃ of 30s, 72 ℃ of 40s carry out 30 circulations; 72 ℃ are extended 7min again; Amplification system is: 25 μ L; Amplification obtains the fragment of 796bp, through order-checking show this fragment have sequence 2 in the sequence table from 5 ' end 1-796 position nucleotide sequence, be the left arm (pha-L) that knocks out phaA1;

Take the DNA that obtained by embodiment 1 as template, increasing with primer pair C1/C2 knocks out the double exchange right arm (pha-R) of phaA1, and the pcr amplification program is: 94 ℃ of 3min denaturations; Then 94 ℃ of 30s, 54 ℃ of 30s, 72 ℃ of 40s carry out 30 circulations; 72 ℃ are extended 7min again; Amplification system is: 25 μ L; Amplification obtains the fragment of 781bp, through order-checking show this fragment have sequence 2 in the sequence table from 5 ' end 2215-2995 position nucleotide sequence, be the right arm (pha-R) that knocks out phaA1.

Agarose gel electrophoresis reclaims PCR product pha-L and pha-R.

2) knock out the structure of the integrative vector pUBPDA of phaA1

With restriction enzyme BamHI and KpnI difference double digestion carrier pUBP (Han, J., Lu, Q., Zhou, L., Zhou, J., Xiang, H.2007.Molecular characterization of the phaEC _HmGenes, required forbiosynthesis of poly (3-hydroxybutyrate) in the extremely halophilic archaeon Haloarculamarismortui.Appl Environ Microbiol, 73 (19), 6058-65., the public can obtain from Institute of Microorganism, Academia Sinica) and PCR product pha-R, then carrier after ligase enzyme is cut and PCR fragment use CaCl ₂Chemical method will connect product and be converted into e. coli jm109, at the enterprising row filter of the resistant panel that contains penbritin, the positive colony that obtains be checked order; The result shows that fragment pha-R (its nucleotides sequence classify as sequence 2 in the sequence table from 5 ' terminal 2215-2995 position nucleotide sequence) is correctly between the BamHI of insertion vector pUBP and KpnI site, with its called after recombinant vectors pUBP-R.

After right arm successfully is connected into, again with HindIII and BamHI respectively double digestion be connected with pUBP recombinant vectors pUBP-R and the PCR product pha-L of right arm, then the carrier after ligase enzyme is cut and PCR fragment use CaCl ₂Chemical method will connect product and be converted into e. coli jm109, at the enterprising row filter of the resistant panel that contains penbritin, the positive colony that obtains be checked order; The result shows that fragment pha-L (its nucleotides sequence classify as sequence 2 in the sequence table from 5 ' terminal 1-796 position nucleotide sequence) is correctly between the BamHI of insertion vector pUBP-R and HindIII site, obtain containing pha-L and the complete double exchange integrative vector of pha-R, and with its called after pUBPDA.

2, the phaA1 deletion mutantion strain Haloferax sp.) structure of Δ phaA1

Carry out homologous recombination by the double exchange arm of pUBPDA and the phaA1 in extremely halophilic archaea (Haloferax sp.) the XH1001 CGMCCNo.3822 genome, knock out the phaA1 in the Haloferax sp.XH1001 CGMCC No.3822 genome, concrete steps are as described below:

1) integrative vector pUBPDA transforms Haloferax sp.XH1001 CGMCC No.3822

Adopt the method for PEG mediation (according to document Cline, S.W., W.L.Lam, R.L.Charlebois, L.C.Schalkwyk, the described method of and W.F.Doolittle.1989.Transformation methods for halophilic archaebacteria.Can J Microbiol 35:148-52.) pUBPDA is transformed extremely halophilic archaea (Haloferaxsp.) XH1001 CGMCC No.3822, (every liter contains: 5.0g acid hydrolysis casein (casamino acids) at the AS-168 that contains the 5mg/L nervinolin after transforming, 5.0g yeast extract (yeast extract), 1.0g Sodium Glutamate (sodium glutamate), 3.0g Trisodium Citrate, 200g NaCl, 20g MgSO ₄7H ₂O, 2.0g KCl, 0.36g FeSO ₄4H ₂O and 0.36mg MnCl ₂4H ₂O, 12g agar, pH 7.2) screen transformant on the solid plate.

2) bacterial strain is changed in the single cross of screening-gene phaA1

In step 1) in the transformant that obtains, carry out the PCR checking: extract total DNA, react as primer with N1 and C2, reaction system is: 1 * PCR damping fluid, dNTPs 0.2 μ M, Mg ²⁺1.5 μ L (final concentration 1.5 μ M), each 1 μ L (final concentration 0.4nM) of N1 and C2, Taq archaeal dna polymerase 1 μ l (3U); Reaction conditions is 94 ℃ of 3min denaturations of elder generation; Then 94 ℃ of 45s, 54 ℃ of 45s, 72 ℃ of 150s carry out 30 circulations; 72 ℃ are extended 7min again.The result as shown in Figure 3, swimming lane 1 is extremely halophilic archaea (Haloferax sp.) XH1001 CGMCCNo.3822 negative control; Swimming lane 2 and swimming lane 3 are the recombinant bacterium of extremely halophilic archaea (Halofepax sp.) XH1001 CGMCCNo.3822, and swimming lane 4 is pUBPDA plasmid positive control.As seen from the figure, negative control PCR product size 2995bp, the PCR product size 1577bp of positive control, the PCR product size of swimming lane 2 is respectively 2995bp and 1577bp, and extremely halophilic archaea (Haloferaxsp.) the XH1001 CGMCC No.3822 bacterial strain that corresponding bacterial strain changes for the phaA1 single cross occurs is described.

3) screening of the mutant strain (Haloferax sp. Δ phaA1) of disappearance phaA1 after the homologous recombination double exchange

With step 2) extremely halophilic archaea (Haloferax sp.) the XH1001 CGMCCNo.3822 bacterial strain of the phaA1 single cross that screens goes down to posterity in not containing the liquid A S-168 substratum of nervinolin and cultivated for 80 generations, repeats to transfer to cultivate the nutrient solution doubling dilution 10 that will go down to posterity and cultivate after 4 times ⁹, in solid AS-168 culture medium flat plate coating evenly, cultivate about a week and obtain mono-clonal, the picking mono-clonal simultaneously on the AS-168 solid plate and the solid medium that contains the AS-168 of 5mg/L nervinolin rule.Until bacteria growing after one week, picking is not grown on resistant panel but single bacterium colony of growing at non-resistance flat board, and its genomic dna of extracting carries out the PCR checking with N1 and C2 as primer equally as template, and it is identical that bacterial strain is changed in reaction system and condition and screening single cross.PCR result as shown in Figure 3, wherein the PCR product of recombinant bacterium shown in the swimming lane 3 size is 1577bp, illustrate that corresponding bacterial strain causes extremely halophilic archaea (Haloferax sp.) the XH1001 CGMCC No.3822 bacterial strain of phaA1 disappearance for double exchange occurs, with its called after Haloferax sp. Δ phaA1.

3, the detection of phaA1 deletion mutantion strain Haloferax sp. Δ phaA1 accumulation PHA kind

Detect the variation of Haloferax sp. Δ phaA1 PHA that accumulates in the substratum of accumulation PHA, use wild mushroom Haloferax sp.XH1001 CGMCC No.3822 as positive control.Concrete operations are as follows:

1) with the Haloferax sp. Δ phaA1 of above-mentioned acquisition in the AS-168 substratum 37 ℃ cultivated 3-4 days, make it enter logarithmic phase.

2) by 5% inoculum size, Haloferax sp. Δ phaA1 is seeded in the MG substratum 37 ℃ continues to cultivate 3 days, then centrifugal collection thalline.

3) the thalline ice of collecting is done, then take by weighing the approximately dried thalline of 75mg ice, be placed in the esterification pipe, (vitriol oil of 3% volume is dissolved in the methyl alcohol to wherein adding the 2mL esterifying liquid again, contain the 1g/L phenylformic acid as interior mark) and 2mL chloroform, be placed in 100 ℃ the baking box esterification behind the mixing 4 hours.Add 1mL distilled water after the esterification, mixing after organic phase and water layering, is got 1 μ L lower floor organic phase and is detected with gas-chromatography.

3 repetitions are established in experiment.Detected result (show among the figure 3-HB and 3-HV monomer peak namely show can produce PHBV) shown in Fig. 4 A and 4B, wherein A is the polyhydroxybutyrate valeric acid copolyesters result of extremely halophilic archaea (Haloferax sp.) XH1001 CGMCC No.3822 wild mushroom accumulation; B is the result of the mutant bacteria Haloferax sp. Δ phaA1 of disappearance phaA1 gene.The result shows, the PHA kind that accumulates in the MG substratum without the Haloferax sp.XH1001 CGMCC No.3822 wild strain of any processing is PHBV (Fig. 4 A), and Haloferax sp. Δ phaA1 under identical culture condition owing to having lacked gene phaA1, synthetic PHA kind becomes PHB (Fig. 4 B).Prove that phaA1 albumen of the present invention and encoding gene thereof are synthetic relevant with 3-HV.

(2), the function of phaA1 gene will be verified behind the phaA1 gene revolution Haloferax sp. Δ phaA1 mutant bacteria

Gene phaA1 is imported mutant strain Haloferax sp. Δ phaA1, and with the function of checking phaA1 gene, concrete operations are as follows:

1, makes up recombinant vectors pWL102-A

Genome sequence design primer according to Haloferax sp.XH1001

HmeF1:5 ' ATA GGATCCCCAGCTTCCAGGGTCATT 3 ' (sequence with underscore is the BamHI recognition site)

HmeR1:5 ' ATC GGTACCTCGGCGAAGATGATAGTT 3 ' (sequence with underscore is the KpnI recognition site)

Take the genomic dna of Haloferax sp.XH1001 CGMCC No.3822 as template, carry out pcr amplification with primer HmeF1 and HmeR1.The PCR reaction conditions is: 94 ℃ of 3min denaturations; Then 94 ℃ of 30s, 54 ℃ of 30s, 72 ℃ of 70s carry out 30 circulations; 72 ℃ are extended 7min again; Amplification system is: 25 μ L; Amplification obtains the fragment of 1329bp, reclaims the PCR product, then cuts with BamHI/KpnI; And with identical restriction endonuclease cutting shuttle vectors pWL 102 (Lam, W.L., and W.F.Doolittle.1989.Shuttle vectors for thearchaebacterium Halobacterium volcanii.Proc Natl Acad Sci USA 86:5478-82, the public can obtain from Institute of Microorganism, Academia Sinica).Carrier after ligase enzyme is cut and fragment, and will connect product CaCl ₂Chemical method transforms e. coli jm109, at the enterprising row filter of the resistant panel that contains penbritin, screening obtains positive colony, positive colony is checked order, sequencing result shows, the sequence of inserting between the BamHI of carrier pWL102 and KpnI site has in the sequence table sequence 2 from 5 ' terminal 791-2119 position nucleotide sequence, with this recombinant vectors called after pWL102-A, and sequence 2 comprises the open reading frame (sequence 2 is from 5 ' terminal 955-2106 position nucleotide sequence) of phaA1 from 5 ' terminal 791-2119 position nucleotide sequence.

2, make up recombinant bacterium Δ phaA1/A

The pWL102-A that step 1 is obtained is converted among the mutant bacteria Haloferax sp. Δ phaA1 that obtains in the step 1 by the method that PEG mediates, and screen positive transformant at the AS-168 solid plate that contains the 5mg/L nervinolin, again positive transformant is extracted plasmid and enzyme is cut and sequence verification, proof has obtained to import the positive transformant of recombinant vectors pWL102-A, will contain recombinant extremely halophilic archaea (Haloferax sp.) the Δ phaA1 called after Δ phaA1/A of pWL102-A.

Adopting uses the same method imports acquisition recombinant bacterium Δ phaA1/pWL102 among recombinant extremely halophilic archaea (Haloferax sp.) the Δ phaA1 with empty carrier pWL102.

3, fermentation recombinant bacterium Δ phaA1/A is to detect the kind of its accumulation PHA

Its Δ phaA1/A engineering bacteria that obtains is fermented according to the method described in the step 13, carry out esterification (process through esterification after) according to step 13 described methods again, then with the kind of gas chromatographic detection Δ phaA1/A PHA that engineering bacteria accumulates.Take extremely halophilic archaea (Haloferax sp.) XH1001 CGMCC No.3822 wild mushroom and recombinant bacterium Δ phaA1/pWL102 as contrast.

3 repetitions are established in experiment, shown in assay and Fig. 4 C, Fig. 4 A is compared with 4B, A is the polyhydroxybutyrate valeric acid copolyesters result (or the polyhydroxybutyrate valeric acid copolyesters result of recombinant bacterium Δ phaA1/pWL102 accumulation, the two comes to the same thing) of extremely halophilic archaea (Haloferax sp.) XH1001 CGMCC No.3822 wild mushroom accumulation; B is the result of the mutant bacteria Haloferax sp. Δ phaA1 of disappearance phaA1 gene; C is the result of the bacterium Haloferax sp. Δ phaA1/A of importing phaA1 gene; D is polyhydroxybutyrate valeric acid copolyesters standard specimen (shows among the figure 3-HB and 3-HV monomer peak namely show can produce PHBV).Each sample of gas chromatographic detection generates hydroxy fatty acid methyl esters through methyl alcohol pyroprocessing, and 4.85min goes out the corresponding benzoic esterification product of 1ng (interior mark) in peak position.

As can be seen from the figure, phaA1 gene and itself promotor (914-954 position nucleotide sequence) import the recombinant bacterium Δ phaA1/A that obtains behind the Haloferax sp. Δ phaA1 can produce the 3-HV component, shows the importing of phaA1 gene and itself promotor so that originally lost the accumulation ability that the bacterial strain of 3-HV component synthesis capability has regained PHBV; Comparison diagram 4A and Fig. 4 C can find out that the mol ratio of 3-HV component is suitable with wild mushroom Haloferax sp.XH1001 CGMCC No.3822.

The albumen of phaA1 coding has the function of β-ketothiolase among the proof Haloferax sp..Show simultaneously, mutant strain Haloferax sp. Δ phaA1 can be used as the function that a strain Host Strains is verified the phaA1 gene that comes from other extremely halophilic archaeas, for screening can efficiently provide the β-ketothiolase of 3-HV that platform is provided in the extremely halophilic archaea field in the future.

Embodiment 3, phaA1 gene are used

The method (Can JMicrobiol.35:148-52.) of the recombinant plasmid pWL102-A that embodiment 2 step 2 are made up by the PEG mediation is converted into wild type strain Haloarcula hispanica CGMCCNo.1.2049 without any processing (available from CGMCC, strain number is CGMCC No.1.2049) in, with the recombinant bacterium called after Haloarcula hispanica/pWL 102-A that obtains.

Ferment and analysis by embodiment 2 described methods.Adopt the recombinant bacterium (called after Haloarculahispanica/pWL102) that empty carrier pWL102 importing Haloarcula hispanica CGMCC No.1.2049 is obtained that uses the same method and ferment and analysis, in contrast.Without the wild type strain Haloarculahispanica CGMCC No.1.2049 of any processing also in contrast.

3 repetitions, results averaged are established in experiment.A is the polyhydroxybutyrate valeric acid copolyesters result that produces of Haloarculahispanica/pWL102 (or the polyhydroxybutyrate valeric acid copolyesters result that produces of wild type strain Haloarculahispanica CGMCC No.1.2049, the two comes to the same thing) among experimental result such as Fig. 5; B is the polyhydroxybutyrate valeric acid copolyesters result that Haloarcula hispanica/pWL102-A produces; C is polyhydroxybutyrate valeric acid copolyesters standard specimen (shows among the figure 3-HB and 3-HV monomer peak namely show can produce PHBV).As seen from the figure, the total amount that wild type strain Haloarcula hispanica CGMCC No.1.2049, Haloarcula hispanica/pWL102 and Haloarcula hispanica/pWL102-A produce PHBV does not have considerable change, but Haloarculahispanica/pWL102 produces that the 3-HV molar percentage is about 3.6 among the PHBV, and the bacterial strain Haloarcula hispanica/pWL102-A that changes recombinant plasmid pWL102-A over to produces that the 3-HV molar percentage is about 9.7 among the PHBV.Change that the 3-HV molar percentage has improved 1.7 times than the bacterial strain that changes empty carrier pWL102 among the PHBV that the bacterial strain of recombinant plasmid pWL102-A produces over to.Heterogenous expression phaA1 gene is described, can increases substantially the ability that Haloarculahispanica CGMCC No.1.2049 bacterium produces the 3-HV component.

Sequence table

＜110〉Institute of Microorganism, Academia Sinica

＜120〉a kind of β-ketothiolase and encoding gene and the application synthetic relevant with the 3-HV monomer of PHBV

<130>CGGNARB102357

<160>3

<170>PatentIn version 3.2

<210>1

<211>383

<212>PRT

＜213〉extremely halophilic archaea (Haloferax sp)

<400>1

Met Glu Val Ala Val Ile Gly Ser Ser Met Thr Lys Phe Gly Gln Arg

1 5 10 15

Ser Ala Trp Ile Arg Glu Leu Leu Ser Glu Ala Gly Gln Ala Cys Leu

20 25 30

Glu Asp Ala Gly Val Ala Pro Ala Ser Val Asp His Leu Tyr Val Ser

35 40 45

Asn Met Ala Ser Gly Glu Phe Glu Gly Gln Thr Gly Val Met Asn Ala

50 55 60

Leu Ala His Asp Leu Gly Val Ile Pro Ala Tyr Thr Gln Arg Ile Asp

65 70 75 80

Gln Thr Ser Ser Ser Gly Gly Ala Gly Ile Tyr Glu Ala Trp Gln Ser

85 90 95

Ile Ala Ser Gly Val Ser Glu Met Thr Leu Leu Val Gly Gly Glu Lys

100 105 110

Met Thr His Lys Thr Thr Gly Glu Ser Thr Asp Ile Ile Ala Ser Cys

115 120 125

Thr His Pro Glu Glu Tyr Lys His Gly Val Thr Leu Pro Ser Phe Ala

130 135 140

Gly Met Thr Ala Arg Asn Tyr Leu Glu Arg Phe Asp Ala Pro Arg Glu

145 150 155 160

Ser Leu Ala Arg Val Ala Val Lys Asn His Arg Asn Gly Val Asp Asn

165 170 175

Pro Lys Ala Gln Phe Gln Lys Glu Ile Asp Ile Glu Thr Ala Leu Glu

180 185 190

Ser Pro Ile Ile Ala Asp Pro Leu Arg Leu Tyr Asp Phe Cys Pro Ile

195 200 205

Thr Asp Gly Ser Ala Ala Met Met Phe Thr Thr Glu Glu Arg Ala Gln

210 215 220

Glu Ile Thr Asp Glu Tyr Ala Ile Val Ser Gly Val Gly Gly Ala Thr

225 230 235 240

Asp Thr His Val Val His Glu Arg Asp Asp Pro Thr Val Met Gly Gly

245 250 255

Val Val Glu Ser Ser Lys Gln Ala Tyr Glu Met Ala Gly Val Gly Pro

260 265 270

Asp Asp Leu Asp Val Ala Glu Leu His Asp Met Phe Thr Ile Leu Glu

275 280 285

Phe Leu Gln Leu Glu Gly Ile Gly Val Ala Asp His Gly Ala Ala Trp

290 295 300

Glu Leu Ala Met Asp Gly Val Thr Ala Lys Asp Gly Gly Leu Pro Ile

305 310 315 320

Asn Thr Ser Gly Gly Leu Lys Ser Lys Gly His Pro Leu Gly Ala Ser

325 330 335

Gly Val Ala Gln Gly Val Glu Ile Tyr Glu Gln Leu Val Gly Glu Ala

340 345 350

Gly Pro Arg Gln Val Glu Ala Asp Thr Ala Leu Ala Cys Asn Val Gly

355 360 365

Gly Phe Gly Asn Cys Val Ile Thr Thr Ile Met Glu Ala Ala Lys

370 375 380

<210>2

<211>2995

<212>DNA

＜213〉extremely halophilic archaea (Haloferax sp.)

<400>2

tgccaccgac ccaatacgga ccagacacac gaatccgttc caatacctgg ttcacggttc 60

gatttttacg aactcacgct ggcgacaaaa cagtacgtcc cttttgcgtc tccaccgaga 120

gagactatcg ttcaaattgg accggagtaa ggaattcgtg gtcgtcgtcg aacggcacgt 180

agttatcatc gttcgatacg ccttcgtcga aacacccgtg gacagacagc agtggtcagt 240

caccgtccaa ttcaaacgga cgttcgagca cgtacctgtt ttccgggtgg ggttcgtcgc 300

cgattatcgt ctcacgttca tcggcgtgtt cgaacccgaa tcgttcgtag aacgcgttgc 360

cgggcttgtt ctctacgagg accatcgcgt tgatccgttc gatgccctgt tcggcgaggc 420

cagcacacgt ctgttcgagc aactcacgtc caacgttttc tcgccggtgt tcggggtgaa 480

cgtaaatccg gaggatgtat ccctcccctt cggtgttgtt ccaagtcgcg tgtgcgaaac 540

cgatgactgt gtcctcgcgt tcagcaacga gaatccgcgc ctgactcttg tggagttccg 600

ctacaatctg ctcaggagtg taccagtcgg tgaccgcctc ttcggccgtt tcgcgggtca 660

gaatctccgg atagtcggtt ttccaggact gttgtgctat ctgaaggatg gcgtcggtat 720

cgtcttcggt cgcagtccgg ataggcatgt atgaccatag cactggcatc ccgatagtcc 780

ttccccacct tcggcgaaga tgatagttcc gtcttcggca ccgagacagg gtacacgagc 840

cagcaactca tagctgaggc gtgagatgct gggtatatat ctccacccat ggccctatct 900

aacaaattat cctcaaccaa catgataata tgacacctgt gagaagtttc gagtatggaa 960

gtcgcagtga ttggctcatc gatgaccaag ttcggtcagc ggagtgcctg gatccgtgag 1020

ttgctctcag aagcaggcca agcatgtctc gaggatgcgg gcgtcgcccc cgcaagtgta 1080

gaccatctgt acgtctcgaa tatggccagt ggcgagttcg aaggccagac gggggtgatg 1140

aacgcactgg cccatgatct cggagtgata ccggcctaca cccagcgaat cgaccagacc 1200

tcttcgtccg gtggggcggg aatctacgag gcgtggcagt cgattgcctc aggagtcagc 1260

gagatgacgc tgttggtcgg tggcgagaag atgacccaca agaccacggg cgagtcaacc 1320

gatatcatcg cctcctgtac ccacccagag gagtacaaac acggcgtgac gctgccgtca 1380

ttcgccggga tgacggcccg gaactacctc gaacggttcg acgcaccgcg ggagtcgctg 1440

gcccgggtcg cggtcaagaa tcacaggaac ggcgtcgaca acccgaaagc gcagttccag 1500

aaagagatcg acatcgagac ggctctggag tcaccaatca tcgctgatcc gctccggttg 1560

tacgacttct gtcctatcac ggacgggagc gcggcgatga tgtttacgac cgaagaacgg 1620

gcgcaagaga tcaccgacga gtatgccatc gtctctggcg tcggcggcgc aacggacaca 1680

cacgtcgtcc acgaacgtga tgacccaacc gtgatgggcg gcgtcgtcga atcgagtaag 1740

caagcctacg agatggccgg cgtcggaccc gatgatctcg atgtggcaga acttcacgac 1800

atgttcacaa tccttgaatt cctccaactg gagggcatcg gtgttgcgga ccacggtgcc 1860

gcgtgggaac tggcgatgga cggcgtcact gcaaaagacg gcggcctccc gatcaacacc 1920

tccgggggac tcaagtcgaa aggccacccg ctgggggcga gcggcgttgc acagggcgtc 1980

gagatatacg aacagctcgt cggtgaggct ggtccgcgac aagtcgaagc cgacactgca 2040

ctggcctgta acgtcggcgg ctttggaaat tgtgtcatca ctaccatcat ggaggctgca 2100

aaatgaccct ggaagctggc aagtgtccta acgggcacgt ctcgtatccc acgcaccctc 2160

gttgtcggaa atgtggtgaa ccgcaaacgg agacgctcga cctctcggac cggaccggga 2220

aggtcgttac gtggactcac tccacggcga ccccgccggg cgtccgccag ccgaacacga 2280

tggcaatcgt cgagttcgaa gtagacggcc aggccgtccg cgcgctcggg caggtaacca 2340

ccgacgacat cgagaccggt gatgtggtcg aaccggtgta tgtcgaagaa ctacgcgacc 2400

cagaagttgg gatcaaagcc cccgaaagtc agtcctggga cggctatcgc tgggaccctg 2460

tgtagtatta ggggtccggt gtagcgactc actcgtgtcg tcttttttac cacatgtcgc 2520

cttgccagac ccaaatcgtt tgacgatagc gtgcgattag ttatcatggt tgacgcacgc 2580

gaataccacg agcagacgaa acattctccg gaacgcgtcc gcgccgacac gttctcactc 2640

gatttcgaga acaagccgcg accgtacaag gtgtacgagg ggctgtcaca gatctcgctc 2700

gaagagttgc gatactcagc cgacgaaccg gcactgtctg cgattactac cccgccaccc 2760

gaatcacgtg tggatgttgg ttcgccatcg aacggtgtcg gttcgtcatc gaacggtgtc 2820

ggttcgtcat cggtcgatac ccagtcgccg tcagtcgaca cccagacact ccaaacgctc 2880

tgccactatg cgacgggtgt aactaagacg ctgaaaatcc gcggcaggca aacgcgtttt 2940

cgggccgctt cctgtacggg gaaactctat cacatcgatc tctatgccgt caccg 2995

<210>3

<211>1473

<212>DNA

＜213〉extremely halophilic archaea (Haloferax sp)

<400>3

attccggttg atcctgccgg aggtcattgc tattggggtc cgatttagcc atgctagttg 60

cacgagttca cactcgtggc gaaaagctca gtaacacgtg gccaaactac cctacagaga 120

acgataacct cgggaaactg aggctaatag ttcatacggg agtcatgctt gaatgccgac 180

tccccgaaac gctccggcgc tgtaggatgt ggctgcggcc gattaggtag acggtggggt 240

aacggcccac cgtgccaata atcggtacgg gttgtgagag caagaacccg gagacggaat 300

ctgagacaag attccgggcc ctacggggcg cagcaggcgc gaaaccttta cactgcacgc 360

aagtgcgata aggggacccc aagtgcgagg gcatatagtc ctcgcttttc tcgactgtaa 420

ggcggtcgag gaataagagc tgggcaagac cggtgccagc cgccgcggta ataccggcag 480

ctcaagtgat gaccgatatt attgggccta aagcgtccgt agccggccat gaaggttcat 540

cgggaaatcc gccagctcaa ctggcgggcg tccggtgaaa accacatggc ttgggaccgg 600

aaggctcgag gggtacgtct ggggtaggag tgaaatcctg taatcctgga cggaccaccg 660

atggcgaaag cacctcgaga agacggatcc gacggtgagg gacgaaagct agggtctcga 720

accggattag atacccgggt agtcctagct gtaaacgatg ctcgctaggt gtggcacagg 780

ctacgagcct gtgctgtgcc gtagggaagc cgtgaagcga gccgcctggg aagtacgtcc 840

gcaaggatga aacttaaagg aattggcggg ggagcactac aaccggagga gcctgcggtt 900

taattggact caacgccgga catctcacca gctccgacta cagtaatgac ggtcaggttg 960

atgaccttac cacgacgctg tagagaggag gtgcatggcc gccgtcagct cgtaccgtga 1020

ggcgtcctgt taagtcaggc aacgagcgag acccgcactt ctaattgcca gcaacagttt 1080

cgactggttg ggtacattag aaggactgcc gctgctaaag cggaggaagg aacgggcaac 1140

ggtaggtcag tatgccccga atgagctggg ctacacgcgg gctacaatgg tcaagacaat 1200

gggttgctat ctcgaaagag aacgctaatc tcctaaactt gatcgtagtt cggattgagg 1260

actgaaactc gtcctcatga agctggattc ggtagtaatc gcatttcaca agagtgcggt 1320

gaatacgtcc ctgctccttg cacacaccgc ccgtcaaagc acccgagtga ggtccggatg 1380

aggccaccac acggtggtcg aatctgggct tcgcaagggg gcttaagtcg taacaaggta 1440

gccgtagggg aatctgcggc tggatcacct cct 1473

Claims (13)

1. protein, its aminoacid sequence is shown in sequence in the sequence table 1.

2. the encoding gene of the described albumen of claim 1.

3. described encoding gene according to claim 2 is characterized in that: described encoding gene be in the sequence table sequence 2 from the dna molecular shown in 5 ' the terminal 955-2106 position Nucleotide.

4. the recombinant vectors that contains claim 2 or 3 described encoding genes.

5. recombinant vectors according to claim 4 is characterized in that: the recombinant vectors that described recombinant vectors obtains for multiple clone site insertion claim 2 or 3 described encoding genes at carrier pWL102.

6. the recombinant bacterium that contains claim 2 or 3 described encoding genes.

7. recombinant bacterium according to claim 6 is characterized in that: described recombinant bacterium is for importing the recombinant bacterium that Host Strains obtain with claim 2 or 3 described encoding genes; Described Host Strains is extremely halophilic archaea.

8. recombinant bacterium according to claim 7 is characterized in that: described Host Strains be in the extremely halophilic archaea Spain salt box bacterium ( Haloarcula hispanica) or the rich salt bacterium in Mediterranean Sea ( Haloferax mediterranei).

9. recombinant bacterium according to claim 7, it is characterized in that: described Host Strains is extremely halophilic archaea CGMCC No.1.2049.

10. the transgenic cell line that contains claim 2 or 3 described encoding genes.

11. the application of the described albumen of claim 1 in synthetic polyhydroxybutyrate hydroxyl valerate and/or 3-hydroxypentanoic acid.

12. claim 2 or the 3 described encoding genes application in synthetic polyhydroxybutyrate hydroxyl valerate and/or 3-hydroxypentanoic acid.

13. method for preparing the polyhydroxybutyrate hydroxyl valerate, it is characterized in that, recombinant bacterium claimed in claim 9 ferments, obtain the polyhydroxybutyrate hydroxyl valerate, in the described polyhydroxybutyrate hydroxyl valerate molar percentage of 3-hydroxy fatty acid be higher than 3-hydroxy fatty acid in the polyhydroxybutyrate hydroxyl valerate that obtains of fermentation Host Strains molar percentage;

The method of described fermentation is: 1) described recombinant bacterium is inoculated in the AS-168 substratum, is cultured to logarithmic phase at 37 ℃, obtain the logarithmic phase bacterial strain; Every liter of AS-168 substratum is prepared as follows: with 5.0 g acid hydrolysis caseins, 5.0 g yeast extracts, 1.0 g Sodium Glutamates, 3.0 g Trisodium Citrates, 200 g NaCl, 20 g MgSO ₄7H ₂O, 2.0 g KCl, 0.36 g FeSO ₄4 H ₂O and 0.36 mg MnCl ₂4 H ₂O is soluble in water, and water is supplied volume; The pH value of described AS-168 substratum is 7.2;

2) more described logarithmic phase inoculation is arrived the MG substratum, cultivated 3 days at 37 ℃, obtain the polyhydroxybutyrate hydroxyl valerate; Every liter of described MG substratum is prepared as follows: with 200 g NaCl, and 20 g MgSO ₄7H ₂O, 2.0 g KCl, 1 g Sodium Glutamate, 37.5 mg KH ₂PO ₄, 50 mg FeSO ₄7 H ₂O, 0.36 mg MnCl ₂4 H ₂O, 1 g yeast extract and 20 g glucose are soluble in water, and water is supplied volume; The pH value of described MG substratum is 7.2.

Images