CN105985939B - A kind of its purposes of poly (hydroxyalkanoate) pellet degradation enzyme and (R) -3HB production method - Google Patents

Abstract

The application discloses a kind of its purposes of poly (hydroxyalkanoate) pellet degradation enzyme and (R) -3HB production method.Poly (hydroxyalkanoate) pellet degradation enzyme PhaZh1 of the invention or polypeptide, wherein the enzyme has amino acid sequence shown in sequence 8 in sequence table, the polypeptide and the enzyme have at least 70%, it is preferred that 80%, further preferred 90%, more preferable 95%, still more preferably 98%, and most preferably 99% homology, and have the enzymatic activity.Enzyme or polypeptide of the invention is capable of the poly (hydroxyalkanoate) particle of degrading microorganism fermentation accumulation, to prepare chiral monomer (R) -3HB.

Description

A kind of its purposes of poly (hydroxyalkanoate) pellet degradation enzyme and (R) -3HB production method

Technical field

Present invention relates generally to a kind of enzymes, and in particular to poly (hydroxyalkanoate) pellet degradation enzyme and utilization enzyme production (R)- The method of 3HB.

Background technique

In the bacterium that carbon source is sufficient to be grown in the environment of other nutrient deficiencies^[1]Or archaeal^[2]It can accumulate in the cell Tired poly (hydroxyalkanoate) (polyhydroxyalkanoate, PHA), PHA are stored as the substance of a kind of carbon source or the energy.Work as ring When lacking carbon source in border, the PHA of these storages will be utilized the survival to maintain thallus by cell mobilization^[3].This microorganism produces Raw PHA is the polymer of fully biodegradable, and has preferable biocompatibility.Have at present and is sent out by microorganism The method of ferment production PHA.

Extremely halophilic archaea Haloferax mediterranei (CGMCC 1.2087) can utilize several kinds of carbon source (such as Portugal Grape sugar, starch and chitin etc.)^[2-5]Accumulate a large amount of hydroxybutyric acid and hydroxypentanoic acid copolyesters (PHBV, poly (3- Hydroxybutyrate-co-3-hydroxyvalerate), one kind of PHA) particle is in intracellular.When the knockout bacterium genome In bktB gene when, cell only can accumulating poly hydroxybutyric acid (polyhydroxybutyrate, PHB, a kind of PHA are most simple Composition form) particle^[6].PHA synthase (PhaEC) is combined on these particles^[2], PHA grain structure albumen (phasins, PhaP)^[7]With PHA particle regulatory protein (PhaR)^[8]。

In addition to the purposes as degradation plastic, a kind of chiral monomer (R) -3HB ((R) -3 hydroxybutyric acid) of PHA is constituted Or there is the raw material of high added value in industry and field of medicaments^[9].(R) -3HB can be used for, for example, production organic synthesis, The beta-amino acids that petrochemical industry and medical treatment etc. are widely applied.

Chemical method prepares chipal compounds, it usually needs introduces chiral centre in advance, or first prepares racemic mixing After object, then carry out chiral separation.Such preparation process is complicated, separation is difficult, yield is greatly affected.And chemical synthesis process It needing to use to human body or the harmful solvent of environment, reactant more or generates unfavorable by-product, the environment of production process is unfriendly, It also can include a small amount of harmful components in the product finally obtained, influence it and further apply.

However be not much at present by the method that environmental-friendly bioanalysis produces (R) -3HB monomer, more lacking being capable of benefit The method for carrying out industrialized production with microorganism.

Summary of the invention

The present inventor is the study found that extremely halophilic archaea Haloferax mediterranei (CGMCC1.2087) is accumulated PHA pellet degradation enzyme PhaZh1 is also attached on tired PHA particle.Degrading enzyme PhaZh1 has typical patatin (Patatin) catalyst structure domain, wherein Gly16, Ser47 and Asp195 are important active site.PHA particle is in PhaZh1 Under the action of can be degraded to corresponding hydroxy alkanoic acid.It can be especially single chiral monomer (R)-by PHB pellet degradation 3HB。

For this purpose, the present invention provides a kind of poly (hydroxyalkanoate) of polyhydroxybutyrate PHB particle that energy degrading microorganism generates Grain degrading enzyme PhaZh1 or polypeptide.

The enzyme has amino acid sequence shown in sequence 8 in sequence table.

The polypeptide is with the enzyme at least 70%, preferably 80%, further preferred 90%, more preferable 95%, more Further preferred 98%, and most preferably 99% homology, and the polypeptide with the enzymatic activity.

The polypeptide is included at least corresponding to the 16th glycine of PhaZh1 enzyme, the 47th serine and the The amino acid residue of 195 aspartic acids.

It should be readily apparent to one skilled in the art that the Individual amino acids of the PhaZh1 enzyme are replaced, lack and/or are increased Polypeptide obtained from adding, as long as retaining crucial active site and structural domain, can still have it is same or similar with PhaZh1 enzyme seemingly , even higher activity, these polypeptides are also within the scope of the present invention.

The second aspect of the present invention provides above-mentioned poly (hydroxyalkanoate) pellet degradation enzyme PhaZh1 or polypeptide for poly- hydroxyl of degrading The purposes of base alkanoic acid PHA particle.Wherein the poly (hydroxyalkanoate) particle is selected from hydroxybutyric acid-hydroxyl pentanoate copolymer PHBV particle With polyhydroxybutyrate PHB particle.

The third aspect of the present invention provides above-mentioned PhaZh1 enzyme or polypeptide is used to produce the purposes of (R) -3-hydroxybutyrate.

The fourth aspect of the present invention provides one kind by the method for microbial fermentation production (R) -3-hydroxybutyrate, including with Lower step:

In the presence of the PhaZh1 enzyme or polypeptide, the PHA particle extracted by microbial fermentation decompose anti- It answers.

According to a kind of embodiment, which comprises fermented and cultured produces the bacterial strain of PHA particle, PHA to draw accumulation fund Grain, and in the presence of the PhaZh1 enzyme or polypeptide, at 35~50 DEG C, decomposition reaction is carried out at a temperature of preferably 37~45 DEG C.

The preferably described PHA particle is PHB particle.For produce PHB particle bacterial strain be not particularly limited, preferably those Superior strain.Including but not limited to halophilic archaea, bacterium etc..Specifically for example: halophilic archaea H.mediterranei EPS Δ BktB, bacterium Ralstonia eutropha etc..

According to a kind of preferred embodiment, by institute during the enzyme PhaZh1 or the polypeptide bacterial strain described in fermented and cultured It states bacterial strain and generates and be attached on the poly (hydroxyalkanoate) PHA particle and be extracted together.In this embodiment, it will extract Particle directly suspend in a suitable solution, decomposition reaction can be carried out under preference temperature.

It is preferred that using the PHA to be drawn accumulation fund using mild method, such as PHB particle.

After decomposition reaction, it can isolate and purify to obtain (R) -3-hydroxybutyrate by any of method.Such as it can By the way that after the methods of being centrifuged, filter and removing solid impurity, supernatant is purified by resin column；The side such as extraction can also be used Method is purified, but not limited to this.

Present invention discover that and demonstrating the PHA pellet degradation enzyme PhaZh1 degradation effect of poly (hydroxyalkanoate) PHA particle and true The active site of the enzyme is determined.The method that chiral monomer (R) -3HB is prepared by microbial fermentation is provided simultaneously, is bioanalysis Preparation (R) -3HB provides possibility.

Detailed description of the invention

The present invention is better understood with by the following drawings.

Fig. 1 is the bacterial strain H.mediterranei EPS Δ bktB (B) and bacterial strain for knocking out bktB gene The gas chromatographic analysis result figure of H.mediterranei EPS (A) accumulation PHA.

Fig. 2 is bacterial strain H.mediterranei EPS Δ bktB and bacterial strain H.mediterranei EPS Δ phaZh1 difference Fermented and cultured extracts PHA particle in the result figure of 45 DEG C of self-degradations.

Fig. 3 is the building structural schematic diagram of expression vector pTA03.

Fig. 4 is the electrophoresis photographs for purifying PhaZh1, and wherein M is standard protein sample, 1,2 respectively represent before purification after albumen electricity Swimming band.

Fig. 5 is the mass spectrogram for identifying albumen PhaZh1.

Fig. 6 is the electrophoresis photographs of the mutation PhaZh1 (D195A, S47A and G16A) and wild type PhaZh1 (WT) of purifying.

Fig. 7 is the experiment for being mutated PhaZh1 (D195A, S47A and G16A) and wild type PhaZh1 (WT) degradation PHB particle Middle solution turbidity versus time curve.

Fig. 8 is that the HPLC that the PhaZh1 enzyme obtained with the present invention carries out degradation reaction to PHB particle analyzes result figure.

Fig. 9 is the result figure with the PHB particle in the source PhaZh1 bacterium for degrading Ralstonia eutropha.

Specific embodiment

The advantages of more specific embodiment of the present invention and various aspects, will carry out in conjunction with attached drawing and specific embodiment below It explains in detail.However, it will be understood by those skilled in the art that these specific descriptions for a better understanding of the present invention, without Embodiments of the present invention are constituted with any limitation.

The building of embodiment 1 knocks out the bacterial strain H.mediterranei EPS Δ bktB of bktB gene and knocks out phaZh1 base The bacterial strain H.mediterranei EPS Δ phaZh1 of cause

The building of H.mediterranei EPS Δ bktB:

1, the building of the Homologous integration carrier pHFX-DbktB of gene bktB is knocked out

With extremely halophilic archaea Haloferax mediterranei (culture presevation number: CGMCC 1.2087) full-length genome For template, primer pair DbktB-F1-HindIII/DbktB-R1-BamHI and DbktB-F2-BamHI/DbktB-R2- are used KpnI amplifies the DNA fragmentation of gene bktB upstream 814bp (sequence 1) and downstream 799bp (sequence 2) respectively.PCR amplification journey Sequence: 94 DEG C of 5min initial denaturations；Then 94 DEG C of 30s, 55 DEG C of 30s, 68 DEG C of 1min carry out 30 circulations；Extend 10min after 68 DEG C, expands 25 μ L of increasing system.Use HindIII and BamHI digestion fragment upstream, BamHI and KpnI digestion segments downstream.After recycling digestion Upstream and downstream segment, then with carrier pHFX (extremely halophilic archaea and the shuttle vehicle of HindIII and KpnI digestion PHFX is constructed according to the method in bibliography [10]) it is connected, obtain Homologous integration recombinant plasmid pHFX-DbktB.

2, the building and functional verification of bktB deletion mutation strain H.mediterranei EPS Δ bktB

Knockout carrier pHFX-DbktB reference literature [2] the method built is converted into bacterial strain H.mediterranei EPS (construction method of bacterial strain H.mediterranei EPS is shown in document [4]), using described in document [10] with pyrF be screening The method of the homologous recombination of label obtains knocking out the bacterial strain H.mediterranei EPS Δ bktB of gene bktB.

Using document [2] the method, respectively to bacterial strain H.mediterranei EPS and recombinant bacterial strain The PHA of H.mediterranei EPS Δ bktB accumulation carries out gas chromatographic analysis, as a result as shown in Figure 1.Bacterial strain The PHA of H.mediterranei EPS accumulation is PHBV (see Figure 1A), and recombinant bacterial strain H.mediterranei EPS Δ bktB Accumulation is PHB (see Figure 1B).

The primer of the building bktB gene knockout carrier of table 1

Primer	Primer sequencea
		DbktB-F1-HindIII	ATCAAGCTTTGCCACCGACCCAATACG
DbktB-R1-BamHI	ATAGGATCCCGCCGAAGGTGGGGAAGG
		DbktB-F2-BamHI	ATAGGATCCCCGGGAAGGTCGTTACGT
DbktB-R2-KpnI	ATAGGTACCCGGTGACGGCATAGAGAT

^aRestriction enzyme site is indicated (similarly hereinafter) with black matrix

The building of H.mediterranei EPS Δ phaZh1:

1, the building of the Homologous integration carrier pHFX-DphaZh1 of gene phaZh1 is knocked out

Using extremely halophilic archaea Haloferax mediterranei (CGMCC 1.2087) full-length genome as template, use Primer pair phaZh1-DF1/phaZh1-DR1 and phaZh1-DF2/phaZh1-DR2 amplify gene phaZh1 upstream 521bp The DNA fragmentation of (sequence 3) and downstream 668bp (sequence 4), PCR amplification program: 94 DEG C of 5min initial denaturations；Then 94 DEG C of 30s, 55 DEG C 30s, 68 DEG C of 40s carry out 30 circulations；Extend 10min, 25 μ L of amplification system after 68 DEG C.Then Overlap extension PCR is utilized, with Amplifying the gene phaZh1 upstream and downstream segment come is template, is amplified and is melted using primer pair phaZh1-DF1/phaZh1-DR2 It closes segment 1159bp (sequence 5), PCR amplification program: 94 DEG C of 5min initial denaturations；Then 94 DEG C of 30s, 55 DEG C of 30s, 68 DEG C of 1.5min Carry out 30 circulations；68 DEG C re-extend 10min, and 25 μ L of amplification system handles the fusion segment using BamHI and KpnI digestion. Fusion segment after recycling digestion, is connected with the carrier pHFX of same digestion, obtains Homologous integration carrier pHFX-DphaZh1.

2, the building of phaZh1 deletion mutation strain H.mediterranei EPS Δ phaZh1

Knockout carrier pHFX-DphaZh1 reference literature [2] the method built is converted into bacterial strain H.mediterranei EPS (construction method of bacterial strain H.mediterranei EPS sees reference document [4]), utilizes document [10] bacterial strain for obtaining knocking out gene phaZh1 using pyrF as the method for the homologous recombination of selection markers described in H.mediterranei EPSΔphaZh1。

The primer of the building phaZh1 gene knockout carrier of table 2

Primer	Primer sequencea
		phaZh1-DF1	CGCGGATCCTCTAACAGCGAAGCACG
phaZh1-DR1	GAGCACCACCGTGAGAAGTCGTTGTGCAATTCATT
		phaZh1-DF2	ATTGCACAACGACTTCTCACGGTGGTGCTCCGGGA
phaZh1-DR2	CGGGGTACCACTGACCGTCGAAGGAA

The culture of 2 H.mediterranei EPS Δ bktB and H.mediterranei EPS Δ phaZh1 of embodiment and The extraction of PHA particle:

Culture medium:

AS-168 culture medium: every liter contains Bacto casamino acids (Difco) 5g, Bacto yeast Extract (Oxoid) 5g, sodium glutamate 1g, trisodium citrate 3g, epsom salt 20g, potassium chloride 2g, sodium chloride 200g, sulphur Sour iron is micro, manganese chloride trace, pH 7.0~7.2.

PA culture medium: every liter contains sodium chloride 110g, magnesium chloride hexahydrate 9.6g, epsom salt 14.4g, calcium chloride 1g, Potassium chloride 5g, ammonium chloride 2g, potassium dihydrogen phosphate 0.0375g, glucose 10g, ironic citrate ammonium salt solution 1mL, trace element solution SL-61mL。

Trace element solution SL-6 contains: 2~4mM of zinc ion, 1~2mM of manganese ion, 40~55mM of borate, cobalt ions 6 ~10mM, 0.5~1.5mM of copper ion, 1~2mM of nickel ion, 1~2mM of molybdate；PH is adjusted to 3~4.Preferably, described micro- Secondary element solution S L-6 contains zinc ion 3.5mM, manganese ion 1.6mM, borate 48.6mM, cobalt ions 8.4mM, copper ion 0.6mM, nickel ion 1.6mM, molybdate 1.3mM；PH is adjusted to 3~4.

Strain culturing:

The two plants of recombinant bacteriums constructed in embodiment 1 are cultivated on the agar plate containing AS-168 culture medium to (37 respectively DEG C) 3~4 days.Taking the single colonie on agar plate to access the test tube equipped with AS-168 fluid nutrient medium respectively, (50mL shakes pipe dress 10mL culture medium) in temperature is 37 DEG C, revolving speed is to cultivate 2~3 days on 200rpm shaking table to OD₆₀₀About 3.0 to 4.0, then with The inoculum concentration of 1:25 is forwarded to the shaking flask (1L shaking flask fills 250mL culture medium) equipped with PA culture medium in temperature is 37 DEG C, revolving speed is 3~4 days glucose consumptions into culture medium are cultivated totally on 200rpm shaking table, can be used to extract PHA particle.

The extraction of PHA particle:

Collect thallus, be suspended in PAS salting liquid (every liter contain sodium chloride 110g, magnesium chloride hexahydrate 9.6g, seven water sulfuric acid Magnesium 14.4g, calcium chloride 1g, potassium chloride 5g, ammonium chloride 2g), utilize french press machine (Thermo Spectronic French Pressure FA-078cell) it is crushed thallus, release PHA particle.Then PHA is concentrated using sucrose density gradient centrifugation Particle.Saccharose gradient be 1.0M, 1.3M, 1.6M, 2.0M, centrifugal condition 210,000 × g, 4 DEG C, 2 hours.After washing respectively Obtain the PHA particle of two kinds of bacterial strains production.

The self-degradation of 3 PHA particle of embodiment

Be prepared in embodiment 2 two kinds of PHA particles are resuspended in respectively in solution and obtain PHA particle suspension (2M KCl, 100mM Tris-HCl (pH 7.5), 5mM MgCl₂And PHA particle, OD₆₅₀~1.0), suspension is under conditions of 45 DEG C Reaction 5 hours or more.As a result as shown in Fig. 2, in the recombinant bacterium H.mediterranei EPS Δ bktB for having knocked out bktB, point Self-degradation has occurred from obtained PHB particle itself；And in the recombinant bacterium H.mediterranei for having knocked out phaZh1 gene In EPS Δ phaZh1, since bacterial strain cannot express PHA degrading enzyme PhaZh1, thus the PHBV particle of bacterium accumulation does not have in vitro It degrades.Result explanation, albumen PhaZh1 has the function of PHA particle of degrading, and is attached on PHA particle, It can thus be separated together.

The expression and purification of 4 PhaZh1 of embodiment

1, the building of expression vector pTA03

The building process of pTA03 is as shown in figure 3, specific embodiment is as follows:

Using extremely halophilic archaea Haloferax mediterranei (CGMCC 1.2087) full-length genome as template, with drawing Object expands promoter P5218 (sequence 6) to P5218-F/P5218-R, PCR amplification program: 94 DEG C of 5min initial denaturations；Then 94 DEG C 30s, 55 DEG C of 30s, 68 DEG C of 10s carry out 30 circulations；Extend 10min, 25 μ L of amplification system after 68 DEG C.Amplified production BamHI It is handled with KpnI digestion, (pTA1228 is extreme halotolerant by digestion products and the same pTA1228 handled with BamHI and KpnI digestion The carrier of archaeal and bacillus coli shuttle, sequence information and construction method are shown in document [11]) connection, obtain plasmid pTA01.With KpnI digestion handles pTA01, then eliminates to form flat end by 3 ' jags in the pTA01 of linearisation with T4DNA polymerase, The pTA01 of flat end is obtained into pTA02 from after connecting.Then pTA02, treated pTA02 are handled with EcoRI and BamHI digestion It is connected with the product after primer pair TA03-F/TA03-R annealing (80 DEG C of water-bath 10min, be then naturally cooling to room temperature) is used, Obtain carrier pTA03.

The relevant primer of 3 carrier construction pTA03 of table

Primer	Primer sequencea
		P5218-F	CGGGGTACCAATGGTGTCGAAGGGAAC
P5218-R	CGCGGATCCGAATTCGTCGTTCGTCATCTCCT
		TA03-F	AATTCGGTACCGGATCCCACCACCACCACCACCACTAA
TA03-R	GATCTTAGTGGTGGTGGTGGTGGTGGGATCCGGTACCG

2, the building of expression vector pTA03-phaZh1

Using extremely halophilic archaea Haloferax mediterranei (CGMCC 1.2087) full-length genome as template, use Primer pair phaZh1-TA-F/phaZh1-TA-R amplifies the open reading frame (ORF) of phaZh1 and its own promoter is total to The DNA fragmentation (sequence 7) of 978bp, PCR amplification program: 94 DEG C of 5min initial denaturations；Then 94 DEG C of 30s, 55 DEG C of 30s, 68 DEG C of 1min Carry out 30 circulations；Extend 10min, 25 μ L of amplification system after 68 DEG C, with EcoRI the and KpnI digestion segment.After recycling digestion Segment be connected with the pTA03 that same digestion is handled, obtain pTA03-phaZh1.

3, the building of bacterial strain Haloferax volcanii H1424 (pTA03-phaZh1) is expressed

Expression vector pTA03-phaZh1 reference literature [2] the method built is converted into H.volcanii H1424 (starting strain is Haloferax volcanii (culture presevation number: CGMCC1.2150), bacterial strain H.volcanii H1424's Relevant information and construction method see reference document [12]) Haloferax volcanii H1424 (pTA03- can be obtained phaZh1)。

The primer of the building phaZh1 expression vector of table 4

Primer	Primer sequencea
		phaZh1-TA-F	CCGGAATTCAGTGAGACCGATTCCACG
phaZh1-TA-R	CGGGGTACCTTTACTCGCCTGAAATTC

4, the culture of bacterial strain and the purifying of albumen PhaZh1

Culture medium:

YPC culture medium: every liter contains Bacto yeast extract (Oxoid) 5g, Peptone (Soya) 1g, Bacto Casamino acids (Difco) 1g, sodium chloride 144g, epsom salt 33g, magnesium chloride hexahydrate 30g, potassium chloride 4.2g, 1M Tris-HCl (pH 7.5) 12mL, 1M calcium chloride 6mL, pH 7.5.

Strain culturing and protein purification:

1), using YPC culture medium culture thallus (45 DEG C) to logarithmic phase, being forwarded to shaking flask with the inoculum concentration of 1:100, (2L is shaken Bottled liquid 500mL) 1.5 days (OD of culture₆₀₀About 3.0~4.0).

2), using refrigerated centrifuge in 4 DEG C, 10,000rpm centrifugation 15min collect thallus, if cannot use immediately needs Thallus is frozen in -20 DEG C.It is primary to wash thallus with sample-loading buffer (2M NaCl, 20mMTris-HCl, pH 8.0), repeat from The heart.With the power ultrasonication thallus of 200W, work 3s, is spaced 5s, total 20min.

3), using refrigerated centrifuge in 4 DEG C, 10,000rpm centrifugation 15min take supernatant and with 0.22 μm of membrane filtration.

4), by filtered protein solution inject Ni-agarose affinity column after, with wash buffer (2M NaCl, 20mM Tris-HCl (pH 8.0), 20mM imidazoles) 50mL rinse foreign protein, then with 10mL elution buffer (2M NaCl, 20mM Tris-HCl (pH 8.0), 500mM imidazoles) elution destination protein (electrophorogram of PhaZh1 is as shown in Figure 4).Purpose Albumen is identified (qualification result is as shown in Figure 5) through mass spectrometer (ABI 4700MALDI TOF-TOF).Obtained albumen With amino acid sequence shown in sequence 8；The albumen is in extremely halophilic archaea Haloferax mediterranei genome Encoding gene be sequence 9 shown in.

The determination of 5 PhaZh1 active site of embodiment

1, the building of the expression vector containing the mutational site gene phaZh1

Using extremely halophilic archaea Haloferax mediterranei (CGMCC 1.2087) full-length genome as template, respectively Using primer pair phaZh1-TA-F/phaZh1-G16A-R and phaZh1-G16A-F/phaZh1-TA-R amplify containing The partial dna sequence of phaZh1 mutated nucleotides, the mutant DNA sequences then gone out using above-mentioned primer pair amplifies are used as template Primer pair phaZh1-TA-F/phaZh1-TA-R amplifies the DNA fragmentation phaZh1- of phaZh1 mutation using Overlap extension PCR G16A (sequence 10), PCR amplification program: 94 DEG C of 5min initial denaturations；Then 94 DEG C of 30s, 55 DEG C of 30s, 68 DEG C of 1min carry out 30 Circulation；Extend 10min, 25 μ L of amplification system after 68 DEG C.Then primer pair phaZh1-TA- is used respectively using same method F/phaZh1-S47A-R and phaZh1-S47A-F/phaZh1-TA-R and phaZh1-TA-F/phaZh1-D195A-R and PhaZh1-D195A-F/phaZh1-TA-R amplifies the partial dna sequence containing phaZh1 mutated nucleotides, then with above-mentioned The mutant DNA sequences that primer pair amplifies go out two-by-two are template, utilize overlapping using primer pair phaZh1-TA-F/phaZh1-TA-R Extension PCR amplifies the DNA fragmentation phaZh1-S47A (sequence 11) and phaZh1-D195A (sequence 12) of phaZh1 mutation.It presses H.volcanii H1424 (pTA03-phaZh1-G16A), H.volcanii are constructed according to method similar in embodiment 4 H1424 (pTA03-phaZh1-S47A) and H.volcanii H1424 (pTA03-phaZh1-D195A), and purify PhaZh1's Each point mutation albumen PhaZh1G16A, PhaZh1S47A and PhaZh1D195A.

Table 5 constructs the primer of the expression vector of phaZh1 mutation

Primer	Primer sequence
		phaZh1-G16A-F	ATTGCCTGTCAAGGCGCCGGCAGTCACACGGCA
phaZh1-G16A-R	TGCCGTGTGACTGCCGGCGCCTTGACAGGCAAT
		phaZh1-S47A-F	GGCATCAGCGGAACGGCCGGCGGTGCGTTCAAC
phaZh1-S47A-R	GTTGAACGCACCGCCGGCCGTTCCGCTGATGCC
		phaZh1-D195A-F	GGCCACTACCACTGGGCCGGGCTATTCAGCCAA
phaZh1-D195A-R	TTGGCTGAATAGCCCGGCCCAGTGGTAGTGGCC

2, the activity analysis of point mutation albumen PhaZh1

The electrophoretogram of the wild-type protein of PhaZh1 mutain and embodiment 4 purifying purified above is as shown in Figure 6.It will Each albumen is separately added into (100 μ g mL of final concentration^-1) into embodiment 2 from bacterial strain H.mediterranei EPS Δ phaZh1 (2M KCl, 100mM Tris-HCl (pH 7.5), 5mM MgCl in the PHA particle suspension of extraction₂And PHA particle, OD₆₅₀~ 1.0), reaction condition is as described in Example 3.As a result as shown in fig. 7, in no blank control that albumen is added and PhaZh1 is added The degradation of PHA particle is not observed in the solution of mutain.And be added in the solution of wild type PhaZh1 can be apparent Observe the degradation of PHA particle.The result illustrates the amino acid residue Gly in PhaZh1¹⁶、Ser⁴⁷And Asp¹⁹⁵It is important work Property site.

The product analysis of 6 PhaZh1 of embodiment degradation PHB particle

By the PhaZh1 purified in embodiment 5 (100 μ g mL of final concentration^-1) be added in embodiment 2 from (2M KCl, 100mM Tris-HCl in the PHA particle re-suspension liquid extracted in H.mediterranei EPS Δ phaZh1 bacterial strain (pH 7.5), 5mM MgCl₂And PHA particle, OD₆₅₀~1.0).After being reacted 5 hours in 45 DEG C of water-baths, 12,000 × g centrifugation 5 Minute, take supernatant reference literature [13] to carry out product analysis (result represents (R) -3HB referring to Fig. 8, the peak of 13.7min).Through counting It calculates, finally obtains (R) -3HB of 9.15 ± 0.41mM.

Implement the PHB particle in 7 PhaZh1 bacterium for degrading sources

1, bacterium Ralstonia eutropha accumulates the extraction of PHB particle

Culture medium:

PN culture medium: every liter of yeast containing Bacto extract (Oxoid) 5g, Tryptone (Oxoid) 10g, glucose Sour sodium 5g, ammonium sulfate 5g, pH 7.0.

The extraction of strain culturing and PHB particle:

By Ralstonia eutropha (bacterial strain deposit number: CGMCC 1.3907) in the agar plate containing PN culture medium Upper culture (30 DEG C) 1~2 day, picking single bacterium, which is fallen within, shakes Yu Wen in pipe (50mL shakes pipe dress 10mL culture medium) containing PN culture medium Degree is 30 DEG C, revolving speed is that 1~2 day is cultivated on 200rpm shaking table to OD₆₀₀About 3.0 to 4.0.Then turned with the inoculum concentration of 1:25 The shaking flask (1L shaking flask fills 250mL culture medium) equipped with PN culture medium is connected in temperature is 30 DEG C, revolving speed is to train on 200rpm shaking table It supports 15~20 hours.The extraction of PHB particle is identical as described in embodiment 2.

2, the PHB particle in PhaZh1 bacterium for degrading source

By the PhaZh1 purified in embodiment 5 (100 μ g mL of final concentration^-1) be added to from Ralstonia eutropha (2M KCl, 100mM Tris-HCl (pH 7.5), 5mM MgCl in the PHB particle re-suspension liquid of extraction₂And PHB particle, OD₆₅₀~ 1.0).As a result as shown in figure 9, can significantly observe that PhaZh1 is capable of the PHB particle in bacterium for degrading source.

Bibliography:

1.Grage K,Jahns AC,Parlane N,Palanisamy R,Rasiah IA,Atwood JA,Rehm BHA.2009.Bacterial polyhydroxyalkanoate granules:biogenesis,structure,and potential use as aano-/micro-beads in biotechnological and biomedical applications.Biomacromolecules 10:660-669.

2.Lu QH,Han J,Zhou LG,Zhou J,Xiang H.2008.Genetic and biochemical characterization of the poly(3-hydroxybutyrate-co-3-hydroxyvalerate)synthase in Haloferax mediterranei.J.Bacteriol.190:4173-4180.

3.Handrick R,Reinhardt S,Jendrossek D.2000.Mobilization of poly(3- hydroxybutyrate)in Ralstonia eutropha.J.Bacteriol.182:5916-5918.

4.Zhao D,Cai L,Wu J,Li M,Liu H,Han J,Zhou J,Xiang H.2012.Improving polyhydroxyalkanoate production by knocking out the genes involved in exopolysaccharide biosynthesis in Haloferax mediterranei.Appl Microbiol Biotechnol.

5.Hou J,Han J,Cai L,Zhou J,Lu Y,Jin C,Liu J,Xiang H.2014.Characterization of genes for chitin catabolism in Haloferax mediterranei.Appl Microbiol Biotechnol 98:1185-1194.

6.Hou J,Feng B,Han J,Liu HL,Zhao DH,Zhou J,Xiang H.2013.Haloarchaeal- type beta-ketothiolases involved in poly(3-Hydroxybutyrate-co-3- Hydroxyvalerate)synthesis in Haloferax mediterranei.Appl.Environ.Microbiol. 79:5104-5111.

7.Cai SF,Cai L,Liu HL,Liu XQ,Han J,Zhou J,Xiang H.2012.Identification of the haloarchaeal phasin(PhaP)that functions in polyhydroxyalkanoate accumulation and granule formation in Haloferax mediterranei.Appl.Environ.Mi crobiol.78:1946-1952.

8.Cai SF,Cai L,Zhao DH,Liu GM,Han J,Zhou J,Xiang H.2015.A novel DNA- binding protein,PhaR,plays a central role in the regulation of polyhydroxyalkanoate accumulation and granule formation in the haloarchaeon Haloferax mediterranei.Appl.Environ.Microbiol.81:373-385.

9.Ren Q,Ruth K,Thony-Meyer L,Zinn M.2010.Enatiomerically pure hydroxycarboxylic acids:current approaches and future perspectives.Appl.Micr obiol.Biotechnol.87:41-52.

10.Liu H,Han J,Liu X,Zhou J,Xiang H.2011.Development of pyrF-based gene knockout systems for genome-wide manipulation of the archaea Haloferax mediterranei and Haloarcula hispanica.J.Genet.Genomics 38:261-269.

11.Brendel J,Stoll B,Lange SJ,Sharma K,Lenz C,Stachler AE,Maier LK, Richter H,Nickel L,Schmitz RA,Randau L,Allers T,Urlaub H,Backofen R, Marchfelder A.2014.A complex of Cas proteins 5,6,and 7is required for the biogenesis and stability of clustered regularly interspaced short palindromic repeats(CRISPR)-derived RNAs(crRNAs)in Haloferax volcanii.J.Biol.Chem.289: 7164-7177.

12.Stroud A,Liddell S,Allers T.2012.Genetic and biochemical identification of a novel single-stranded DNA-binding complex in Haloferax volcanii.Front.Microbiol.3:224.

13.Lu J,Takahashi A,Ueda S.2014.3-Hydroxybutyrate oligomer hydrolase and 3-hydroxybutyrate dehydrogenase participate in intracellular polyhydroxybutyrate and polyhydroxyvalerate degradation in Paracoccus denitr ificans.Appl.Environ.Microbiol.80:986-993.

Claims (9)

1. The purposes of poly (hydroxyalkanoate) particle 1. poly (hydroxyalkanoate) PHA pellet degradation enzyme PhaZh1 is used to degrade, the poly- hydroxyl alkane Sequence amino acid sequence as shown in sequence 8 in sequence table of sour PHA pellet degradation enzyme PhaZh1.
2. 2. purposes according to claim 1, wherein the poly (hydroxyalkanoate) PHA particle is selected from hydroxybutyric acid-hydroxypentanoic acid Copolymer p HBV particle and polyhydroxybutyrate PHB particle.
3. 3. poly (hydroxyalkanoate) pellet degradation enzyme PhaZh1 is used to produce the purposes of (R) -3-hydroxybutyrate, the poly (hydroxyalkanoate) Sequence amino acid sequence as shown in sequence 8 in sequence table of PHA pellet degradation enzyme PhaZh1.
4. 4. a kind of method for producing (R) -3-hydroxybutyrate by microbial fermentation, comprising the following steps:

   In the presence of poly (hydroxyalkanoate) pellet degradation enzyme PhaZh1, to the poly (hydroxyalkanoate) extracted by microbial fermentation PHA Grain carries out decomposition reaction, wherein the sequence of enzyme amino acid sequence as shown in sequence 8 in sequence table.
5. 5. according to the method described in claim 4, the method comprise the steps that

   The bacterial strain of fermented and cultured production poly (hydroxyalkanoate) PHA particle；

   The poly (hydroxyalkanoate) PHA particle drawn accumulation fund；With

   In the presence of the poly (hydroxyalkanoate) PHA pellet degradation enzyme PhaZh1, decomposition reaction is carried out at a temperature of 35~50 DEG C.
6. 6. according to the method described in claim 5, the decomposition reaction carries out at a temperature of 37~45 DEG C.
7. 7. according to the method described in claim 5, wherein the poly (hydroxyalkanoate) PHA particle is polyhydroxybutyrate PHB particle.
8. 8. according to the method described in claim 7, the bacterial strain for wherein producing polyhydroxybutyrate PHB particle is halophilic archaea H.mediterranei EPS Δ bktB or bacterium Ralstonia eutropha.
9. 9. the method according to any one of claim 4~8, wherein the poly (hydroxyalkanoate) PHA pellet degradation enzyme It is generated and is attached to one on the poly (hydroxyalkanoate) PHA particle by the bacterial strain during PhaZh1 bacterial strain described in fermented and cultured It is same to be extracted.