CN101058799B - Method of producing polyhydroxyalkanoates and special-purpose engineering bacterium for the same - Google Patents

Method of producing polyhydroxyalkanoates and special-purpose engineering bacterium for the same Download PDF

Info

Publication number
CN101058799B
CN101058799B CN2007100985164A CN200710098516A CN101058799B CN 101058799 B CN101058799 B CN 101058799B CN 2007100985164 A CN2007100985164 A CN 2007100985164A CN 200710098516 A CN200710098516 A CN 200710098516A CN 101058799 B CN101058799 B CN 101058799B
Authority
CN
China
Prior art keywords
bacteria
coli
pha
genbank number
cab
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN2007100985164A
Other languages
Chinese (zh)
Other versions
CN101058799A (en
Inventor
陈国强
魏晓星
吴琼
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tsinghua University
Original Assignee
Tsinghua University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tsinghua University filed Critical Tsinghua University
Priority to CN2007100985164A priority Critical patent/CN101058799B/en
Publication of CN101058799A publication Critical patent/CN101058799A/en
Application granted granted Critical
Publication of CN101058799B publication Critical patent/CN101058799B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Landscapes

  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a method for producing polyhydroxy fatty acid ester and a specific project bacterial, which is a recombination bacterial after diverting recombination expression carrier with cascade anaerobic induced promoter and polyhydroxy fatty acid ester synthesis gene to host bacterial. The manufacturing method of polyhydroxy fatty acid ester is: getting polyhydroxy fatty acid ester by fermentation of the project bacterial in the anoxic condition. The invention doesn't need air or oxygen in the fermentation synthesis PHA process, which also doesn't need nitrogen, reduces the cost.

Description

A kind of method and dedicated engineering bacteria thereof of producing polyhydroxyalkanoate
Technical field
The present invention relates to a kind of method and dedicated engineering bacteria thereof of producing polyhydroxyalkanoate.
Background technology
Polyhydroxyalkanoate (polyhydroxyalkanoates, be called for short PHA) be extensively to be present in the biological polyester of the intravital family macromolecule of microorganism, in vivo mainly as reserve substance (the Anderson AJ of carbon source and energy, Dawes EA.Occurrence, metabolism, metabolic role, and industrial use ofbacterial polyhydroxyalkanoates.Microbiol.Rev., 1990,54:450-472; MadisonLL, Huisman GW.Metabolic engineering of poly (3-hydroxyalkanoates): from DNAto plastic.Microbiol.Mol.Biol.Rev., 1999,63:21-53).Natural multiple microorganism all can be synthesized PHA, its molecular weight generally by several ten thousand to millions of (Sudesh K, Abe H, Doi Y.Synthesis, structure and properties of polyhydroxyalkanoates:biologicalpolyesters.Prog.Polym.Sc i., 2000,25:1503-1555).
The general structure of PHA is:
Figure G2007100985164D00011
N=1,2,3 or 4 wherein; Usually n=1 is poly--3-hydroxy fatty acid.M represents the polymerization degree, the size of decision molecular weight.R is variable group, can be saturated or unsaturated, straight chain or contains side chain and substituent alkyl.
PHA and traditional, with the oil is raw material synthetic plastics such as polyethylene, polypropylene etc. have similar materialogy character, but can be with the reproducible energy (as the carbohydrate of photosynthesis of plant generation, lipid acid etc.) synthetic, and can degrade fully and enter natural ecological circulation, therefore be considered to a kind of eco-friendly " green plastic ", can substitute nondegradable conventional plastic, and cause extensive attention (the Steinb ü chel A.Perspectives for biotechnological production andutilization of biopolymers:metabolic engineering of polyhydroxyalkanoatebiosynthesis pathways as a successful example.Macromol.Biosci. of countries in the world scientific circles and industrial community, 2001,1:1-24; Chen GQ, Wu Q, Xi JZ, et al.Microbial production of biopolyesters-polyhydroxyalkanoates.Prog.Nat.Sci., 2000,10:843-850; Lee SY.Bacterialpolyhydroxyalkanoates.Biotechnol.Bioeng., 1996,49:1-14).The major cause of current puzzlement PHA industrialization is that the relative oil plastics of its production cost are still higher.
At present, the method for traditional production PHA mostly is and utilizes wild PHA to produce bacterium at aerobic condition bottom fermentation accumulation PHA.Yet under aerobic condition, the acetyl-CoA that produces through glycolytic pathway as the carbohydrate of carbon source enters the tricarboxylic acid cycle system immediately provides energy for biology growing, final a part of carbon source becomes carbonic acid gas and is discharged from, and the residue carbon source then is respectively applied for the accumulation of thalli growth and product P HA.In this process, aerobic metabolism also can produce extra NADH and cause metabolic imbalance, causes the waste of energy in high oxygen consumption in the fermenting process and the raw material.In addition, in the fermentation production process of reality, the oxygen consumption power cost of fermenting process is often up to about 50% of the total power consumption of fermentation cost.Therefore present existing PHA fermentative production technology exists the carbon source transformation efficiency low, and the high problem of fermentation costs.So press for exploitation can be synthesized PHA under anoxia condition technology, reduce the production cost of PHA.So-called anoxic fermentation is meant in anaerobic or the little oxygen (fermentation culture of carrying out under the state of dissolved oxygen DO＜0.5mg/L).Compare the cultivation under the aerobic condition, anoxic fermentation need not in fermented liquid Extra Supply pure oxygen or the air usefulness for microbial metabolism.Strict anaerobically fermenting need constantly feed nitrogen in culturing process.
Summary of the invention
The purpose of this invention is to provide a kind of method and dedicated engineering bacteria thereof of producing polyhydroxyalkanoate.
Production polyhydroxyalkanoate engineering bacteria provided by the present invention is to be transferred to the reorganization bacterium that obtains behind the host bacterium with containing the hypoxia inducible promotor with the recombinant expression vector that is series at the polyhydroxyalkanoate synthetic gene in described hypoxia inducible promotor downstream.
Described hypoxia inducible promotor can be the ethanol dehydrogenase promotor of (alcohol dehydrogenase is called for short ADH) and (is called for short P AdhE) (is 5 of NC_000913 ' end 1294197-1294669 position Nucleotide from GENBANK number), the promotor of pyruvic acid-formic acid lyase (pyruvate formate lyase is called for short PFL) (is 5 of NC_000913 ' end 4143715-4144281 position Nucleotide from GENBANK number), the promotor of serum lactic dehydrogenase (D-lactate dehydrogenase) (is 5 of NC_000913 ' end 1439568-1439878 position Nucleotide from GENBANK number), the promotor (P of glycerol dehydrogenase (glycerol dehydrogenase is called for short GLD) IdhA) (is 5 of NC_000913 ' end 4135492-4135955 position Nucleotide from GENBANK number), the promotor (P of aerobic repiration modulin (aerobic respiration control protein is called for short ARC) ArcA) (is 5 of NC_000913 ' end 3348236-3348711 position Nucleotide from GENBANK number) etc.
Described polyhydroxyalkanoate synthetic gene can be the gene of synthetic short chain PHA-poly butyric ester PHB, as derives from the PHB synthetic gene phaCAB (being 5 of AM260479 ' end 1557353-1561203 position Nucleotide from GENBANK number) of the synthetic short chain PHA of the true bacteria Ralstonia of Luo Shi eutropha or the PHB synthetic gene phaCAB (being 5 of U47026 ' end 533-4336 position Nucleotide from GENBANK number) of huge Alcaligenes Alcaligenes latus; Also can be the synthetic gene of synthetic middle long-chain PHA, as derive from middle long-chain PHA synthetic gene phaC1ZC2 (being 5 of AY278219 ' end 1-4746 position Nucleotide) and the phaC (holding 1-1683 position Nucleotide for 5 of NC_002947 ') of Rhodopseudomonas Pseudomonas from GENBANK number from GENBANK number, also can be short chain and middle long-chain pha copolymer synthetic gene, as derive from the PHA synthetic gene phaPCJ (being 5 of AY093685 ' end 292-2920 position Nucleotide) of Aeromonas Aeromonas from GENBANK number.
Described host bacterium can be intestinal bacteria, huge Alcaligenes, the true bacteria of Luo Shi, pseudomonas or has a liking for water-based gas sporangium, is preferably intestinal bacteria, such as the deletion mutant E.coli ackA of wild e. coli k-12 and two strain acetate route of synthesis thereof -With E.coli pta -Deng.Some promotors such as alcohol dehydrogenase promoter (are called for short P AdhE) and pyruvic acid-formic acid lyase promotor (abbreviation P Flp) at some colibacillary mutant (as acetate route of synthesis mutant E.coli ackA -With E.coli pta -) in activity can be higher than wild-type e. coli.
The carrier that sets out of described carrier recombinant expressed in intestinal bacteria is pBluescript IISK (-) (the NCBIGenBank searching number is X52330).Described is pBBR1MCS-2 (NCBI GenBank number is U23751) at pseudomonas and the carrier that sets out of having a liking for carrier recombinant expressed in the water-based gas sporangium.
The method of production polyhydroxyalkanoate provided by the present invention is with above-mentioned engineering bacteria, and under anoxia condition, fermentation obtains polyhydroxyalkanoate.
Described anoxia condition is anaerobic or little oxygen condition, i.e. dissolved oxygen DO＜0.5mg/L; During the fermentation need be in the PHA cumulative process bubbling air or oxygen rich gas or the strictly anaerobic condition is provided; According to arts demand, also can carry out aerobic fermentation accumulation thalline early stage cultivating, be cultured to the middle and later periods and stop ventilation and transfer anoxic to and cultivate, and under anoxia condition, carry out the synthetic of PHA.
The leavening temperature of described colibacillus engineering is 28-38 ℃; Be preferably 37 ℃.
The fermention medium of described colibacillus engineering is the substratum that contains 3-7g/L yeast extract, 6-12g/L peptone, 6-12g/L NaCl, 10-30g/L glucose; In order to prevent living contaminants, also can add 60-100 μ g/mL penbritin in the described substratum.The fermention medium of colibacillus engineering is preferably and contains 5g/L yeast extract, 10g/L peptone, 10g/L NaCl, 20g/L glucose and 100 μ g/mL penbritins.
Described pseudomonas engineering bacteria can be selected any one in following three kinds of substratum for use:
1) every liter of substratum contains: yeast extract 4-6g/L, and peptone 8-12g/L, NaCl 8-12g/L, glucose 18-22g/L, all the other are water.
2) every liter of substratum contains: yeast extract 4-6g/L, peptone 8-12g/L, glucose 40-60g/L, (NH 4) 2SO 45-7g/L; MgSO 40.38-0.45g/L; Na 2HPO 412H 2O 9.6-9.7g/L; KH 2PO 41.2-1.8g/L, trace element solution I 8-12mL/L, trace element solution II 0.8-1.2mL/L, all the other are water; Every liter of trace element solution I contains: Fe (III)-NH 4-Citrate 4-6g/L, CaCl 22H 2O 1.8-2.2g/L, all the other are 0.4-0.6M HCl; Every liter of trace element solution II contains: ZnSO 47H 2O 80-120mg/L, MnCl 24H 2O 25-35mg/L, H 3BO 3280-320mg/L, CoCl 26H 2O 180-220mg/L, CuSO 45H 2O8-12mg/L, NiCl 26H 2O 18-22mg/L, NaMoO 42H 2O 28-32mg/L, all the other are 0.4-0.6M HCl.
3) every liter of substratum contains: lauric acid 7-9g/L, (NH 4) 2SO 41.8-2.2g/L; MgSO 40.38-0.45g/L; Na 2HPO 412H 2O 9.6-9.7g/L; KH 2PO 41.2-1.8g/L, trace element solution I 8-12mL/L, trace element solution II 0.8-1.2mL/L, all the other are water; Every liter of trace element solution I contains:
Fe (III)-NH 4-Citrate 4-6g/L, CaCl 22H 2O 1.8-2.2g/L, all the other are 0.4-0.6M HCl; Every liter of trace element solution II contains: ZnSO 47H 2O 80-120mg/L, MnCl 24H 2O 25-35mg/L, H 3BO 3280-320mg/L, CoCl 26H 2O 180-220mg/L, CuSO 45H 2O 8-12mg/L, NiCl 26H 2O 18-22mg/L, NaMoO 42H 2O 28-32mg/L, all the other are 0.4-0.6M HCl.
In actual culturing process, can in above-mentioned substratum, add certain density microbiotic again to keep the stability of plasmid, as 30-50 μ g/mL sulphuric acid kanamycin and 60-100 μ g/mL penbritin.
The leavening temperature of described pseudomonas engineering bacteria is 30-35 ℃.
The fermention medium of described huge Alcaligenes, the true bacteria of Luo Shi and Aeromonas hydrophila is to add longer chain fatty acid or Sunmorl N 60S in the mineral substratum (MM substratum) as carbon source.
Described mineral substratum comprises following four kinds of components:
Component I (20 *): Na 2HPO 412H 2O 180g/L, KH 2PO 430g/L;
Component I I:(NH 4) 2SO 40.5～2g/L, MgSO 47H 2O 0.4g/L;
Component III (100 *): Fe (III)-NH 4-Citrate 5g/L, CaCl 22H 2O 2g/L;
Component I V (1000 *): ZnSO 47H 2O 100mg/L, MnCl 24H 2O 30mg/L, H 3BO 3300mg/L, CoCl 26H 2O 200mg/L, CuSO 45H 2O 10mg/L, NiCl 26H 2O 20mg/L, NaMoO 42H 2O 30mg/L.
Wherein component III and component I V are trace element, with the hydrochloric acid soln preparation of 1mol/L.
During sterilization, be substrate with component I I, four kinds of separately sterilizations separately of component are used preceding by described mixed.Component I V is diluted to the mother liquor of 100 times of concentration and sterilizes before sterilization.
In above-mentioned mineral substratum, add 8-10g/L longer chain fatty acid such as capric acid, lauric acid etc. before the inoculation as carbon source.In actual culturing process, can in above-mentioned substratum, add the 1g/L yeast powder again and promote thalli growth; Also has certain density microbiotic to keep plasmid stability, as 30-50 μ g/mL sulphuric acid kanamycin and 60-100 μ g/mL penbritin.
The leavening temperature of the engineering bacteria of described huge Alcaligenes, the true bacteria of Luo Shi and Aeromonas hydrophila is 30-35 ℃.
Can efficiently express the PHA bacterial classification under the anoxic fermentation condition that method of the present invention obtains by structure, utilize this bacterial classification, synthetic PHA under anoxia condition.Method of the present invention need not bubbling air or oxygen in the synthetic PHA process of fermentation, and strict anaerobic condition also need not be provided, and promptly need not constantly feed nitrogen, utilizes the cheap carbon source fermentation, has comprehensively reduced the production cost of PHA.
Embodiment
Method among the following embodiment if no special instructions, is ordinary method.
Relate to the used enzyme of molecular biology operation among the following embodiment, all available from TaKaRa company, respective phases of operation is carried out according to relevant product description fully; Extract plasmid, reclaim the used test kit of dna fragmentation available from Shen energy betting office, corresponding operation is carried out according to its product description fully; The examining order that relates in the experiment is transferred to AudioCodes biotech firm and is carried out.
The bacteria culture medium that relates among the following embodiment is as follows, and as special indicating not, substratum is all prepared with deionized water; As special indicating not, the sterilising conditions of substratum is 115 ℃, 20 minutes:
The LB liquid nutrient medium: contain 5g/L yeast extract, 10g/L peptone, 10g/L NaCl, pH 7.0;
LB-Amp liquid nutrient medium: contain 5g/L yeast extract, 10g/L peptone, 10g/L NaCl and 100 μ g/mL penbritins;
LB-Amp solid medium: contain 15g/L agar, 5g/L yeast extract, 10g/L peptone, 10g/L NaCl and 100 μ g/mL penbritins;
The LB-Km liquid nutrient medium: every liter of substratum contains the 5g/L yeast extract, the 10g/L peptone, and 10g/L NaCl and 50 μ g/mL sulphuric acid kanamycins, all the other are water.
The LB-Km solid medium: every liter of substratum contains 15g/L agar, the 5g/L yeast extract, and the 10g/L peptone, 10g/L NaCl and 50 μ g/mL sulphuric acid kanamycins, all the other are water.
The LB-Km-Amp liquid nutrient medium: every liter of substratum contains the 5g/L yeast extract, the 10g/L peptone, and 10g/L NaCl, 50 μ g/mL sulphuric acid kanamycins and 100 μ g/mL penbritins, all the other are water.
The LB-Km-Amp solid medium: every liter of substratum contains 15g/L agar, the 5g/L yeast extract, and the 10g/L peptone, 10g/L NaCl, 50 μ g/mL sulphuric acid kanamycins and 100 μ g/mL penbritins, all the other are water.
LBG-Amp liquid nutrient medium: contain 5g/L yeast extract, 10g/L peptone, 10g/L NaCl, 20g/L glucose and 100 μ g/mL penbritins.
The MM substratum comprises following four kinds of components:
Component I (20 *): Na 2HPO 412H 2O 180g/L, KH 2PO 430g/L;
Component I I:(NH 4) 2SO 40.5～2g/L, MgSO 47H 2O 0.4g/L;
Component III (100 *): Fe (III)-NH 4-Citrate 5g/L, CaCl 22H 2O 2g/L;
Component I V (1000 *): ZnSO 47H 2O 100mg/L, MnCl 24H 2O 30mg/L, H 3BO 3300mg/L, CoCl 26H 2O 200mg/L, CuSO 45H 2O 10mg/L, NiCl 26H 2O20mg/L, NaMoO 42H 2O 30mg/L;
Wherein component III and component I V are trace element, with the hydrochloric acid soln preparation of 1mol/L.
During sterilization, be substrate with component I I, four kinds of separately sterilizations separately of component are used preceding according to the multiple diluted mixture.Component I V is diluted to the mother liquor of 100 times of concentration and sterilizes before sterilization.
The present invention utilizes the hypoxia inducible promotor to start polyhydroxyalkanoate (PHA) synthetic gene expression to generate polyhydroxyalkanoate (PHA); Described hypoxia inducible promotor comprises the ethanol dehydrogenase promotor (P of (alcohol dehydrogenase is called for short ADH) AdhE) (is 5 of NC_000913 ' end 1294197-1294669 position Nucleotide from GENBANK number), the promotor (P of pyruvic acid-formic acid lyase (pyruvate formate lyase is called for short PFL) PfIC) (is 5 of NC_000913 ' end 4143715-4144281 position Nucleotide from GENBANK number), the promotor of serum lactic dehydrogenase (D-lactate dehydrogenase) (is 5 of NC_000913 ' end 1439568-1439878 position Nucleotide from GENBANK number), the promotor of glycerol dehydrogenase (glycerol dehydrogenase is called for short GLD) (is 5 of NC_000913 ' end 4135492-4135955 position Nucleotide from GENBANK number), the promotor (P of aerobic repiration modulin (aerobic respiration control protein is called for short ARC) ArcA) (from being 5 of NC_000913 ' end 3348236-3348711 position Nucleotide for GENBANK number), and other can expression promoter under anoxia condition;
Described polyhydroxyalkanoate synthetic gene can be the gene of synthetic short chain PHA-poly butyric ester PHB, as derives from the PHB synthetic gene phaCAB (being 5 of AM260479 ' end 1557353-1561203 position Nucleotide from GENBANK number) of the synthetic short chain PHA of the true bacteria Ralstonia of Luo Shi eutropha or the PHB synthetic gene phaCAB (being 5 of U47026 ' end 533-4336 position Nucleotide from GENBANK number) of huge Alcaligenes Alcaligenes latus; Also can be the synthetic gene of synthetic middle long-chain PHA, as derive from middle long-chain PHA synthetic gene phaC1ZC2 (being 5 of AY278219 ' end 1-4746 position Nucleotide) and the phaC (holding 1-1683 position Nucleotide for 5 of NC_002947 ') of Rhodopseudomonas Pseudomonas from GENBANK number from GENBANK number, also can be short chain and middle long-chain pha copolymer synthetic gene, as derive from the PHA synthetic gene phaPCJ (being 5 of AY093685 ' end 292-2920 position Nucleotide) of Aeromonas Aeromonas from GENBANK number.
Embodiment 1, utilize alcohol dehydrogenase promoter (to be called for short P AdhE) and poly--3-butyric ester (PHB) synthetic genes involved (phaCAB) production PHA and compliance test result thereof
The method of following embodiment utilizes alcohol dehydrogenase promoter (to be called for short P AdhE) and poly--3-butyric ester (PHB) synthetic genes involved (phaCAB) make up the recombinant vectors pPadhE-CAB that hypoxia inducible is expressed poly--3-butyric ester for example, pPadhE-CAB is imported the deletion mutant E.coli ackA of wild intestinal bacteria E.coli K-12 and two strain acetate route of synthesis thereof by the mode of electricity conversion -With E.coli pta -Obtain three strain hypoxia inducibles and express the engineering bacteria of poly--3-butyric ester.Wherein phaCAB derives from plasmid pBHR68 (according to document (Spiekermann, P., et al., A sensitive, viable-colony staining method usingNile red for direct screening of bacteria that accumulate polyhydroxyalkanoicacids and other lipid storage compounds.Arch Microbiol, 1999.171 (2): p.73-80) described method makes up), alcohol dehydrogenase promoter (is called for short P AdhE) derive from wild intestinal bacteria Escherichia coli K-12 (ATCC numbering: 25404) genome, uses prokaryotic expression carrier pBluescriptII SK (-) (NCBI GenBank searching number is X52330) the conduct carrier that sets out.
One, scarce acquisition of inducing oxygen to express the engineering bacteria of poly--3-butyric ester
1, hypoxia inducible promotor P AdhEThe clone and the structure of expression vector plasmid pPadhE
1) extraction of bacillus coli gene group
Get 1.5mL intestinal bacteria Escherichia coli K-12 (ATCC numbering: 25404) 37 ℃ of overnight culture in centrifuge tube, the centrifugal 1min of 12000rpm, supernatant discarded is collected thalline.Add 400 μ L lysates (1Mm EDTA, 1%SDS, pH 7.8 for 40mM Tris-acetic acid, 20mM sodium-acetate) mixing, place 37 ℃ of water-baths 1 hour.The sodium chloride solution 200 μ L that add 5M then, behind the mixing in the centrifugal 15min of 13000rpm.Get supernatant liquor, with phenol extracting 2 times, chloroform extracting 1 time.Add the two volumes dehydrated alcohol, 1/10 volume Potassium ethanoate (3M, pH 5.8) is preserved after 1 hour for-20 ℃, and the centrifugal 15min of 13000rpm abandons supernatant liquor, and precipitation is washed 2 times with 70% ethanol; Obtain bacillus coli gene group DNA after placing drying at room temperature, be dissolved in the 50 μ L TE solution.
2) acquisition of the promotor of alcohol dehydrogenase gene
Under the polymerase chain reaction condition of standard, be template with the bacillus coli gene group of extracting in the step 1), with P1:AAAA CTCGAGGGTTAGCTCCGAAGCAAAAG ( XhoI) and P2:CAGC CATATGGCTCTCCTGATAATGTTAAAC ( NdeI) obtain the fragment of 473bp for the upstream and downstream primer amplification, show through order-checking, this fragment contains the promotor (have GENBANK number and be 5 of NC_000913 ' end 1294197-1294669 position nucleotide sequence) of alcohol dehydrogenase gene, after cutting processing with restriction enzyme XhoI/NdeI enzyme, reclaim the fragment that this 473bp contains the promotor of alcohol dehydrogenase gene.
3) contain the structure of the recombinant vectors (pPadhE) of the promotor of alcohol dehydrogenase gene
With restriction enzyme XhoI and NdeI plasmid pBluescript IISK (-) (NCBI GenBank searching number is X52330) is carried out double digestion, reclaim endonuclease bamhi, the promoter fragment of this fragment with the alcohol dehydrogenase gene of above-mentioned PCR acquisition is connected with the T4 dna ligase, after ligation is finished, the method that connects product electricity consumption conversion is imported to E.coli JM109 (ATCC numbering: 53323), transformant is coated on the LB-Amp solid culture flat board, under 37 ℃, 200rpm, cultivated 12h; The mono-clonal that picking grows on LB-Amp solid culture flat board, it is inoculated in the LB-Amp liquid nutrient medium, shaking table is cultivated 12h under 37 ℃, 200rpm, extract plasmid, and with restriction enzyme XhoI and NdeI plasmid is carried out enzyme and cut evaluation, positive plasmid can produce the dna fragmentation that size is about 2969bp and 473bp behind double digestion, the alcohol dehydrogenase promoter (P that the clone is obtained with pBluescript II SK (-) carrier multiple clone site upstream primer M13 primer AdhE) check order, confirm that its sequence is correct, will show the correct P that contains after testing AdhERecombinant vectors called after pPadhE.
2, hypoxia inducible is expressed the structure of the recombinant expression vector (pPadhE-CAB) of polyhydroxyalkanoate (PHA)
Under the condition of the polymerase chain reaction of standard, with plasmid pBHR68 (according to document (Spiekermann, P., et al., A sensitive, viable-colony staining method using Nile red for directscreening of bacteria that accumulate polyhydroxyalkanoic acids and otherlipid storage compounds.Arch Microbiol, 1999.171 (2): p.73-80) described method makes up) be template, use P3:AGC CATATGGCGACCGGCAAAGGC ( NdeI) and P4:CGC GGATTCGTCAGCCCATGTGCAGGC ( BamHI) go out the phaCAB gene for the upstream and downstream primer amplification, after the fragment that amplifies cut processing with NdeI and BamHI enzyme, recovery obtains the fragment (having from the GenBank searching number is 5 of NC_008313 ' end 1557353-1561203 position nucleotide sequence) of 3863bp, is the phaCAB gene fragment;
Use restriction enzyme NdeI and BamHI enzyme to cut and handle plasmid pPadhE, reclaim enzyme and cut the back fragment, with its with step 1) in the phaCAB gene fragment that obtains be connected with the T4 ligase enzyme; After ligation is finished, the method that connects product electricity consumption conversion is imported to E.coli JM109 (ATCC numbering: 53323), transformant is coated the LB-Amp solid medium, cultivate 12h;
The picking mono-clonal is to the LB-Amp liquid nutrient medium from the LB-Amp solid medium, and (37 ℃ of shaking tables 200rpm), extract plasmid, and whether cut the affirmation plasmid construction by XhoI and BamHI enzyme successful to cultivate 12h; Positive plasmid is after above-mentioned steps is handled, and it is two segment DNA segments that enzyme is cut product, and size is 4320bp and 2969bp, and detection is shown the correct alcohol dehydrogenase promoter (P that contains AdhE) and the plasmid called after pPadhE-CAB of PHA synthetic gene phaCAB.
3, hypoxia inducible is expressed recombinant bacterial strain (E.coli K-12 (pPadhE-CAB), the E.coli ackA of polyhydroxyalkanoate (PHA) -(pPadhE-CAB) or E.coli pta -(pPadhE-CAB)) acquisition
1) intestinal bacteria acetate route of synthesis deletion mutant E.coli ackA -With E.coli pta -Acquisition
I) electric transformed competence colibacillus preparation: inoculate E.coli K-12 fresh seeds liquid 1mL respectively to 100mL LB liquid nutrient medium is housed, 37 ℃ of following thermal agitations are cultivated and were reached at 0.4 o'clock to OD 600 values in 1.5-2 hour, from shaking table, take out and shake bottle, placed cooled on ice 15 minutes; Cell under 4 ℃, 5000rpm centrifugal 10 minutes is abandoned supernatant liquor; With the frozen water resuspension cell of sterilization, then according to top step repeated centrifugation, careful abandoning supernatant; With 10% glycerine resuspension cell 20mL sterilization, after the precooling, centrifugal according to top step then, careful abandoning supernatant with 10% glycerine resuspension cell of 1ml precooling, promptly obtains the electric transformed competence colibacillus of E.coli K-12; With competent cell liquid respectively by the 100 μ L equal portions Eppendorf tube of packing into, in-80 ℃ of preservations;
Ii) (GENBANK number is AY048746, and size is 6329bp with plasmid pKD46; According to document (Datsenko, K.A.and B.L.Wanner, One-step inactivation of chromosomal genes inEscherichia coli K-12 using PCR products.Proc Natl Acad Sci U S A, 2000.97 (12): p.6640-5) described method structure) change the E.coli K-12 that E.coli K-12 competence obtains containing pKD46 over to;
Iii) (GENBANK number is AY048744, and size is 3434bp with pKD13; According to document (Datsenko, K.A.and B.L.Wanner, One-step inactivation of chromosomal genes inEscherichia coli K-12 using PCR products.Proc Natl Acad Sci U S A, 2000.97 (12): p.6640-5) described method makes up) be template, with P1:
GTGTCCCGTATTATTATGCTGATCGTGTAGGCTGGAGCTGCTTC and P2:
TTACTGCTGCTGTGCAGACTGTTTCCGGGGATCCGTCGACC shows correct back recovery with the PCR product through order-checking for the upstream and downstream primer amplification obtains containing Km (kantlex) the resistant gene fragment that phosphoric acid changes acetate enzyme phosphotransacetylase gene (being called for short pta) homologous sequence (primer underscore part);
IV) mode that transforms by electricity imports to above-mentioned PCR product among the E.coli K-12 that contains plasmid pKD46, by the red recombinase effect that is present on the plasmid pKD46 pta gene is replaced with the Km resistant gene, thereby recon has had Km (kantlex) resistance and can screen on LB-Km-Amp solid medium flat board and obtain recon (be that the pta gene is replaced with the Km resistant gene in the E.coli K-12 genome, and contained pta gene substitution the bacterial strain of plasmid pKD46 of Km resistant gene); With the recon that obtains in nonresistant LB substratum 42 ℃ cultivate 24 hours after, recon is inoculated into respectively on LB-Km solid medium and the LB-Amp solid medium cultivates, screening has the Km resistance and the bacterial strain that do not have an Amp resistance (is that the pta gene is replaced with the Km resistant gene in the E.coli K-12 genome, and pta gene substitution the bacterial strain lost of the plasmid pKD46 of Km resistant gene), be pta genetically deficient mutant E.coli pta -
V) with pKD13 be template, with P3:
ATGTCGAGTAAGTTAGTACTGGTTCTGGTGTAGGCTGGAGCTGCTTC and P4:
TCAGGCAGTCAGGCGGCTCTTTCCGGGGATCCGTCGACC shows correct back recovery with the PCR product through order-checking for the upstream and downstream primer amplification obtains containing the Km resistant gene fragment of E.C. 2.7.2.1 acetate kinase gene (being called for short ackA) homologous sequence (primer underscore part);
Vi) mode that transforms by electricity imports to the PCR product among the E.coli K-12 that contains plasmid pKD46, by the red recombinase effect that is present on the plasmid pKD46 ackA gene is replaced with the Km resistant gene, thereby recon had the Km resistance can be at Amp (acillin), Km is two anti-dull and stereotyped to be gone up screening and obtains recon (be that the ackA gene is replaced with the Km resistant gene in the E.coli K-12 genome, and contained ackA gene substitution the bacterial strain of plasmid pKD46 of Km resistant gene); With the recon that obtains in nonresistant LB substratum 42 ℃ cultivate 24 hours after, recon is inoculated into respectively on LB-Km solid medium and the LB-Amp solid medium cultivates, screening has the Km resistance and the bacterial strain that do not have an Amp resistance (is that the ackA gene is replaced with the Km resistant gene in the E.coli K-12 genome, and ackA gene substitution the bacterial strain lost of the plasmid pKD46 of Km resistant gene), be ack genetically deficient mutant E.coli ackA -
2) from E.coli JM109 (pPadhE-CAB), extract fresh plasmid pPadhE-CAB, get E.coli K-12, E.coli ackA that the 1L plasmid adds the step 1) preparation respectively -With E.coli pta -Electric transformed competence colibacillus in, mixed on ice about 5 minutes; Transfer DNA/cell mixture is to cooled 1mm electroporation container (Bio-rad company); The electroporation container is carried out pulse (200 ohm, 25 μ Fd, 1.25 kilovolts), and the LB that adds 800 μ L immediately is to the electroporation container, and 37 ℃ of following culturing cell recoveries are coated with the LB-Amp solid medium after 45 minutes; The picking mono-clonal is to the LB-Amp liquid nutrient medium from the LB-Amp solid medium, and (37 ℃ of shaking tables 200rpm), extract plasmid and verify whether conversion is successful, and correct plasmid size is 7.308kb to cultivate 12h; Cut this plasmid of further affirmation by XhoI and BamHI enzyme, plasmid pPadhE-CAB is after above-mentioned steps is handled, it is two segment DNA fragments that enzyme is cut product, size is 4320bp and 2969bp, will confirm to contain the E.coli K-12 called after E.coli K-12 (pPadhE-CAB) of pPadhE-CAB plasmid after testing; The E.coli ackA of pPadhE-CAB plasmid will be confirmed to contain after testing -Called after E.coli ackA -(pPadhE-CAB); Or will confirm to contain the E.coli pta of pPadhE-CAB plasmid after testing -Called after E.coli pta -(pPadhE-CAB)).
Two, engineering bacteria E.coli K-12 (pPadhE-CAB) anaerobism is cultivated the shake flat experiment of producing PHA
E.coli K-12 (pPadhE-CAB) is cultivated 12h in the LB-Amp liquid nutrient medium (37 ℃ of shaking tables are 200rpm) as seed liquor; 1% inoculum size (promptly 5 * 10 by volume 9Cfu/L) seed liquor is inoculated in the LBG-Amp liquid nutrient medium, in shaking bottle, adds 20mL sterilization paraffin secluding air after the inoculation immediately, form anaerobic environment; Be divided into two groups, respectively static cultivation 48h in 30 ℃ or 37 ℃ of incubators.(Gaschromatography, GC) to the tunning qualitative detection, the result shows that the PHA component that adopts this method production to obtain is poly-beta-hydroxy-butanoic acid ester (PHB) with vapor-phase chromatography.
According to following method carry out PHA content in the thalline vapor-phase chromatography (Gas chromatography, GC) detect:
HP 6890 gas chromatographs of Agilent company are used in gas chromatographic analysis.Chromatographic column is the HP-5 capillary column, and long 30m, internal diameter 320 μ m, stationary phase are the thick phenyl methyl polysiloxane of 25nm.Detector be flame ionization detector (Flame ionization detector, FID).As carrier gas, hydrogen is as combustion gas with high pure nitrogen, and air is combustion-supporting gas.
The condition of gas chromatographic analysis is as follows:
Column temperature: 80 ℃ of beginnings stop 1.5min; The speed of 30 ℃/min is warmed up to 140 ℃, stops 0min; The speed of 40 ℃/min is warmed up to 220 ℃, stops 0.5min; Total time is 6min.
Post is pressed: 10psi begins, and stops 1.5min; 2.5psi/min speed boost to 20psi, stop 0.5min.(psi is a pressure unit, i.e. pound/square inch, 1psi=6.89476kPa)
Injection port: temperature is 200 ℃, shunt mode, and splitting ratio is 30～100.
Detector: temperature is 220 ℃, and hydrogen flowing quantity is 30mL/min, and air is 400mL/min.
The detection step is as follows:
1) with E.coli K-12 (pPadhE-CAB) the bacterium liquid of above-mentioned fermentation culture, centrifugal (8000rpm 10min) collects bacterium, then with recentrifuge behind the distilled water wash; With the cell frost drying, and the mensuration dry cell weight (Cell dryweight, CDW);
2) get 30-50mg left and right trunk cell in the esterification pipe, add 2mL esterifying liquid (vitriol oil of 3% volume is dissolved in the methyl alcohol, contains the 1g/L phenylformic acid as interior mark), 2mL chloroform, covered and enclosed, esterification 4h in 100 ℃ of baking ovens; After being cooled to room temperature, add 1mL distilled water, fully vibration, standing demix; After treating chloroform and water separating fully, get chloroform and carry out gas-chromatography (GC) analysis mutually;
3) difference of concentration per sample, sample size is 0.4～1 μ L, uses the microsyringe of Agilent company.Adopt marker method that PHA is carried out quantitative analysis, according to peak area quantification.PHA content is defined as the ratio of PHA pair cell dry weight, PHA output=PHA content * dry cell weight.
Content and the dry cell weight result of accumulation PHA are as shown in table 1 in the thalline, and the result shows that E.coli K-12 (pPadhE-CAB) can synthesize PHB under above-mentioned anoxia condition, and the content of PHB can reach 50% of dry cell weight when cultivating for 37 ℃.Residual biomass is the amount of dry cell weight deduction PHA in the table 1.
Table 1. bacterial strain E.coli K-12 (pPadhE-CAB) anoxic is cultivated accumulation PHA and is shaken a bottle result
Dry cell weight (g/L fermented liquid) PHA content (%) PHA output (g/L fermented liquid) Residual biomass (g/L fermented liquid)
30 ℃ of cultivations 1.29±0.05 45.94±1.51 0.59±0.07 0.69±0.04
37 ℃ of cultivations 0.70±0.07 50.23±1.55 0.35±0.03 0.35±0.05
Three, engineering bacteria E.coli ackA -(pPadhE-CAB) anoxic is cultivated and is produced the PHA shake flat experiment
With E.coli ackA -(pPadhE-CAB) (3 ℃ of shaking tables are 200rpm) as seed liquor to cultivate 12h in the LB-Amp liquid nutrient medium; 1% inoculum size (promptly 5 * 10 by volume 9Cfu/L) seed liquor is inoculated in the LBG-Amp liquid nutrient medium, in shaking bottle, adds 20mL sterilization paraffin secluding air after the inoculation immediately, form anaerobic environment; Be divided into two groups, respectively static cultivation 48h in 30 ℃ or 37 ℃ of incubators.To the tunning qualitative detection, the result shows that the PHA component that adopts this method production to obtain is poly-beta-hydroxy-butanoic acid ester (PHB) with vapor-phase chromatography.
Carry out PHA content in the thalline according to the detection of method described in the embodiment 2, content and the dry cell weight detected result of every liter of fermented liquid accumulation PHA are as shown in table 2.The result shows, E.coli ackA -(pPadhE-CAB) under above-mentioned anoxia condition, can synthesize PHB, and the content of PHB can be increased to 58% of dry cell weight when cultivating for 37 ℃.
Table 2 bacterial strain E.coli ackA -(pPadhE-CAB) anoxic is cultivated accumulation PHA and is shaken a bottle result
Dry cell weight (g/L fermented liquid) PHA content (%) PHA output (g/L fermented liquid) Residual biomass (g/L fermented liquid)
30 ℃ of cultivations 1.00±0.02 48.83±2.89 0.49±0.03 0.51±0.04
37 ℃ of cultivations 0.65±0.08 58.61±3.68 0.38±0.07 0.27±0.03
Four, engineering bacteria E.coli pta -(pPadhE-CAB) anoxic is cultivated the shake flat experiment of producing PHA
With E.coli pta -(pPadhE-CAB) (3 ℃ of shaking tables are 200rpm) as seed liquor to cultivate 12h in the LB-Amp liquid nutrient medium; 1% inoculum size (promptly 5 * 10 by volume 9Cfu/L) seed liquor is inoculated in the LBG-Amp liquid nutrient medium, in shaking bottle, adds 20mL sterilization paraffin secluding air after the inoculation immediately, form anaerobic environment; Be divided into two groups, respectively static cultivation 48h in 30 ℃ or 37 ℃ of incubators.To the tunning qualitative detection, the result shows that the PHA component that adopts this method production to obtain is PHB with vapor-phase chromatography.
Carry out PHA content in the thalline according to the detection of method described in the embodiment 2, content and the dry cell weight detected result of accumulation PHA are as shown in table 3 in the thalline.The result shows, E.coli pta -(pPadhE-CAB) under above-mentioned anoxia condition, can synthesize PHB, and the content of PHB can further improve to 65% of dry cell weight when cultivating for 37 ℃.
Table 3 bacterial strain E.coli pta -(pPadhE-CAB) anoxic is cultivated accumulation PHA shake flat experiment result
Dry cell weight (g/L fermented liquid) PHA content (%) PHA output (g/L fermented liquid) Residual biomass (g/L fermented liquid)
30 ℃ of cultivations 0.95±0.04 55.34±5.64 0.53±0.04 0.43±0.09
37 ℃ of cultivations 0.57±0.04 65.13±5.48 0.37±0.05 0.20±0.03
Embodiment 2, the promotor of utilizing pyruvic acid-formic acid lyase and phaCAB gene are connected on and produce PHA and compliance test result thereof under the anoxia condition
Utilize pyruvic acid-formic acid lyase promotor (to be called for short P PflC) and poly--3-butyric ester (PHB) synthetic genes involved (phaCAB) make up the recombinant vectors pPpflC-CAB that hypoxia inducible is expressed poly--3-butyric ester for example, pPpflC-CAB is imported the deletion mutant E.coli ackA of wild intestinal bacteria E.coli K-12 and two strain acetate route of synthesis thereof by the mode of electricity conversion -With E.coli pta -Obtain three strain hypoxia inducibles and express the engineering bacteria of poly--3-butyric ester (PHB).Wherein phaCAB derives from plasmid pBHR68 (according to document (Spiekermann, P., et al., A sensitive, viable-colony staining method using Nile red fordirect screening of bacteria that accumulate polyhydroxyalkanoic acids andother lipid storage compounds.Arch Microbiol, 1999.171 (2): p.73-80) described method makes up), pyruvic acid-formic acid lyase promotor (is called for short P PflC) derive from wild intestinal bacteria Escherichia coli K-12 (ATCC numbering: 25404) genome, use prokaryotic expression carrier carrier pBluescript II SK (-) (NCBI GenBank searching number is X52330) as carrier.
One, hypoxia inducible is expressed the acquisition of the recombinant bacterial strain of polyhydroxyalkanoate (PHA)
1, pyruvic acid-formic acid lyase promotor (is called for short P PflC) acquisition of dna fragmentation
(the ATCC numbering: 25404) genome is a template, under the condition of the polymerase chain reaction of standard, with P1:AAAA with intestinal bacteria Escherichia coli K-12 CTCGAGAAAAGTCCGCGCTCGCTTA ( XhoI) and P2:CAGC CATATGCCTGGATCTCCTTCGAC ( NdeI) obtain the fragment of 567bp for the upstream and downstream primer amplification, show through order-checking, this fragment contains the promotor (having from 5 of GENBANK NC_000913 ' end 4143715-4144281 position nucleotide sequence) of pyruvic acid-formic acid lyase gene, after cutting processing with restriction enzyme XhoI/NdeI enzyme, reclaim the fragment that this 567bp contains the promotor of pyruvic acid-formic acid lyase gene.
2, hypoxia inducible is expressed the structure of the recombinant expression vector (pPpflC-CAB) of polyhydroxyalkanoate (PHA)
Use restriction enzyme XhoI/NdeI enzyme to cut and handle plasmid pPadhE-CAB (step 2 preparation in embodiment 1 step 1), make the alcohol dehydrogenase promoter (P that wherein contains AdhE) cut away.With the fragment of the above-mentioned promotor that contains pyruvic acid-formic acid lyase gene that obtains with the XhoI/NdeI double digestion after, and remove alcohol dehydrogenase promoter (P AdhE) pPadhE-CAB connect, make the promotor (P of pyruvic acid-formic acid lyase gene PflC) with the promotor (P of pyruvic acid-formic acid lyase gene PflC) replace; Sequence verification shows checking the promotor (P that contains pyruvic acid-formic acid lyase gene PflC) the plasmid called after pPpflC-CAB of fragment and PHA synthetic gene phaCAB.
3, engineering strain E.coli K-12 (pPpflC-CAB), E.coli ackA -(pPpflC-CAB) and E.colipta -(pPpflC-CAB) acquisition
According to the described method of the step 3 in the step 1 of embodiment 1 plasmid pPpflC-CAB is imported E.coliK-12, E.coli ackA respectively -With E.coli pta -In, obtain engineering strain E.coli K-12 (pPpflC-CAB), E.coli ackA -(pPpflC-CAB) and E.coli pta -(pPpflC-CAB).
Two, engineering bacteria E.coli K-12 (pPpflC-CAB), E.coli ackA -(pPpflC-CAB) and E.colipta -(pPpflC-CAB) anoxic is cultivated the shake flat experiment of producing PHA
Above-mentioned three strain bacterium are carried out the gas chromatographic detection of experiment of anaerobism shake flask fermentation and product P HA according to the described method of step 2 in the step 1 of embodiment 1.The result shows, engineering bacteria E.coli K-12 (pPpflC-CAB), E.coliackA -(pPpflC-CAB) and E.coli pta -(pPpflC-CAB) the PHA component that adopts this method production to obtain is PHB.Wherein E.coli K-12 (pPpflC-CAB) can accumulate 44% PHB in thalline, at mutant engineering bacteria E.coli ackA -(pPpflC-CAB) and E.coli pta -(pPpflC-CAB) in, the content of PHB can be increased to 54% and 57% respectively in the thalline.
Embodiment 3, utilize the glycerol dehydrogenase promotor of (glycerol dehydrogenase is called for short GLD) (to be called for short P GldA) and the phaC2 gene be connected under the anoxia condition and produce PHA
Following method utilizes the glycerol dehydrogenase promotor (to be called for short P GldA) and low substrate specificity PHA synthetic gene (phaC2) (5 of GENBANK searching number AY278219 ' end 2873-4555 position nucleotide sequence) make up the recombinant vector pPgld-phaC2 that hypoxia inducible is expressed poly--3-hydroxybutyrate ester for example, the mode that transforms by electricity imports pPgld-phaC2 among wild Escherichia coli E.coli K-12 and the synthetic Auxotrophie mutant Ralstonia eutropha PHB-4 of the true bacteria Ralstonia of Luo Shi eutropha and obtains colibacillus engineering E.coii K-12 (pPgld-phaC2) or the true bacteria engineering bacteria of Luo Shi R.eutropha (pPgld-phaC2). Wherein low substrate specificity PHA synthetic gene (phaC2) is from Pseudomonas stutzeri 1317 (Chen JY, Liu T, ZhengZ, et al.Polyhydroxyalkanoate synthases PhaC1 and PhaC2 from Pseudomonasstutzeri 1317 had different substrate specificities, FEMS MICROBIOLOGYLETTERS 234 (2): 231-237 MAY 15 2004); Mutant R.eutropha PHB-4 is available from German microbial strains company (DSM 541).
One, hypoxia inducible is expressed the acquisition of the recombinant bacterial strain of polyhydroxyalkanoate (PHA)
1, hypoxia inducible is expressed the structure of the recombinant expression vector pPgld-phaC2 of polyhydroxyalkanoate (PHA)
1) the glycerol dehydrogenase promotor (is called for short P GldA) acquisition of dna fragmentation
(the ATCC numbering: 25404) genome is a template, under the condition of the polymerase chain reaction of standard, with P1:AAAA with intestinal bacteria Escherichia coli K-12 ATCGATAGGATAAGTAAGCTGCACA ( ClaI) and P2:CAGC AAGCTTACCTACTCCAAACTCCCG ( HindIII), show that this fragment contains the promotor (have from GENBANK number and be 5 of NC_000913 ' end 4135492-4135955 position nucleotide sequence) of glycerol dehydrogenase for the upstream and downstream primer amplification obtains the fragment of 464bp through order-checking.
(plasmid pCJY08 derives from wide model host carrier pBBR1MCS-2 (NCBI GenBank number be U23751) to be inserted into the plasmid pCJY08 that contains phaC2 with the fragment of the promotor that contains glycerol dehydrogenase of restriction enzyme ClaI and the above-mentioned acquisition of HindIII double digestion, according to document (Chen JY, Song G and Chen GQ.A LowerSpecificity PhaC2 Synthase from Psuedomonas stutzeri Catalyses theProduction of Copolyesters Consisting of Short-Chain-Length andMedium-Chain-Length 3-Hydroxyalkanoates.Antonie van Leewenhoek 89 (2006) 157-167) described method makes up) through between ClaI and the HindIII restriction enzyme site, and the order-checking detection, will show the recombinant plasmid called after pPgldA-phaC2 that contains glycerol dehydrogenase promotor and phaC2 gene through order-checking.
2, the acquisition of colibacillus engineering E.coli K-12 (pPgldA-phaC2) and the true bacteria engineering bacteria of Luo Shi R.eutropha (pPgldA-phaC2)
The mode that plasmid pPgld-phaC2 electricity consumption is transformed imports respectively among intestinal bacteria E.coli K-12 and the synthetic defective type mutant strain R.eutropha PHB-4 of the true bacteria of Luo Shi, will change the intestinal bacteria E.coli K-12 called after colibacillus engineering E.coli K-12 (pPgldA-phaC2) of pPgld-phaC2 over to and will change the true bacteria called after of the Luo Shi Luo Shi true bacteria engineering bacteria R.eutropha (pPgldA-phaC2) of pPgld-phaC2 over to.
Two, colibacillus engineering E.coli K-12 (pPgldA-phaC2) and the true bacteria engineering bacteria of Luo Shi R.eutropha (pPgldA-phaC2) produce the shake flask fermentation experiment of PHA
Respectively colibacillus engineering E.coli K-12 (pPgldA-phaC2) and the true bacteria engineering bacteria of Luo Shi R.eutropha (pPgldA-phaC2) are carried out the experiment of anaerobism shake flask fermentation, the shake flask fermentation experiment of colibacillus engineering E.coli K-12 (pPgldA-phaC2) is with the described method of step 2 in the step 1 of embodiment 1; The anaerobism shake flask fermentation of the true bacteria engineering bacteria of Luo Shi R.eutropha (pPgldA-phaC2) is according to 5 * 10 with the true bacteria engineering bacteria of Luo Shi R.eutropha (pPgldA-phaC2) 9The amount of cfu/L inserts and contains in the MM substratum of 20g/L Sunmorl N 60S and 8g/L Sodium octoate, leaves standstill at 30 ℃ and cultivates 48h.
After fermentation culture finishes, collect thalline respectively and carry out the gas chromatographic detection of product P HA.The result shows, the PHA component that colibacillus engineering E.coli K-12 (pPgldA-phaC2) and the true bacteria engineering bacteria of Luo Shi R.eutropha (pPgldA-phaC2) productions obtain is short chain copolymerization PHA or middle long-chain copolymerization PHA, wherein 4 carbon components account for 80%, all the other are 6 carbon, 8 carbon, 10 carbon and 12 carbon components, and content from 2% to 12% does not wait.The gross accumulation amount of PHA reaches 38.4% in colibacillus engineering E.coli K-12 (pPgldA-phaC2), and the gross accumulation amount of PHA reaches 42.5% in the true bacteria engineering bacteria of Luo Shi R.eutropha (pPgldA-phaC2).
Embodiment 4, serum lactic dehydrogenase promotor (are called for short P LdhA) be connected on production PHA and effect experiment thereof under the anoxia condition with the phaPCJ gene
Utilize the serum lactic dehydrogenase promotor (to be called for short P LdhA) and derive from the PHA synthetic gene phaPCJ (being 5 of AY093685 ' end 292-2920 position Nucleotide from GENBANK number) that Aeromonas hydrophila belongs to Aeromonas and make up the recombinant vectors pPldh-PCJ that hypoxia inducible is expressed poly--3-butyric ester, by mode pPldh-PCJ is imported in the Aeromonas hydrophila (Aeromonas hydrophila), and under anoxia condition, synthesize PHA in conjunction with conversion.
1, the structure of recombinant vectors pMCS-Pldh-PCJ
1) the serum lactic dehydrogenase promotor (is called for short P LdhA) acquisition of dna fragmentation
(the ATCC numbering: 25404) genome is a template, under the condition of the polymerase chain reaction of standard, with P1:CAGC with intestinal bacteria Escherichia coli K-12 AAGCTTCACATGCTGCCGGAAATC ( HindIII) and P2:AAAA GAATTCATCTTGCCGCTCCCCTGC ( EcoRI), show that this fragment contains the promotor (have from GENBANK number and be 5 of NC_000913 ' end 1439568-1439878 position nucleotide sequence) of glycerol dehydrogenase for the upstream and downstream primer amplification obtains the fragment of 311bp through order-checking.
2) acquisition of the recombinant expression vector of production PHA
Cut the fragment of the above-mentioned promotor that contains glycerol dehydrogenase that obtains of processing with restriction enzyme HindIII and EcoRI enzyme after, be inserted between the HindIII and EcoRI restriction enzyme site of carrier pBBR1MCS-2 (NCBI GenBank number is U23751), obtain recombinant vectors, sequence verification will show the recombinant vectors called after pMCS-ldh of the promotor that contains glycerol dehydrogenase through order-checking.
With plasmid pQd-APCJ (according to (Qiu YZ, Han J, Guo JJ, Chen GQ.Production of poly (3-hydroxybutyrate-co-3-hydroxyhexanoate) from gluconate and glucose byrecombinant Aeromonas hydrophila and Pseudomonas putida.Biotech Lett 27 (2005): 1381-1386) described method makes up) be template, under the condition of the polymerase chain reaction of standard, with P1:AGCT GAATTCATGAATATGGACGTGATCA ( EcoRI) and P2:AAAA GGATCCTTAAGGCAGCTTGACCAC ( BamHI) obtain the fragment of 2629bp for the upstream and downstream primer amplification, show through order-checking, the PHA synthetic gene phaPCJ (have from GENBANK number and be 5 of AY093685 ' end 292-2920 position nucleotide sequence) that this fragment contains Aeromonas hydrophila 4AK4 uses restriction enzyme BamHIWith EcoRIBe connected to 2 after double digestion is handled) in the middle interstitial granules pMCS-ldh that obtains BamHIWith EcoRIBetween the restriction enzyme site, sequence verification will contain the serum lactic dehydrogenase promotor and (be called for short P LdhA) and derive from the recombinant vectors called after pMCS-Pldh-PCJ of the PHA synthetic gene phaPCJ that has a liking for aqueous vapor Zymomonas mobilis Aeromonas hydrophila 4AK4.
2, acquisition and the shake flat experiment of engineering bacteria Aeromonas hydrophila (pMCS-Pldh-PCJ)
1) the vector plasmid pMCS-Pldh-PCJ that makes up is imported to E.coli S17-1 (ATCC numbering: 47055) with electrotransformation, and transformant coated on the LB-Km solid culture flat board, in 37 ℃ of incubators, cultivate 12h, obtain bacterial strain E.coli S17-1 (pMCS-Pldh-PCJ);
2) picking positive monoclonal E.coli S17-1 (pMCS-Pldh-PCJ), it is inoculated in the LB-Km liquid nutrient medium, at 37 ℃, shaking table is cultivated 12h under the 200rpm, simultaneously with Aeromonas hydrophila 4AK4 bacterial strain (Shaoping Ouyang, Jing Han, Yuanzheng Qiu, Lingfang Qin, Song Chen, QiongWu, Michael L.Leski, Guoqiang Chen.Poly (3-hydroxybutyrate-co-3-hydroxyhexanoate) Production in RecombinantAeromonas hydrophila 4AK4 Harboring phbA, phbB and vgb Genes.MacromolecularSymposia 224 (2005) 21-34) be inoculated in the LB liquid nutrient medium, at 30 ℃, shaking table is cultivated 12h under the 200rpm, the nutrient solution of respectively getting the above-mentioned two kinds of bacterial strains of 1mL then is to aseptic tubule, centrifugal 2 minutes of 8000rpm, abandoning supernatant, respectively add the aseptic LB liquid nutrient medium of 0.5mL again, behind the resuspended bacterium, the resuspended bacterium liquid of two pipes is mixed, placed 30 ℃ of incubators 1 hour, one ring mixed bacteria liquid is coated on the LB-Km-Amp solid culture flat board by method of scoring with the aseptic inoculation ring, in 30 ℃ of incubators, cultivated 24h;
3) mono-clonal that on LB-Km-Amp solid culture flat board, grows of picking, it is seeded in the LB-Km-Amp liquid nutrient medium, after shaking table is cultivated 12h under 30 ℃, 200rpm, extract plasmid, and with restriction enzyme BamH I plasmid is carried out enzyme and cut evaluation, positive plasmid can produce the dna segment that size is about 5144bp and 2940bp after enzyme is cut, have the reorganization of plasmid pMCS-Pldh-PCJ to have a liking for aqueous vapor Zymomonas mobilis called after Aeromonas hydrophila (pMCS-Pldh-PCJ) with correctly transforming.
4) to the experiment of engineering bacteria Aeromonas hydrophila (pMCS-Pldh-PCJ) row anaerobism shake flask fermentation, nutrient media components is that mineral substratum (MM substratum) adds the 8g/L lauric acid, and cultural method is 30 ℃ and leaves standstill cultivation 48 hours.After fermentation culture finishes, collect thalline and carry out the gas chromatographic detection of product P HA.The result shows that the PHA component that adopts this method production to obtain is 4 carbon or 6 carbon copolymerization PHA (being called for short PHBHHx), and wherein 4 carbon components account for 85.3%, 6 carbon component concentration and account for 14.7%.The accumulation volume of PHA reaches 35.5% in having a liking for aqueous vapor Zymomonas mobilis engineering bacteria Aeromonashydrophila (pMCS-Pldh-PCJ).
The promotor of embodiment 5, aerobic repiration modulin (is called for short P ArcA) be connected on production PHA anoxia condition under with the middle long-chain PHA synthetic gene phaC1ZC2 of pseudomonas
Utilize aerobic repiration modulin promotor (to be called for short P ArcA) and the PHA synthetic gene phaC1ZC2 (being 5 of NC_002947 ' end 1-1683 position nucleotides from GENBANK number) that derives from pseudomonad Pseudomonasputida KT2440 make up the recombinant vector pMCS-arcA-phaC that hypoxia inducible is expressed medium chain length PHA; Obtain the true bacteria engineering bacteria of Luo Shi R.eutropha (pMCS-arcA-phaC) by in conjunction with the mode that transforms pMCS-arcA-phaC being imported among the synthetic Auxotrophie mutant R.eutropha PHB-4 (available from German microorganism fungus kind company (DSM 541)) of the true bacteria R.eutropha of Luo Shi, and under anoxia condition, synthesize medium chain length PHA.
Concrete preparation method is as described below:
1, the structure of recombinant vectors pMCS-arcA-phaC
1) aerobic repiration modulin promotor (is called for short P ArcA) acquisition of dna fragmentation
(the ATCC numbering: 25404) genome is a template, under the condition of the polymerase chain reaction of standard, with P1:CAGC with intestinal bacteria Escherichia coli K-12 AAGCTTATCGGCCTGGGCCAGAGG ( HindIII) and P2:AAAA GAATTCCCCCGGCTAGACCGGGGT ( EcoRI), show that this fragment contains aerobic and breathes the modulin promotor and (be called for short P for the upstream and downstream primer amplification obtains the fragment of 475bp through order-checking ArcA) (have from GENBANK number and be 5 of NC_000913 ' end 3348236-3348711 position nucleotide sequence).
2) acquisition of the recombinant expression vector of production PHA
Handle the fragment that aerobic is breathed the modulin promotor that contains of above-mentioned acquisition with restriction enzyme HindIII and EcoRI double digestion, after the recovery, be inserted between the HindIII and EcoRI restriction enzyme site of pBBR1MCS-2 (NCBI GenBank number is U23751), sequence verification will show through order-checking to contain the recombinant vectors called after pMCS-acrA that aerobic is breathed the modulin promoter fragment.
(the ATCC numbering: genome 47054) is a template, with P1:AGCT with Pseudomonas putida KT2440 GAATTCATGACAGACAAACCGGCCA ( EcoRI) and P2:AAAA GGATCCTCATCGGGTCAGCACGTA ( BamHI) obtain the fragment of 1683bp for the upstream and downstream primer amplification, show through order-checking, this fragment contains the PHA synthetic gene phaC1ZC2 (being 5 of NC_002947 ' end 1-1683 position Nucleotide from GENBANK number) of pseudomonas Pseudomonas putida KT2440, with this fragment with restriction enzyme BamHI and EcoRI enzyme cut be connected to after the processing between the BamHI and EcoRI restriction enzyme site of interstitial granules pMCS-acrA, sequence verification shows that with order-checking containing aerobic breathes modulin promotor and the recombinant vectors called after pMCS-arcA-phaC that derives from the middle long-chain PHA synthetic gene of Rhodopseudomonas Pseudomonas.
2, the acquisition of the true bacteria engineering bacteria of engineering bacteria Luo Shi R.eutropha (pMCS-arcA-phaC) and shake flat experiment result
The mode that plasmid pMCS-arcA-phaC electricity consumption is transformed imports among the synthetic defective type mutant strain R.eutropha PHB-4 of the true bacteria of Luo Shi and obtains the true bacteria engineering bacteria of Luo Shi R.eutropha (pMCS-arcA-phaC).The true bacteria engineering bacteria of Luo Shi R.eutropha (pMCS-arcA-phaC) is linked into to contain in the lauric MM substratum of 8g/L to leave standstill at 30 ℃ cultivated 48 hours.After fermentation culture finishes, collect thalline and carry out the gas chromatographic detection of product P HA.The result shows, the PHA component that the true bacteria engineering bacteria of Luo Shi R.eutropha (pMCS-arcA-phaC) production obtains is middle long-chain PHA (being called for short mcl-PHA), wherein 6 carbon PHA components account for 13.7%, 8 carbon PHA components account for 45.3%, 10 carbon PHA components account for 23.6%, 12 carbon PHA component and account for 17.4%.The gross accumulation amount of PHA is 38.4% in the true bacteria engineering bacteria of Luo Shi R.eutropha (pMCS-arcA-phaC).
The promotor of embodiment 6, aerobic repiration modulin (is called for short P ArcA) be connected on production PHA anoxia condition under with the PHB synthetic gene phaCAB of huge Alcaligenes
The promotor of aerobic repiration modulin and PHB synthetic gene phaCAB (being 5 of U47026 ' end 533-4336 position Nucleotide from GENBANK number) from huge Alcaligenes Alcaligenes latus DSM1124 (available from German microbial strains company) are connected on extensive host's carrier pBBR1MCS-2 (NCBI GenBank number be U23751), constitute carrier pMCS-arcA-CAB.Carrier pMCS-arcA-CAB imported respectively among the synthetic defective type mutant strain R.eutropha PHB-4 of huge Alcaligenes A.latus and the true bacteria of Luo Shi obtain huge Alcaligenes engineering bacteria A.latus (pMCS-arcA-CAB) or the true bacteria engineering bacteria of Luo Shi R.eutropha (pMCS-arcA-CAB).
Concrete preparation method is as described below:
1, the structure of recombinant vectors pMCS-arcA-CAB
Genome with huge Alcaligenes Alcaligenes latus DSM 1124 (available from German microbial strains company) is a template, with P1:AGCT GAATTCGTGACCCTGCAAGCCATT ( EcoRI) and P2:AAAA GGATCCTCAGCCCATGTGCAGGCC ( BamHI) obtain the fragment of 3804bp for the upstream and downstream primer amplification, show through order-checking, this fragment contains the PHB synthetic gene (being 5 of U47026 ' end 533-4336 position Nucleotide from GENBANK number) of huge Alcaligenes Alcaligenes latus, with being connected between the middle interstitial granules pMCS-acrA BamHI and EcoRI restriction enzyme site that contain aerobic repiration modulin promotor that obtains among the embodiment 5 after restriction enzyme BamHI and the processing of EcoRI double digestion, sequence verification will show through order-checking to contain the recombinant vectors pMCS-arcA-CAB that aerobic is breathed the modulin promotor and derived from the PHB synthetic gene phaCAB of huge Alcaligenes Alcaligenes latus.
2, acquisition and the shake flat experiment result of the huge Alcaligenes Alcaligenes of engineering bacteria latus (pMCS-arcA-CAB) and the true bacteria engineering bacteria of Luo Shi R.eutropha (pMCS-arcA-CAB)
Carrier pMCS-arcA-CAB is imported respectively huge Bacillus alcaligenes A.latus DSM1124 (available from German microorganism fungus kind company) (can not synthesize PHA under the anoxic) to the mode that transforms by electricity and the true bacteria of Luo Shi synthesizes among the Auxotrophie mutant R.eutropha PHB-4 (available from German microorganism fungus kind company (DSM 541)); With changing the huge Bacillus alcaligenes A.latus called after huge Bacillus alcaligenes engineering bacteria A.latus (pMCS-arcA-CAB) of pMCS-arcA-CAB over to, with the true bacteria called after of the Luo Shi Luo Shi true bacteria engineering bacteria R.eutropha (pMCS-arcA-CAB) that changes pMCS-arcA-CAB over to. With huge Alcaligenes engineering bacteria A.latus (pMCS-arcA-CAB) or the true bacteria engineering bacteria of Luo Shi R.eutropha (pMCS-arcA-CAB) respectively according to 5 * 109The amount of cfu/L is inoculated in to contain in the lauric MM substratum of 8g/L and leaves standstill cultivation 48 hours at 30 ℃.After fermentation culture finishes, collect thalline and carry out the gas chromatographic detection of product P HA.The result shows that the PHA component that adopts this method to obtain is PHB in two strain engineering bacterias.The accumulation volume of PHB can reach 63.8% of dry cell weight in huge Alcaligenes A.latus (pMCS-arcA-CAB); The accumulation volume of PHB can reach 54.2% of dry cell weight in the true bacteria R.eutropha of Luo Shi (pMCS-arcA-CAB).

Claims (7)

1. the engineering bacteria of a hypoxia inducible expression polyhydroxyalkanoate is to be transferred to the reorganization bacterium that obtains behind the host bacterium with containing the hypoxia inducible promotor with the recombinant expression vector that is series at the polyhydroxyalkanoate synthetic gene in described hypoxia inducible promotor downstream; The nucleotides sequence of described hypoxia inducible promotor is classified as from GENBANK number and is 5 of NC_000913 ' end 1294197-1294669 position Nucleotide, from GENBANK number is 5 of NC_000913 ' end 4143715-4144281 position Nucleotide, from GENBANK number is 5 of NC_000913 ' end 1439568-1439878 position Nucleotide, from GENBANK number is that 5 of NC_000913 ' holds 4135492-4135955 position Nucleotide or is 5 of NC_000913 ' end 3348236-3348711 position Nucleotide from GENBANK number;
Described anoxic is anaerobic or little oxygen; Dissolved oxygen DO＜the 0.5mg/L of described little oxygen;
Described host bacterium is intestinal bacteria, huge Alcaligenes, the true bacteria of Luo Shi, pseudomonas or has a liking for water-based gas sporangium.
2. engineering bacteria according to claim 1 is characterized in that: the nucleotides sequence of described polyhydroxyalkanoate synthetic gene classify as from GENBANK number Nucleotide for 5 of AM260479 ' end 1557353-1561203 position, from GENBANK number for 5 of U47026 ' end 533-4336 position Nucleotide, from GENBANK number Nucleotide, GENBANK for 5 of AY278219 ' end 1-4746 position number for 5 of NC_002947 ' end 1-1683 position Nucleotide or from GENBANK number Nucleotide for 5 of AY093685 ' end 292-2920 position.
3. engineering bacteria according to claim 2 is characterized in that: when described host bacterium was intestinal bacteria, the true bacteria of Luo Shi, the carrier that sets out of described recombinant expression vector was pBluescript II SK (-) or pBBR1MCS-2; When described host bacterium is huge Alcaligenes, pseudomonas or when having a liking for water-based gas sporangium, the carrier that sets out of described recombinant expression vector is pBBR1MCS-2.
4. engineering bacteria according to claim 3 is characterized in that: described intestinal bacteria are e. coli k-12, E.coli ackA -Or E.coli pta -
5. a method of producing polyhydroxyalkanoate is with each described engineering bacteria of claim 1-4, and under anoxia condition, fermentation obtains polyhydroxyalkanoate;
Described anoxia condition is anaerobic or little oxygen; Dissolved oxygen DO＜the 0.5mg/L of described little oxygen.
6. method according to claim 5 is characterized in that: when the host bacterium of described engineering bacteria was intestinal bacteria, described leavening temperature was 28-38 ℃; When the host bacterium of described engineering bacteria is huge Alcaligenes, the true bacteria of Luo Shi, pseudomonas or when having a liking for water-based gas sporangium, described leavening temperature is 30-35 ℃.
7. method according to claim 6 is characterized in that: when the host bacterium of described engineering bacteria was intestinal bacteria, described leavening temperature was 37 ℃.
CN2007100985164A 2007-04-19 2007-04-19 Method of producing polyhydroxyalkanoates and special-purpose engineering bacterium for the same Expired - Fee Related CN101058799B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN2007100985164A CN101058799B (en) 2007-04-19 2007-04-19 Method of producing polyhydroxyalkanoates and special-purpose engineering bacterium for the same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN2007100985164A CN101058799B (en) 2007-04-19 2007-04-19 Method of producing polyhydroxyalkanoates and special-purpose engineering bacterium for the same

Publications (2)

Publication Number Publication Date
CN101058799A CN101058799A (en) 2007-10-24
CN101058799B true CN101058799B (en) 2010-06-09

Family

ID=38865106

Family Applications (1)

Application Number Title Priority Date Filing Date
CN2007100985164A Expired - Fee Related CN101058799B (en) 2007-04-19 2007-04-19 Method of producing polyhydroxyalkanoates and special-purpose engineering bacterium for the same

Country Status (1)

Country Link
CN (1) CN101058799B (en)

Families Citing this family (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101363034B (en) * 2008-08-08 2011-08-31 山东大学 Method for producing polyhydroxyalkanoate using engineering strain
MY169567A (en) * 2009-06-12 2019-04-22 Univ Sains Malaysia Gene encoding polymer synthase and a process for producing polymer
US10465214B2 (en) 2014-11-20 2019-11-05 Full Cycle Bioplastics Llc Producing resins from organic waste products
CN105543297B (en) * 2016-03-02 2019-04-09 中国科学院过程工程研究所 Hydrogenogen combines conversion of biomass and CO with alcaligenes eutrophus2The method for preparing polyhydroxyalkanoate
CN106047741B (en) * 2016-03-04 2019-09-27 李涛 It is a kind of to utilize the bacterial strain and synthetic method of chitin synthesis PHA and its application
TWI622648B (en) 2016-12-27 2018-05-01 國立清華大學 Butanol expression cassette, recombinant plasmid and butanol production related gene expression method
CN108587990B (en) * 2018-04-12 2020-10-09 中国科学院南海海洋研究所 Organophosphorus degradation active nano-particles and preparation method and application thereof
CN110004182B (en) * 2019-04-02 2021-03-05 清华大学 Preparation method and application of large-particle inclusion in microbial cell
CN113046287A (en) * 2021-03-23 2021-06-29 辽宁大学 Construction method and application of PHA synthase N-terminal deletion mutant
CN115976088B (en) * 2022-07-21 2023-09-19 深圳蓝晶生物科技有限公司 Low endotoxin content eutrophic rogowski bacteria and application thereof
CN115678816A (en) * 2022-12-16 2023-02-03 北京华熙荣熙生物技术研究有限公司 Nitrogen hydrogen single cell bacterium T1 for producing 3-hydroxybutyric acid and application thereof
CN117946225B (en) * 2024-01-05 2024-10-18 上海蓝晶微生物科技有限公司 Recombinant engineering bacterium for improving yield of polyhydroxyalkanoate and application thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1560256A (en) * 2004-03-03 2005-01-05 清华大学 Expression carrier of low oxygen inducing microorganusm and constructure process and application thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1560256A (en) * 2004-03-03 2005-01-05 清华大学 Expression carrier of low oxygen inducing microorganusm and constructure process and application thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
MICHAEL R. LEONARDO等.Anaerobic Regulation of the adhE Gene, EncodingtheFermentativeAlcohol Dehydrogenase of Escherichia coli.JOURNAL OF BACTERIOLOGY175 3.1993,175(3),第870-878页. *
MICHAELR.LEONARDO等.AnaerobicRegulationoftheadhEGene EncodingtheFermentativeAlcohol Dehydrogenase of Escherichia coli.JOURNAL OF BACTERIOLOGY175 3.1993
Sabine Becker等.Regulatory O2 tensions for the synthesis offermentationproductsin Escherichia coli and relation toaerobic respiration.Arch Microbiol168.1997,168第290-296页. *

Also Published As

Publication number Publication date
CN101058799A (en) 2007-10-24

Similar Documents

Publication Publication Date Title
CN101058799B (en) Method of producing polyhydroxyalkanoates and special-purpose engineering bacterium for the same
KR100971790B1 (en) Method for preparing butanol through butyryl-coa as an intermediate using bacteria
CN101184843B (en) Cell or plant having polylactic acid ester or copolymer thereof producing ability and method for producing polylactic acid ester or copolymer thereof
JP5670728B2 (en) Improved polyhydroxyalkanoate-producing microorganism and method for producing polyhydroxyalkanoate using the same
US20190153486A1 (en) Transformant that produces copolymerized pha containing 3hh unit, and method for producing said pha
CN104508136A (en) Recombinant microorganisms and uses therefor
CN104640977A (en) Recombinant microorganisms make biodiesel
CN102212501B (en) Recombinant escherichia coli and method for applying same to produce poly(3-hydroxybutyrate-3-hydroxyvalerate) (PHBV) by utilizing single carbon source
JP6755515B2 (en) Method for producing copolymerized polyhydroxyalkanoic acid from sugar raw material
JP2009507483A (en) Deregulated bacteria exhibiting improved polyhydroxyalkanoate production
CN102816729A (en) Construction and application of polygene knockout strain of Halomonas sp. TD01
US20230303966A1 (en) Recombinant bacterium with a high pha yield and the construction method thereof
CN116970659B (en) Method for producing polyhydroxyalkanoate
CN101631869B (en) Method for preparing butanol through butyryl-CoA as an intermediate using bacteria
KR102311152B1 (en) Production of poly(3HB-co-3HP) from methane by metabolic engineered methanotrophs
CN104762242A (en) Producing strain of mevalonic acid, and method used for producing mevalonic acid
EP4279587A1 (en) Engineered microorganism expressing acetoacetyl coenzyme a reductase variant and method for increasing proportion of 3-hydroxyhexanoic acid in pha
JPWO2008090873A1 (en) Process for producing polyhydroxyalkanoate
CN117402904A (en) Engineering bacterium for synthesizing PHA by using carbon dioxide and construction method and application thereof
JPWO2004074476A1 (en) New vector
CN102382789B (en) Engineering bacterium containing 2-oxoglutarate decarboxylase gene kgd and applications thereof
CN102268424A (en) Beta-ketothiolase related to 3-HV monomer synthesis of PHBV, coding gene thereof, and application thereof
CN117143793B (en) Method for producing 5-carbon compound or polymer thereof
JP2005333933A (en) New expression plasmid
WO2021077543A1 (en) Linoleate isomerase and use thereof in production of conjugate linoleic acid

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20100609

Termination date: 20180419

CF01 Termination of patent right due to non-payment of annual fee