CN116904384A - Recombinant microorganism and application thereof in production of polyhydroxyalkanoate - Google Patents

Recombinant microorganism and application thereof in production of polyhydroxyalkanoate Download PDF

Info

Publication number
CN116904384A
CN116904384A CN202311167153.0A CN202311167153A CN116904384A CN 116904384 A CN116904384 A CN 116904384A CN 202311167153 A CN202311167153 A CN 202311167153A CN 116904384 A CN116904384 A CN 116904384A
Authority
CN
China
Prior art keywords
medium
amino acid
microorganism
genus
acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202311167153.0A
Other languages
Chinese (zh)
Inventor
陈国强
邵明威
张忠楠
刘絮
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Micro Structure Factory Biotechnology Co ltd
Tsinghua University
Original Assignee
Beijing Micro Structure Factory Biotechnology Co ltd
Tsinghua University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Micro Structure Factory Biotechnology Co ltd, Tsinghua University filed Critical Beijing Micro Structure Factory Biotechnology Co ltd
Priority to CN202311167153.0A priority Critical patent/CN116904384A/en
Publication of CN116904384A publication Critical patent/CN116904384A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
    • C12N9/0014—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4)
    • C12N9/0016—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4) with NAD or NADP as acceptor (1.4.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/38—Chemical stimulation of growth or activity by addition of chemical compounds which are not essential growth factors; Stimulation of growth by removal of a chemical compound
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93—Ligases (6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/62—Carboxylic acid esters
    • C12P7/625—Polyesters of hydroxy carboxylic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y104/00—Oxidoreductases acting on the CH-NH2 group of donors (1.4)
    • C12Y104/01—Oxidoreductases acting on the CH-NH2 group of donors (1.4) with NAD+ or NADP+ as acceptor (1.4.1)
    • C12Y104/01002—Glutamate dehydrogenase (1.4.1.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y104/00—Oxidoreductases acting on the CH-NH2 group of donors (1.4)
    • C12Y104/01—Oxidoreductases acting on the CH-NH2 group of donors (1.4) with NAD+ or NADP+ as acceptor (1.4.1)
    • C12Y104/01013—Glutamate synthase (NADPH) (1.4.1.13)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y603/00—Ligases forming carbon-nitrogen bonds (6.3)
    • C12Y603/01—Acid-ammonia (or amine)ligases (amide synthases)(6.3.1)
    • C12Y603/01002—Glutamate-ammonia ligase (6.3.1.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/185—Escherichia
    • C12R2001/19—Escherichia coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/38—Pseudomonas
    • C12R2001/40—Pseudomonas putida

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Virology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention belongs to the technical field of microorganism culture, and particularly relates to a recombinant microorganism and application thereof in production of polyhydroxyalkanoates. The invention provides a culture medium of halophilic microorganisms, which takes amino acid or amino acid salt as a nitrogen source, and also provides a recombinant halophilic microorganism which knocks out a coding gene of a glutamic acid synthesis related protein in the recombinant halophilic microorganism, and the amino acid or amino acid salt (especially sodium glutamate) is used as a unique nitrogen source for fermentation culture, so that the carbon source conversion rate in the fermentation process can be remarkably improved, and the PHA yield is further improved; when fermentation is performed using the mixed amino acid as a nitrogen source, the dry cell weight, the PHA yield, the PHA percentage content and the carbon source conversion rate can be simultaneously improved.

Description

Recombinant microorganism and application thereof in production of polyhydroxyalkanoate
Technical Field
The invention belongs to the technical field of microorganism culture, and particularly relates to a recombinant microorganism and application thereof in production of polyhydroxyalkanoates.
Background
Microbial fermentation refers to the process of converting a feedstock into a product desired by a human being via a specific metabolic pathway under suitable conditions using microorganisms. Microbial fermentation has wide application in the fields of food, medicine, energy, environmental protection and the like. Polyhydroxyalkanoate (PHA) produced by microorganisms is a biodegradable polymer material with good biocompatibility and hot workability, and can be used for the production of biomedical materials and degradable plastics (Ye J W, lin Y N, yi X Q, et al Synthetic biology of extremophiles: a new wave of biomanufacturing [ J ]. Trends in Biotechnology, 2022.).
Currently, the main method for producing PHA using microorganisms is the microbial fermentation process. The method utilizes microorganisms to synthesize PHA in a fermentation tank by utilizing carbon sources such as saccharides, fatty acids or glycerol. Traditional microbial fermentation media are two-stage fermentations performed in fermentors using urea or ammonium salts as nitrogen sources. The first stage is a growth stage, and provides sufficient carbon sources and other nutrient elements to promote the growth of the strain; the second stage is the synthesis stage, limiting the nitrogen source, maintaining the carbon source supply, promoting PHA accumulation in the cell (Chen G Q, zhang X, liu X, et al.Halomonasspp., as chassis for low-cost production of chemicals[J]. Applied Microbiology and Biotechnology, 2022, 106(21): 6977-6992.). The use of high concentrations of inorganic nitrogen during fermentation results in a substantial decrease in the conversion of the carbon source to PHA, resulting in a decrease in PHA production (Liu X, li D, yan X, et al Rapid quantification of polyhydroxyalkanoates accumulated in living cells based on green fluorescence protein-expanded phasins: the qPHA method [ J ]]. Biomacromolecules, 2022, 23(10): 4153-4166.）。
Therefore, developing a fermentation process that increases the conversion of carbon sources and increases the accumulation of PHA is of great interest for industrial microbial production and PHA production.
Disclosure of Invention
In order to solve the above problems, the present invention provides a recombinant microorganism in which nitrogen source assimilation-related proteins (e.g., glutamic acid synthesis-related proteins) are inactivated, and a culture medium in which the microorganism is fermented to culture can increase the carbon source conversion rate, and the fermentation production of the recombinant microorganism using the culture medium of the present invention can increase the dry cell weight, PHA yield, PHA percentage and carbon source conversion rate (i.e., increase the substrate to product conversion rate) in the fermentation production.
In a first aspect of the present invention, there is provided a recombinant microorganism having a glutamate synthesis-related protein inactivated.
The protein related to the glutamic acid synthesis comprises one or more than two of glutamate dehydrogenase (GdhA), glutamate synthase (GltBD), glutamine synthase (GlnA) or glutamine synthase (GlnN).
Preferably, the deactivation may be by any of the methods known in the art.
Further preferably, the inactivation comprises:
a) Knocking out all or part of the gene encoding the protein related to glutamate synthesis or knocking out the gene encoding the protein related to glutamate synthesis;
b) Mutation of a part of bases of a gene encoding a protein involved in glutamate synthesis makes the gene incapable of normally expressing the protein, or the expressed protein has reduced or no activity.
In one embodiment of the invention, the inactivation is a knockout of a gene encoding glutamine synthetase.
Preferably, the knockout can be performed using any of the methods known in the art.
It is further preferred to use methods including, but not limited to, DNA homologous recombination, RNA interference, zinc finger nucleases, TALENs, CRISPR/Cas, CRISPR/AID, and the like.
In one embodiment of the invention, a gene encoding a CRISPR/AID knockout glutamine synthetase (gina or ginn) is used.
Preferably, the CRISPR/AID comprises the use of an sgRNA, the sgRNA sequence comprising the sequence of SEQ ID NO: 1. 4-8.
Preferably, the recombinant microorganism also expresses exogenous PHA synthesis-associated proteins.
Preferably, an expression vector comprising a gene encoding a protein associated with exogenous PHA synthesis may be introduced into the recombinant microorganism.
Preferably, the PHA synthesis-related protein comprises one or more than two of PhaA, phaB, phaC, sucD, 4hbD, orfZ, aldD or DhaT proteins.
Preferably, the growth of the recombinant microorganism requires that the medium contains an inorganic salt with a certain salt concentration.
Further preferably, the salt concentration in the medium is any one of 2.5-100g/L, further preferably 40-60g/L, such as 2.5, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100g/L. Preferably, the recombinant microorganism is selected from eukaryotic or prokaryotic microorganisms.
Further preferred, the recombinant microorganism is selected from the group consisting of prokaryotic microorganisms.
More preferably, the recombinant microorganism is selected from the group consisting of Escherichia genusEscherichia) Genus PseudomonasPseudomonas) Genus RocheRalstonia) Genus AeromonasAeromonas) Genus CorynebacteriumCorynebacterium) Or halomonas genusHalomonas）。
Preferably, the genus EscherichiaEscherichia) Including but not limited to E.coliEscherichia coli) And derivatives thereof.
Preferably, the Pseudomonas genusPseudomonas) Including but not limited to Pseudomonas putida ]Pseudomonas putida) And derivatives thereof.
Preferably, the genus RocheRalstonia) Including but not limited to Eutrophic Bacillus rosis ]Ralstonia eutropha) And derivatives thereof.
Preferably, the aeromonas genus is [ ]Aeromonas) Including but not limited to Aeromonas hydrophilaAeromonas hydrophila) And derivatives thereof.
Preferably, the halomonas genus is [ ], theHalomonas) Including but not limited toHalomonas bluephagenesisTD01（CGMCC No. 4353）、Halomonas campaniensisLS21（CGMCC No. 6593）、Halomonas aydingkolgenesisM1（CGMCC No.19880）、Halomonas bluephagenesisWZY254 and/or 254Halomonas bluephagenesisWZY278 and their derivative strains or combinations thereof.
The recombinant microorganism can produce PHA.
In a second aspect of the present invention, there is provided a method for producing a recombinant microorganism according to the first aspect, which comprises inactivating a glutamic acid synthesis-related protein in a starting strain.
Preferably, the preparation method further comprises introducing a gene encoding a PHA synthesis-related protein.
The recombinant microorganism, the protein involved in glutamate synthesis, the inactivation and the related definition of the protein involved in PHA synthesis are the same as those of the first aspect of the present invention.
In a third aspect of the present invention, there is provided a culture medium for a microorganism, the culture medium comprising a nitrogen source, the nitrogen source comprising an amino acid or an amino acid salt, the amino acid being added in a manner comprising directly adding one or more than two amino acids, or adding a substance which hydrolyzes to produce the amino acid.
Preferably, the substances which generate amino acids after hydrolysis include, but are not limited to, one or more of hair hydrolysate, algae powder hydrolysate or casein hydrolysate.
Preferably, the amino acid is selected from one or more than two of glycine, alanine, valine, leucine, isoleucine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, glutamic acid, lysine, arginine or histidine.
Preferably, the amino acid salt comprises one or more than two of potassium salt, sodium salt, calcium salt, magnesium salt or zinc salt of amino acid.
In one embodiment of the invention, the amino acid salt is sodium glutamate.
Preferably, the hair hydrolysate is selected from hydrolysates of human hair or animal hair.
It is further preferred that the hair hydrolysate comprises amino acids or salts thereof including, but not limited to, one or more of glycine, alanine, valine, leucine, isoleucine, methionine, proline, serine, tyrosine, cystine, phenylalanine, threonine, aspartic acid, glutamic acid, lysine, arginine or histidine or salts thereof.
In one embodiment of the invention, the hair hydrolysate is wool hydrolysate.
Preferably, the concentration of the amino acid or amino acid salt in the medium is any one of 0.01 to 2mol/L, preferably any one of 0.01 to 1mol/L, for example 0.01, 0.02, 0.03, 0.04, 0.05, 0.1, 0.2, 0.25, 0.3, 0.33, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9 or 2mol/L.
The nitrogen source may include inorganic nitrogen and/or organic nitrogen as desired for a particular embodiment. The organic nitrogen includes the above amino acids or amino acid salts, and may also include, but is not limited to, peanut meal, soybean meal, cotton seed meal, corn steep liquor, yeast meal, fish meal, silkworm chrysalis meal, peptone, bran, waste mycelium, and the like. The inorganic nitrogen includes, but is not limited to, ammonium salts (e.g., ammonia sulfate), nitrate salts, or aqueous ammonia, among others.
Preferably, the medium contains a carbon source.
Preferably, the concentration of the carbon source in the medium may be any one of 1 to 300 g/L, preferably any one of 10 to 80 g/L, for example 1, 5, 10, 20, 30, 35, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290 or 300 g/L.
Preferably, the carbon source is selected from one or more of glucose, gluconate, sucrose, fructose or an organic acid.
Further preferably, the organic acid is selected from, but not limited to, acetic acid, propionic acid, butyric acid and/or medium long chain fatty acids, etc. (e.g. lauric acid, palm oil, oleic acid).
Further preferably, the gluconate is selected from one or more than two of calcium gluconate, magnesium gluconate, zinc gluconate, sodium gluconate and potassium gluconate.
In one embodiment of the invention, the carbon source is glucose, fructose and/or an organic acid (e.g., lauric acid).
Preferably, the culture medium also comprises other substances for the growth, screening, metabolism and the like of the microorganisms.
Further preferably, the other substances include, but are not limited to, one or more of antibiotics, additional carbon sources, vitamins or growth factors for maintaining plasmid stability.
Preferably, the medium comprises inorganic salts, and the salt concentration in the medium is any value from 2.5 to 100g/L, more preferably 40 to 60g/L, such as 2.5, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100g/L.
Preferably, the pH of the medium is any one of values 6-10, e.g., 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5 or 10.
The culture medium includes, but is not limited to, an MM medium, LB medium, TB medium or SB medium with an amino acid or an amino acid salt.
Under general conditions, the MM medium comprises MgSO 4 、KH 2 PO 4 、Fe(III)-NH 4 -Citrate、CaCl 2 ·2H 2 O、ZnSO 4 ·7H 2 O、MnCl 2 ·4H 2 O、H 3 BO 3 、CoCl 2 ·6H 2 O、CuSO 4 ·5H 2 O、NiCl 2 ·6H 2 O、NaMoO 4 ·2H 2 O. Preferably also glucose and/or NaCl.
In general, the LB medium contains tryptone, yeast extract and NaCl.
The TB culture medium is a culture medium which is higher than LB culture medium, increases the content of tryptone and yeast extract and provides glycerol as an additional carbon source; the SB culture medium is a culture medium which increases the content of tryptone and yeast extract compared with the LB culture medium.
According to the needs of the specific embodiment, it is also possible to add to the medium any of the values 1-300 g/L (preferably any of the values 10-80 g/L, such as 1, 5, 10, 20, 30, 35, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290 or 300 g/L, further preferably 35 g/L) glucose and/or add any of the values 2.5-100g/L (preferably 40-60g/L, such as 2.5, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100 g/L) inorganic salts (such as NaCl, KCL) to maintain osmotic pressure and salt concentration.
Preferably, the microorganism is selected from the genus EscherichiaEscherichia) Genus PseudomonasPseudomonas) Genus RocheRalstonia) Genus AeromonasAeromonas) Genus CorynebacteriumCorynebacterium) Or halomonas genusHalomonas). Further limitations of the respective genera are as in the first aspect of the invention.
Preferably, the microorganism expresses an exogenous PHA synthesis-associated protein.
Further preferably, the glutamic acid synthesis-related protein of the microorganism is inactivated.
Preferably, the protein related to glutamate synthesis comprises one, two or three of glutamate dehydrogenase, glutamate synthase or glutamine synthase.
The microorganism can produce PHA.
The relevant definition of the inactivated, PHA synthesis-related proteins is the same as that of the first aspect of the invention.
In a fourth aspect of the invention, there is provided a fermentation process comprising using a medium as described in the third aspect above.
In a fifth aspect of the present invention, there is provided a method of culturing a microorganism, the method comprising culturing the microorganism using the medium of the third aspect described above.
Preferably, the microorganism comprises the recombinant microorganism of the first aspect.
In a sixth aspect of the invention there is provided a method of increasing substrate conversion in a fermentation process, the method comprising using a medium as described in the third aspect above.
Preferably, the substrate is a carbon source.
Preferably, the fermentation comprises fermenting the recombinant microorganism of the first aspect.
The culture medium and the carbon source are defined as in the first aspect of the present invention.
In a seventh aspect, the present invention provides the use of a medium according to the third aspect above for culturing a microorganism.
Preferably, the microorganism comprises the recombinant microorganism of the first aspect.
In an eighth aspect of the present invention, there is provided a method for producing PHA, comprising culturing microorganisms using the medium described in the third aspect above.
Preferably, the microorganism comprises the recombinant microorganism of the first aspect.
Preferably, the PHAs include, but are not limited to, short chain PHAs of 3-5 carbon atom monomer chain length (SCL-PHA) and/or medium-long chain PHAs of 6-14 carbon atom monomer chain length (MCL-PHA).
Preferably, the PHA comprises a homopolymer or copolymer of monomers comprising the PHA.
Further preferably, the monomers comprising PHA include, but are not limited to, one, two or more of 2-hydroxypropionic acid, 3-hydroxybutyric acid, 4-hydroxybutyric acid, 3-hydroxyvaleric acid, 3-hydroxypropionic acid, 5-hydroxyvaleric acid, 3-hydroxycaproic acid, 3-hydroxyheptanoic acid, 6-hydroxycaproic acid, 3-hydroxyoctanoic acid, 3-hydroxynonanoic acid, 3-hydroxydecanoic acid, 3-hydroxyundecanoic acid, or 3-hydroxydodecanoic acid.
More preferably, the PHA includes, but is not limited to, one or more of P3HP, PHB, P (HB-LA), PHV, P34HB, PHBV, PHBHHx, PHBHHp, PHO, PHN, PHD, P3HB4HB3HV or P3HB4HB5 HV.
All combinations of items to which the term "and/or" is attached "in this description shall be taken to mean that the respective combinations have been individually listed herein. For example, "a and/or B" includes "a", "a and B", and "B". Also for example, "A, B and/or C" include "a", "B", "C", "a and B", "a and C", "B and C" and "a and B and C".
The term "comprising" or "including" as used herein is an open reading frame, and when used to describe a sequence of a protein or nucleic acid, the protein or nucleic acid may consist of the sequence, or may have additional amino acids or nucleotides at one or both ends of the protein or nucleic acid, but still have the same or similar activity as the original sequence.
Drawings
Fig. 1: knock-outHalomonas aydingkolgenesis In M1 StrainglnNGeneSequencing results of (2);
fig. 2: and (5) detecting the components of the wool hydrolysate.
Detailed Description
The invention is further illustrated by the following specific examples. It should be noted that these examples are merely illustrative for better describing and aiding in the understanding of the present invention and are not intended to limit the present invention to these examples. Examples are described by way of example for halophiles, but do not mean that the culture medium, the culture method and the genetic engineering method are not applicable to other microorganisms.
Further, one skilled in the art can engage and combine the different embodiments or examples described in this specification. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.
The experimental methods used in the following examples are conventional methods unless otherwise specified.
Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.
The strains used in the examples areHalomonas bluephagenesis TD01、Halomonas campaniensis LS21、Halomonas aydingkolgenesis M1、Pseudomonas putida（Wang H, Zhou X, Liu Q, et al. Biosynthesis of polyhydroxyalkanoate homopolymers by Pseudomonas putida[J]. Applied microbiology and biotechnology, 2011, 89: 1497-1507.）、Escherichia coli（Meng D C, Shi Z Y, Wu L P, et al. Production and characterization of poly (3-hydroxypropionate-co-4-hydroxybutyrate) with fully controllable structures by recombinant Escherichia coli containing an engineered pathway[J]. Metabolic Engineering, 2012, 14(4): 317-324.）、Ralstonia eutropha（Zheng Z, Li M, Xue X J, et al. Mutation on N-terminus of polyhydroxybutyrate synthase of Ralstonia eutropha enhanced PHB accumulation[J]Applied microbiology and biotechnology, 2006, 72:896-905.) andAeromonas hydrophila（Zhao Y H, Li H M, Qin L F, et al. Disruption of the polyhydroxyalkanoate synthase gene in Aeromonas hydrophila reduces its survival ability under stress conditions[J]. FEMS microbiology letters, 2007, 276(1): 34-41.）。
Halomonas bluephagenesis TD01 strain is preserved in China general microbiological culture Collection center (CGMCC) at 11 and 19 of 2010, and has a preservation registration number of CGMCC No.4353, and is classified and named as halomonasHalomonas sp. TD01 (also called Halomonas bluephagenesis TD01; which is described in patent application publication No. CN102120973A; the bacteria are available to the public from university of Qinghai).
The Halomonas campaniensis LS strain is a gram-negative halophilic bacterium obtained by screening in the laboratory, has a very good industrial production application prospect, has a preservation registration number of CGMCC No. 6593, is recorded in patent application publication No. CN102925382A, and is disclosed in J iang X, yao Z, chen G Q, controlling cell volume for efficient PHB production by Halomonas [ J ]. Metabolic Engineering, 2017, 44:30-37, and can be obtained from university of Qinghua by the public.
The Halomonas aydingkolgenesis M strain has a preservation registration number of CGMCC No.19880 and is described in patent application publication No. CN111593006A; the public may obtain the bacterium from the university of bloom.
The MM medium used to culture the microorganisms had the following composition:
MgSO 4 0.2g/L；KH 2 PO 4 1.5g/L; totalizing<0.1 g/L Fe (III) -NH 4 -Citrate，CaCl 2 ·2H 2 O，ZnSO 4 ·7H 2 O，MnCl 2 ·4H 2 O，H 3 BO 3 ，CoCl 2 ·6H 2 O，CuSO 4 ·5H 2 O，NiCl 2 ·6H 2 O，NaMoO 4 ·2H 2 O。
The 60MM medium is prepared by adding glucose 35g/L as carbon source into the MM medium, and adding 60g/L NaCl to maintain osmotic pressure; the pH was adjusted to between 6.5 and 9.0 with NaOH solution. The nitrogen source of the culture medium is added according to the need, and sodium glutamate or wool hydrolysate (mixed amino acids) with different concentrations can be used.
The composition of the LB medium used for culturing the microorganism was as follows:
tryptone (Tryptone) 10g/L Yeast extract (Yeast extract) 5g/L sodium chloride (NaCl) 10g/L
The concentration of sodium chloride in the 60LB medium is 60g/L.
The dry cell weight calculation method in the examples:
cell Dry Weight (CDW) is the Weight of the cells after all the water is removed, and is expressed in g/L. The method for detecting the dry cell weight comprises the steps of weighing the empty centrifuge tube with the mass of a, adding 35mL of bacterial liquid sample into a 50mL centrifuge tube by a pipette, centrifuging to remove supernatant, washing shake sediment by distilled water, removing residual culture medium components, and freeze-drying for 18-24 hours to obtain the weight b.
Cell dry weight= (b-a)/(0.035); the weight unit of the centrifuge tube is g; 0.035 represents 0.035L.
The calculation method of the carbon source conversion rate in the examples comprises:
carbon source conversion = amount of PHA produced (g)/(amount of glucose utilized) (g).
Gas chromatography detection of Polyhydroxyalkanoates (PHA):
about 30 mg of the dry product is added into an esterification pipe, about 16 mg, 18 mg, 20 mg and 22 mg of pure P3HB standard samples are respectively taken, 4 ml of esterification mixed liquid is respectively added (the esterification liquid and the chloroform are uniformly mixed according to the volume ratio of 1:1), and the metal bath at 100 ℃ is placed for heating and esterification for 4 hours after sealing. The esterification reaction bottle is taken out from the esterifying instrument and is placed in a fume hood to be cooled for 10-15 min to room temperature. Cooling to room temperature after esterification, adding 1ml ultrapure water into an esterification pipe, covering a bottle cap, oscillating 2500 rpm with a multi-pipe vortex instrument for 5min for extraction, standing for 1 h after oscillation is completed for layering an organic phase and a water phase, extracting 1ml of a lower organic phase by using a syringe in a fume hood, and injecting into a sample injection bottle for gas chromatography detection.
The gas chromatograph is Shimadzu GC-2014 type gas chromatograph, and the chromatographic column is HP-5 type chromatographic column. The GC analysis temperature increase program was set as follows: the sample inlet temperature is 240 ℃, the detector temperature is 250 ℃, the initial temperature is 80 ℃ and is kept for 1.5min, then the sample enters a first heating stage, the heating rate is 30 ℃/min, the second heating stage is 40 ℃/min, and when the temperature is raised to 240 ℃, the sample is kept for 2min.
The data processing method comprises the following steps: calculating 3HB monomer proportion by obtaining internal standard peak area measured by gas chromatography, internal standard peak area of PHA monomer methyl ester peak area sample of standard sample and PHA monomer methyl ester peak area of sample, and calculating 3HB mass in sample by taking the PHA monomer methyl ester peak area/internal standard peak area of standard sample as standard curve, and further calculating 3HB percentage content in sample: 3HB mass/cell dry weight.
Example 1: sodium glutamate is used as nitrogen source to improve the glucose conversion rate in fermentation production
The halophilus is prepared from the strain of PseudomonasHalomonas campaniensis LS21 is inoculated into a 60MM medium with three different nitrogen sources, the medium of a control group 1 uses 0.05 mol/L ammonia sulfate as the nitrogen source, the medium of a control group 2 uses 0.025 mol/L urea as the nitrogen source, the experimental group uses 0.05 mol/L sodium glutamate as the nitrogen source, and the quality of nitrogen elements in the medium of the control group 1, the medium of the control group 2 and the medium of the experimental group are consistent, and each group contains 60g/L NaCl and 35g/L glucose. Three replicates were run for each set of experiments, the results were averaged, incubated at 37℃and 200rpm for 48h, and glucose conversions were calculated and the results are shown in Table 1.
Table 1:Halomonas campaniensis LS21 uses sodium glutamate as nitrogen source to improve conversion rate of glucose to synthesize PHB
As can be seen from Table 1, in comparison with the use of ammonia sulfate or urea as the nitrogen sourceHalomonas campaniensis The use of sodium glutamate as a nitrogen source in LS21 can significantly improve the conversion rate of glucose, and the conversion rate of glucose reaches 0.47+/-0.01.
The results show that the conversion rate of glucose by fermentation using sodium glutamate as a nitrogen source is superior to that of ammonia sulfate and urea, and glucose can be converted into the target product P3HB as much as possible.
Example 2: knocking out halophilesglnNGene, sodium glutamate is used as nitrogen source, and glucose conversion rate in fermentation production is improved
First, halomonas halophila was knocked out using CRISPR/AID technologyHalomonas aydingkolgenesis Glutamine synthetase gene in M1glnNSpecifically, a plasmid with pSEVA341 as a framework is constructed, and the plasmid contains an sgRNA sequence as follows: gccagattctgcggcgcattct (SEQ ID NO: 1). The plasmid containing the sgRNA sequence and the CRISPR/AID plasmid were then separately transferred in combinationHalomonas aydingkolgenesisM1 strain, designing a pair of primers F tgttgaagagaccgggctt (SEQ ID NO: 2) and R tacagctggctttgagtgg (SEQ ID NO: 3) for colony PCR verification, sequencing the correct size strip, and successfully knocking out the strainglnNThe result of the mutation of CAG at the 126 th codon of the gene into TAG stop codon is shown in FIG. 1. Successful pick-outglnNThe colony of the gene is transferred to 60LB culture medium, and placed in a shaking table at 37 ℃ to lose plasmid, and the knockout is obtained after streaking verificationglnNGene strain designated M1-deltaglnN。
The gene knockout bacterium M1-delta is treatedglnNAnd original parent strainHalomonas aydingkolgenesis M1 was inoculated into 60MM medium with sodium glutamate as nitrogen source, the sodium glutamate concentration was set to 0.1mol/L, and each group contained 60g/L NaCl and 35g/L glucose. Three replicates were run for each set of experiments, the results were averaged, incubated at 37℃and 200rpm for 48h, and glucose conversions were calculated and the results are shown in Table 2.
Table 2: knock-outHalomonas aydingkolgenesis In M1glnNGene and use of sodium glutamate as nitrogen source can increase conversion rate of glucose to P3HB
As can be seen from the results in Table 2, the culture medium using sodium glutamate as a nitrogen source was also used as compared with the wild typeHalomonas aydingkolgenesis M1 knockdown ofglnNGene of geneHalomonas aydingkolgenesis The M1 strain can obviously improve the conversion rate of glucose, and the conversion rate of glucose reaches 0.58+/-0.02.
Thus, it was revealed that the glutamine synthetase gene was knocked outglnNAnd the sodium glutamate is used as a nitrogen source to replace urea, so that the glucose conversion rate can be obviously improved, and as much glucose as possible is converted into a target product P3HB, so that the method has a very good application prospect in industrial microorganism production.
Example 3: the wool hydrolysate (mixed amino acid) is used as nitrogen source to improve the dry weight of cells, PHA yield and glucose conversion rate in fermentation production
To be used forHalomonas bluephagenesis TD01 is used as a starting strain for fermentation culture, a control group and an experimental group are arranged, and the culture medium of the control group adopts the 60MM culture medium (0.1 mol/L urea is used as a nitrogen source); the culture medium of the experimental group replaces urea in the 60MM culture medium of the control group with wool hydrolysate (mixed amino acid, main components and proportion of the mixed amino acid are shown in fig. 2 and table 3, main components are glutamic acid, and various other amino acids are also contained), the control group and the experimental group both contain NaCl of 60g/L and glucose of 35g/L, three parallel samples are arranged in each group of experiments, and the results are averaged. Fermentation culture was carried out at 37℃and 200rpm, and 48℃and h were cultured. Then, the cells were collected and lyophilized to measure the dry weight of the cells, and the PHA content was measured by gas chromatography to calculate the glucose conversion, and the results are shown in Table 4.
Table 3: amino acid component and ratio contained in wool hydrolysate
Table 4:Halomonas bluephagenesis production of PHA by TD01 using wool hydrolysate (mixed amino acid) as nitrogen
As can be seen from the results in Table 4, the urea was used in comparison with the control groupWool hydrolysates (mixed amino acids) as nitrogen sources are described in the experimental groupHalomonas bluephagenesis Performing PHB production fermentation in TD01 can significantly increase cell dry weight, PHA yield, PHA percentage and glucose conversion. Wherein the dry weight of the cells reaches 15.67 and g/L, the weight of PHA reaches 12.41 and g/L, and the glucose conversion rate reaches 0.45.
Example 4 inPseudomonas putidaMedium knockout of glutamine synthetase gene and fermentation production of PHA using sodium glutamate or mixed amino acid as nitrogen source
Pseudomonas putida using CRISPR/AID technologyPseudomonas putidaMiddle knockout of glutamine synthetase Gene in its genomeglnA. A plasmid with pSEVA341 as a framework is constructed, and the plasmid contains an sgRNA sequence cagcaccacgtgaccatgc (SEQ ID NO: 4) of a targeted glutamine synthetase gene. Plasmids containing the sgRNA sequence and the CRISPR/AID plasmid were transferred into Pseudomonas putida. Sorting out successful knockouts after sequencing verificationglnAPlacing the colony of the gene in LB culture medium, culturing lost plasmid at 30 ℃, and obtaining knockout after streak verificationglnAGene strain designated PP-deltaglnA。
The gene knockout bacteria PP-delta are used for preparing the gene knockout bacteria PP-deltaglnAAnd (3) inoculating into an MM culture medium, and setting three groups of experiments, wherein urea, sodium glutamate and wool hydrolysate (mixed amino acid) with the concentration of 0.1mol/L are respectively used as nitrogen sources, and the glucose addition amounts are 35g/L. Three replicates were set for each set of experiments and the results averaged. Fermentation culture was carried out at 30℃and 200rpm, and 48℃and h were cultured. Then, the cells were collected and lyophilized to measure the dry weight of the cells, and the PHA content was measured by gas chromatography to calculate the glucose conversion, and the experimental results are shown in Table 5.
Table 5: in PP-deltaglnAFermentation comparison of the strains respectively using urea, sodium glutamate and wool hydrolysate as nitrogen sources
As can be seen from Table 5, PP-. DELTA.compared to urea as the nitrogen sourceglnACell stem of strain when sodium glutamate or mixed amino acid is used as nitrogen sourceThe percent of PHA and the conversion rate of glucose are obviously improved.
Example 5 in recombinationEscherichia coliMedium knockout of glutamine synthetase gene and optimization of PHA production using sodium glutamate or mixed amino acids as nitrogen source
Will be derived from Eutrophic bacillus roseburiRalstonia eutropha(Cupriavidus necator) PHB synthetic gene in (B)phaA，phaBAndphaCintegration of genes into E.coliEscherichia coliConstructing recombinant E.coli capable of producing PHA. The glutamine synthetase gene in its genome was then knocked out using the CRISPR/AID technique mentioned aboveglnA. A plasmid with pSEVA341 as a framework is constructed, and the plasmid contains an sgRNA sequence caggtgaatgctgaattctt (SEQ ID NO: 5) of a targeted glutamine synthetase gene. Plasmids containing the sgRNA sequence and the CRISPR/AID plasmid were transferred into E.coli. Sorting out successful knockouts after sequencing verificationglnAPlacing the colony of the gene in LB culture medium, culturing lost plasmid at 37 ℃, and obtaining knockout after streak verificationglnAGene strain designated EC-deltaglnA。
The gene knockout bacterium EC-deltaglnAAnd (3) inoculating into an MM culture medium, and setting three groups of experiments, wherein urea, sodium glutamate and wool hydrolysate (mixed amino acid) with the concentration of 0.1mol/L are respectively used as nitrogen sources, and the glucose addition amounts are 35g/L. Three replicates were set for each set of experiments and the results averaged. Fermentation culture was carried out at 37℃and 200rpm for 48 hours. Then, the cells were collected and lyophilized to measure the dry weight of the cells, and the PHA content was measured by gas chromatography to calculate the glucose conversion, and the experimental results are shown in Table 6.
Table 6: at EC-deltaglnAThe bacterial strains respectively use urea, sodium glutamate and wool hydrolysate as nitrogen source fermentation results
As can be seen from the results in Table 6, EC-. DELTA.compared with urea as the nitrogen sourceglnACell dry weight, PHA hundred of strain when sodium glutamate or mixed amino acid is used as nitrogen sourceThe percent and the glucose conversion rate are obviously improved.
Example 6 inRalstonia eutrophaMedium knockout of glutamine synthetase gene and optimization of PHA production using sodium glutamate or mixed amino acids as nitrogen source
In Eutrophic bacillus of RocheRalstonia eutropha(Cupriavidus necator) Knocking out glutamine synthetase genes in the genome thereof by using CRISPR/AID technologyglnA. A plasmid with pSEVA341 as a framework is constructed, and the plasmid contains an sgRNA sequence cgatccaggtggttgacctc (SEQ ID NO: 6) of a targeted glutamine synthetase gene. Plasmids containing the sgRNA sequence and the CRISPR/AID plasmid were transferred into Eutrophic bacteria. Sorting out successful knockouts after sequencing verificationglnAPlacing the colony of the gene in LB culture medium, culturing lost plasmid at 30 ℃, and obtaining knockout after streak verificationglnAGene strain designated RE-deltaglnA。
The gene knockout bacterium RE-delta is treatedglnAAnd (3) inoculating into an MM culture medium, and setting three groups of experiments, wherein urea, sodium glutamate and wool hydrolysate (mixed amino acid) with the concentration of 0.1mol/L are respectively used as nitrogen sources, and the adding amount of fructose is 20g/L. Three replicates were set for each set of experiments and the results averaged. Fermentation culture is carried out at 30 ℃ and 200rpm for 48 hours. Then, the cells were collected and lyophilized to measure the dry weight of the cells, the PHA content was measured by gas chromatography, and the fructose conversion was calculated, and the experimental results are shown in Table 7.
Table 7: at RE-deltaglnAThe bacterial strains respectively use urea, sodium glutamate and wool hydrolysate as nitrogen source fermentation results
As can be seen from the results in Table 7, RE-. DELTA.compared to urea as the nitrogen sourceglnAThe strain has obviously improved PHA percentage and fructose conversion rate when sodium glutamate or mixed amino acid is used as a nitrogen source.
Example 7 inAeromonas hydrophilaMiddle knockout of glutamine synthetase Gene Using sodium glutamate or Mixed amino acids as NitrogenSource can optimize PHA production
In aeromonas hydrophilaAeromonas hydrophilaKnocking out glutamine synthetase genes in the genome thereof by using CRISPR/AID technologyglnA. A plasmid with pSEVA341 as a framework is constructed, and the plasmid contains an sgRNA sequence ggagcagcacgtctccatcc (SEQ ID NO: 7) of a targeted glutamine synthetase gene. Plasmids containing the sgRNA sequence and the CRISPR/AID plasmid were transferred into Aeromonas hydrophila. Sorting out successful knockouts after sequencing verificationglnAPlacing the colony of the gene in LB culture medium, culturing lost plasmid at 30deg.C, and marking out for verification to obtain knockoutglnAGene strain designated AH-deltaglnA。
The gene knockout bacterium AH-delta is treatedglnAAnd (3) inoculating the mixture into an MM (medium), and setting three groups of experiments, wherein urea, sodium glutamate and mixed amino acid with the concentration of 0.1mol/L are respectively used as nitrogen sources, and the addition amount of lauric acid is 10g/L. Three replicates were set for each set of experiments and the results averaged. Fermentation culture is carried out at 30 ℃ and 200rpm for 48 hours. Then, the cells were collected and lyophilized to measure the dry weight of the cells, the PHA content was measured by gas chromatography, and the lauric acid conversion was calculated, and the experimental results are shown in Table 8.
Table 8: at AH-deltaglnAThe bacterial strains respectively use urea, sodium glutamate and wool hydrolysate as nitrogen source fermentation results
As can be seen from Table 8, AH-. DELTA.compared with urea as the nitrogen sourceglnAThe strain has obviously improved PHA percentage and lauric acid conversion rate when sodium glutamate or mixed amino acid is used as a nitrogen source.
The results show that by knocking out the glutamic acid synthesis gene and simultaneously using amino acid or mixed amino acid as a nitrogen source for fermentation experiments, the cell dry weight, PHA yield and carbon source conversion rate are superior to those of the single use of other nitrogen sources, so that the carbon source can be converted into a target product P3HB as much as possible, and meanwhile, the PHA accumulation amount is improved.
Comparative example 1 wild type SalmonellaHalomonas bluephagenesis TD01 and knockoutglnNRecombinant bacterium of geneHalomonas bluephagenesis TD01-ΔglnNIn contrast to the effect of the use of other amino acids on conversion
Knocking out halophila by CRISPR/AID technologyHalomonas bluephagenesis Glutamine synthetase gene in TD01glnNSpecific knockdownH. bluephagenesisIn (a) and (b)glnNGene methods reference example 2 using a sgRNA of cagccagtatggccagctat (SEQ ID NO: 8).
The gene knockout bacterium TD-delta is subjected toglnNAnd original parent strainHalomonas bluephagenesis TD01 was inoculated into 60MM medium, urea, glutamic acid and other amino acids were used as nitrogen sources, respectively, and the nitrogen source concentrations are shown in Table 9 (the concentrations were designed to be 1mol/L for each N element). Three replicates were run for each set of experiments, the results were averaged, incubated at 37℃and 200rpm for 48h, and glucose conversions were calculated and the results are shown in Table 9.
TABLE 9
As can be seen from the results in table 9, the conversion rate of glucose reached 0.47 when glutamic acid was used as a nitrogen source, compared to urea or other types of amino acids, which is significantly higher than in other groups; and, using glutamic acid as nitrogen source for fermentation culture knockoutglnNGene of geneHalomonas bluephagenesis The TD01 strain can further improve the conversion rate.
The preferred embodiments of the present invention have been described in detail above, but the present invention is not limited to the specific details of the above embodiments, and various simple modifications can be made to the technical solution of the present invention within the scope of the technical concept of the present invention, and all the simple modifications belong to the protection scope of the present invention.
In addition, the specific features described in the above embodiments may be combined in any suitable manner, and in order to avoid unnecessary repetition, various possible combinations are not described further.
Moreover, any combination of the various embodiments of the invention can be made without departing from the spirit of the invention, which should also be considered as disclosed herein.

Claims (17)

1. A recombinant microorganism, wherein a protein associated with glutamate synthesis of said recombinant microorganism is inactivated;
the glutamic acid synthesis related protein comprises one or more than two of glutamate dehydrogenase GdhA, glutamate synthase GltBD, glutamine synthase GlnA or glutamine synthase GlnN.
2. The recombinant microorganism according to claim 1, wherein the recombinant microorganism expresses a protein associated with the synthesis of an exogenous polyhydroxyalkanoate.
3. The recombinant microorganism according to claim 1, wherein the recombinant microorganism is selected from the group consisting of escherichia species @Escherichia) Genus PseudomonasPseudomonas) Genus RocheRalstonia) Genus AeromonasAeromonas) Genus CorynebacteriumCorynebacterium) Or halomonas genusHalomonas）。
4. A method for producing a recombinant microorganism according to any one of claims 1 to 3, which comprises inactivating a glutamic acid synthesis-related protein in a starting strain.
5. The method according to claim 4, wherein the method further comprises introducing polyhydroxyalkanoate to synthesize a protein.
6. A culture medium for a microorganism, wherein the culture medium comprises a nitrogen source, and wherein the nitrogen source comprises an amino acid or an amino acid salt;
the adding mode of the amino acid comprises directly adding one or more than two amino acids or adding substances which generate amino acids after hydrolysis.
7. The medium of claim 6, wherein the amino acid-producing substance after hydrolysis comprises one or more of hair hydrolysate, algae meal hydrolysate or casein hydrolysate.
8. The medium of claim 6, wherein the amino acid is one or more selected from the group consisting of glycine, alanine, valine, leucine, isoleucine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, glutamic acid, lysine, arginine and histidine,
the amino acid salt comprises one or more than two of potassium salt, sodium salt, calcium salt, magnesium salt or zinc salt of amino acid.
9. The medium according to claim 6, wherein the concentration of the amino acid or amino acid salt in the medium is 0.01-2mol/L.
10. The medium of claim 6, wherein the medium comprises a carbon source and the concentration of the carbon source in the medium is 1-300 g/L.
11. The medium of claim 10, wherein the carbon source is selected from one or more of glucose, gluconate, sucrose, fructose, lauric acid, acetic acid, propionic acid, butyric acid, palm oil, or oleic acid.
12. The medium according to claim 6, wherein the medium comprises an inorganic salt,
the concentration of inorganic salt in the culture medium is 2.5-100 g/L.
13. The culture medium according to claim 6, wherein the microorganism is selected from the group consisting of Escherichia genusEscherichia) Genus PseudomonasPseudomonas) Genus RocheRalstonia) Genus AeromonasAeromonas) Genus CorynebacteriumCorynebacterium) Or halomonas genusHalomonas）。
14. The medium of claim 6, wherein the microorganism expresses a protein associated with the synthesis of an exogenous polyhydroxyalkanoate.
15. The medium of claim 14, wherein the microorganism is inactivated by a protein associated with glutamate synthesis.
16. A method of culturing a microorganism, comprising using the medium of any one of claims 6-15.
17. A method for producing polyhydroxyalkanoate, comprising culturing a microorganism using the medium of any one of claims 6-15.
CN202311167153.0A 2023-09-12 2023-09-12 Recombinant microorganism and application thereof in production of polyhydroxyalkanoate Pending CN116904384A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202311167153.0A CN116904384A (en) 2023-09-12 2023-09-12 Recombinant microorganism and application thereof in production of polyhydroxyalkanoate

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202311167153.0A CN116904384A (en) 2023-09-12 2023-09-12 Recombinant microorganism and application thereof in production of polyhydroxyalkanoate

Publications (1)

Publication Number Publication Date
CN116904384A true CN116904384A (en) 2023-10-20

Family

ID=88367174

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202311167153.0A Pending CN116904384A (en) 2023-09-12 2023-09-12 Recombinant microorganism and application thereof in production of polyhydroxyalkanoate

Country Status (1)

Country Link
CN (1) CN116904384A (en)

Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101195677A (en) * 2006-12-07 2008-06-11 深圳市奥贝尔科技有限公司 Polyhydroxyalkanoates-hydroxyl alkoxyl alkyl acid ester and biosynthesis production method thereof
CN101993849A (en) * 2009-08-21 2011-03-30 中国科学院上海生命科学研究院 Biological hydrogen production genetic engineering bacteria for relieving ammonium repression and construction method thereof
CN102268424A (en) * 2010-06-01 2011-12-07 中国科学院微生物研究所 Beta-ketothiolase related to 3-HV monomer synthesis of PHBV, coding gene thereof, and application thereof
CN103314101A (en) * 2010-11-03 2013-09-18 加利福尼亚大学董事会 Biofuel and chemical production by recombinant microorganisms via fermentation of proteinacious biomass
CN103865838A (en) * 2014-01-13 2014-06-18 南京工业大学 Pseudomonas mandelii CBS-1 and application thereof
US20180057807A1 (en) * 2016-07-07 2018-03-01 Ut-Battelle, Llc Gene modification in clostridium for increased alcohol production
CN112771171A (en) * 2018-09-27 2021-05-07 住友林业株式会社 Molecular weight control technology of PHA copolymer produced by halophilic bacteria
CN114134096A (en) * 2022-02-07 2022-03-04 清华大学 3-hydroxybutyrate, 4-hydroxybutyrate and 3-hydroxyvalerate terpolymer P (3HB-4HB-3HV) and microbial production thereof
KR20220043918A (en) * 2020-09-29 2022-04-05 한국화학연구원 Recombinant Corynebacterium glutamicum strain for producing 5-hydroxyvaleric acid and a method of producing glutaric acid using the same
CN115851510A (en) * 2022-10-13 2023-03-28 深圳中科翎碳生物科技有限公司 Halomonas and application thereof in co-production of tetrahydropyrimidine and polyhydroxyalkanoates

Patent Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101195677A (en) * 2006-12-07 2008-06-11 深圳市奥贝尔科技有限公司 Polyhydroxyalkanoates-hydroxyl alkoxyl alkyl acid ester and biosynthesis production method thereof
CN101993849A (en) * 2009-08-21 2011-03-30 中国科学院上海生命科学研究院 Biological hydrogen production genetic engineering bacteria for relieving ammonium repression and construction method thereof
CN102268424A (en) * 2010-06-01 2011-12-07 中国科学院微生物研究所 Beta-ketothiolase related to 3-HV monomer synthesis of PHBV, coding gene thereof, and application thereof
CN103314101A (en) * 2010-11-03 2013-09-18 加利福尼亚大学董事会 Biofuel and chemical production by recombinant microorganisms via fermentation of proteinacious biomass
US20130288325A1 (en) * 2010-11-03 2013-10-31 The Regents Of The University Of California Biofuel and chemical production by recombinant microorganisms via fermentation of proteinaceous biomass
CN103865838A (en) * 2014-01-13 2014-06-18 南京工业大学 Pseudomonas mandelii CBS-1 and application thereof
US20180057807A1 (en) * 2016-07-07 2018-03-01 Ut-Battelle, Llc Gene modification in clostridium for increased alcohol production
CN112771171A (en) * 2018-09-27 2021-05-07 住友林业株式会社 Molecular weight control technology of PHA copolymer produced by halophilic bacteria
KR20220043918A (en) * 2020-09-29 2022-04-05 한국화학연구원 Recombinant Corynebacterium glutamicum strain for producing 5-hydroxyvaleric acid and a method of producing glutaric acid using the same
CN114134096A (en) * 2022-02-07 2022-03-04 清华大学 3-hydroxybutyrate, 4-hydroxybutyrate and 3-hydroxyvalerate terpolymer P (3HB-4HB-3HV) and microbial production thereof
CN115851510A (en) * 2022-10-13 2023-03-28 深圳中科翎碳生物科技有限公司 Halomonas and application thereof in co-production of tetrahydropyrimidine and polyhydroxyalkanoates

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
CHEN GQ等: "Engineering bacteria for enhanced polyhydroxyalkanoates (PHA) biosynthesis", 《SYNTH SYST BIOTECHNOL》, vol. 02, no. 03, pages 192 - 197 *
GUZMÁN H等: "A process for the production of ectoine and poly(3-hydroxybutyrate) by Halomonas boliviensis", 《APPL MICROBIOL BIOTECHNOL》, vol. 84, no. 06, pages 1069 - 1077, XP019757444, DOI: 10.1007/s00253-009-2036-2 *
宋水山, 马宏, 高振贤, 贾振华, 张霞: "以葡萄糖为唯一碳源合成聚-4-羟基丁酸的重组大肠杆菌的构建", 微生物学报, no. 03 *
宋水山等: "以葡萄糖为唯一碳源合成聚-4-羟基丁酸的重组大肠杆菌的构建", 《微生物学报》, vol. 2005, no. 03, pages 382 - 386 *
李正军;魏晓星;陈国强;: "生产聚羟基脂肪酸酯的微生物细胞工厂", 生物工程学报, no. 10, pages 1426 - 1435 *

Similar Documents

Publication Publication Date Title
CN102325883B (en) Method for culturing microorganism, and process for producing substance with microorganism
KR20220132559A (en) Microbial-derived protein hydrolyzate, and method and use thereof
JPH10108682A (en) Polyester polymerase gene and production of polyester
CN114381415B (en) Gene recombination strain for high-yield PHA and construction method thereof
CN110857449B (en) Improved method for producing polyhydroxyalkanoate
CN114480317B (en) Engineered microorganisms expressing acetoacetyl-coa reductase variants and methods of increasing PHA production
CN105647844B (en) Recombinant bacterium for producing glycolic acid by using xylose and construction method and application thereof
CN115851510A (en) Halomonas and application thereof in co-production of tetrahydropyrimidine and polyhydroxyalkanoates
CN113249238B (en) Acid-resistant saccharomyces cerevisiae and application thereof in preparation of organic acid
CN116970659B (en) Method for producing polyhydroxyalkanoate
CN112126609B (en) Recombinant bacterium for producing polyhydroxybutyrate by using ethanol and construction method and application thereof
WO2020050113A1 (en) Method for manufacturing useful substance through use of fermentation process
CN116904384A (en) Recombinant microorganism and application thereof in production of polyhydroxyalkanoate
JP2024516050A (en) Genetically engineered microorganisms expressing acetoacetyl-CoA reductase variants and methods for improving PHA production
CN112625962A (en) Application of marinobacter in preparation of polyhydroxyalkanoate
CN113667627B (en) Construction and application of corynebacterium glutamicum for improving L-glutamic acid production efficiency
WO2023186037A1 (en) Method for preparing glycine, acetyl coenzyme a, and acetyl coenzyme a derivative by using threonine
JP7425783B2 (en) Transformed microorganism and method for producing polyhydroxyalkanoic acid
CN117363554B (en) Engineered halophilic microorganism and construction method and application thereof
CN114736841B (en) Recombinant escherichia coli as well as preparation method and application thereof
CN113667686B (en) Escherichia coli recombinant bacteria for efficiently synthesizing inositol by utilizing glucose, construction method and application thereof
JP5099512B2 (en) Highly efficient production method of glycolipid
CN117965593A (en) Strain for producing 3-hydroxybutyric acid and construction method and application thereof
CN115927500A (en) Method for preparing scopoletin lactone by enzyme method
He et al. Two-stage pH control mode in batch fermentation of a novel bioflocculant from Corynebacterium glutamicum

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination