KR102311152B1 - Production of poly(3HB-co-3HP) from methane by metabolic engineered methanotrophs - Google Patents

Abstract

The present invention relates to a transformed methanogen having the ability to produce 3-hydroxybutyrate-3-hydroxypropionate copolymer (poly(3HB-co-3HP)) from methane and 3-hydroxybutyrate-3 using the same -To a method for producing a hydroxypropionate copolymer, the transformed methanogen can produce 3-hydroxybutyrate-3-hydroxypropionate copolymer from a C1 carbon source, environmentally friendly and economical As such, it can be usefully used for mass production of 3-hydroxybutyrate-3-hydroxypropionate copolymer.

Description

Transformed methanogenic bacteria having the ability to produce 3-hydroxybutyrate-3-hydroxypropionate copolymer (poly(3HB-co-3HP)) from methane and 3-hydroxybutyrate-3-hydroxypropionate using the same Method for producing cypionate copolymer {Production of poly(3HB-co-3HP) from methane by metabolic engineered methanotrophs}

The present invention relates to a transformed methanogen having the ability to produce 3-hydroxybutyrate-3-hydroxypropionate copolymer (poly(3HB-co-3HP)) from methane and 3-hydroxybutyrate-3 using the same -To a method for producing a hydroxypropionate copolymer.

Recently, microplastics that have absorbed harmful chemicals dissolved in the ocean not only contaminate the marine environment but also enter the tissues of marine organisms, which can harm human health due to bioaccumulation, and is emerging as a social problem (Xanthos et al. al, 2017; Gallo et al., 2018) There are about 5 trillion pieces of plastic in the world's oceans and they weigh about 250,000 tonnes (Environmental Audit Committee, 2016). Voluntary plastic reduction campaigns are being conducted due to a change in awareness of the harmfulness of petroleum-based plastic products that are currently widely used. It is not easy to completely reduce the use of plastic because of the convenience of the material. Accordingly, there is a demand for the development and distribution of biodegradable plastics that are easily decomposed in nature while maintaining the convenience of plastics.

Narancic et al. (2018) recently measured the time it takes for various types of polymer-based plastics to decompose in environments such as homes, industrial treatment facilities, soil, and seawater, and found that even biodegradable plastics have significant differences in the degree of decomposition depending on the type. reported In the case of 'Poly lactic acid (PLA)', a polymer widely used in our daily life, it was decomposed at high temperature industrial treatment facilities, but was not easily decomposed at room temperature. has been These results suggest what kind of polymer-derived biodegradable plastics should be developed and used.

chel, 2010). 3-하이드록시부티레이트-3-하이드록시프로피오네이트 공중합체는 E.coli, Ralstonia, Pseudomonas와 같은 미생물에 의해 합성 가능하며 포도당, 오탄당, 및 글리세롤과 같은 탄소원으로부터 생산되어 왔다 (Meng et al., 2015; Sato et al., 2015). 그러나, 폴리머 생산 공정에서 기질의 높은 가격으로 인하여 경제성을 확보하기 어려워, 풍부하고 저렴한 탄소원이 필요하다. In nature, 3-hydroxybutyrate copolymer (poly(3-hydroxybutyrate, 3HB)), a homopolymer of 3-hydroxybutyrate, is the most abundant polymer. However, it is highly crystalline, hard, and brittle, so there is a limit to its practical use, and many studies are being conducted to improve these shortcomings. poly(3-hydroxybutyrate-co-3-hydroxyvalerate, 3HB-co-3HV), poly(3-hydroxybutyrate-co-3-hydroxyhexanoate, 3HB-co-3HH), and poly(3-hydroxybutyrate-co-3-hydroxypropionate) , 3HB-co-3HP) is much more flexible and less crystalline than 3HB (Andreeßen et al., 2014b; Chen et al., 2000; Doi et al., 1995; Shimamura et al., 1993; Sato et al. , 2015) among these co-polymers, 3-hydroxybutyrate-3-hydroxypropionate copolymer (p(3HB-co-3HP)) is very promising as a material for biodegradable plastics due to the advantages of material properties. (Stainb

chel, 2010). 3-hydroxybutyrate-3-hydroxypropionate copolymer can be synthesized by microorganisms such as E. coli, Ralstonia, and Pseudomonas and has been produced from carbon sources such as glucose, pentose, and glycerol (Meng et al., 2015; Sato et al., 2015). However, it is difficult to secure economic feasibility due to the high price of the substrate in the polymer production process, and thus an abundant and inexpensive carbon source is required.

The main components of greenhouse gases that cause global warming are carbon dioxide and methane. Quantitatively, carbon dioxide dominates, but methane is known to have an 84-fold stronger effect. The development of a biodegradable polymer production process using these two greenhouse gases as a carbon source can be evaluated as a technology that can not only reduce greenhouse gases but also secure eco-friendly, sustainable and economical efficiency.

8. Sato, S., Andreeßen, B., & Steinbchel, A. (2015). Strain and process development for poly (3HB-co-3HP) fermentation by engineered Shimwellia blattae from glycerol. AMB Express, 5(1), 18. 9. Meng, D. C., Wang, Y., Wu, L. P., Shen, R., Chen, J. C., Wu, Q., & Chen, G. Q. (2015). Production of poly (3-hydroxypropionate) and poly (3-hydroxybutyrate-co-3-hydroxypropionate) from glucose by engineering Escherichia coli. Metabolic engineering, 29, 189-195. 1. Xanthos, D., & Walker, TR (2017). International policies to reduce plastic marine pollution from single-use plastics (plastic bags and microbeads): a review. Marine pollution bulletin, 118(1-2), 17-26. 2. Gallo, F., Fossi, C., Weber, R., Santillo, D., Sousa, J., Ingram, I., ... & Romano, D. (2018). Marine litter plastics and microplastics and their toxic chemicals components: the need for urgent preventive measures. Environmental Sciences Europe, 30, 1-14. 3. Environmental Audit Committee. (2016) Environmental Impact of Microplastics. Fourth Report of Session, 2016-2017. House of Commons Environmental Audit Committee. 4. Anderson AJ, Haywood GW, Dawes EA. (1990) Biosynthesis and composition of bacterial poly(hydroxyalkanoates). Int J Biol Macromol 12:102-105. 5. Chen GQ, Wu Q, Zhao K, Yu PH (2000) Functional polyhydroxyalkanoates synthesized by microorganisms. Chinese J Polym Sci 18-5:389-396. 6. Doi Y, Kitamura S, Abe H. (1995) Microbial synthesis and characterization of poly (rhydroxybutyrate-co-hydroxyhexanoate). Macromolecules 8:4822-4828. 7. Shimamura E, Kasuya K, Kobayashi G, Shiotani T, Shima Y, Doi Y. (1993) Physical properties and biodegradability of microbial poly(3-hydroxybutyrate-cohydroxyhexanoate). Macromolecules 27:878-880

8. Sato, S., Andreeßen, B., & Steinbchel, A. (2015). Strain and process development for poly (3HB-co-3HP) fermentation by engineered Shimwellia blattae from glycerol. AMB Express, 5(1), 18. 9. Meng, DC, Wang, Y., Wu, LP, Shen, R., Chen, JC, Wu, Q., & Chen, GQ (2015). Production of poly (3-hydroxypropionate) and poly (3-hydroxybutyrate-co-3-hydroxypropionate) from glucose by engineering Escherichia coli. Metabolic engineering, 29, 189-195.

One object of the present invention is malonyl-CoA reductase (malonyl-CoA reductase); acetyl-CoA carboxylase and/or Methylmalonyl-CoA carboxyltransferase; ATP-dependent acyl-CoA synthetase and/or 3-hydroxypropionyl-CoA synthetase; 3-hydroxybutyrate- with enhanced activity of PHA synthetase (phaC), β-ketothiolase (β-ketothiolase, phaA) and NADPH dependent acetoacetyl-CoA reductase (phaB) To provide a transformed methanogen having the ability to produce 3-hydroxypropionate copolymer.

Another object of the present invention is to provide a method for producing a 3-hydroxybutyrate-3-hydroxypropionate copolymer from a methane substrate using the transformed methanogenic bacteria.

Another object of the present invention is to provide a composition for producing a 3-hydroxybutyrate-3-hydroxypropionate copolymer comprising the transformed methanogen.

This will be described in detail as follows.

Meanwhile, each description and embodiment disclosed in the present invention may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed herein fall within the scope of the present invention. In addition, it cannot be considered that the scope of the present invention is limited by the specific descriptions described below.

One aspect of the present invention for achieving the above object is malonyl-CoA reductase (malonyl-CoA reductase); acetyl-CoA carboxylase and/or Methylmalonyl-CoA carboxyltransferase; ATP-dependent acyl-CoA synthetase and/or 3-hydroxypropionyl-CoA synthetase; 3-hydroxybutyrate-3 with enhanced activity of PHA synthetase (phaC), β-ketothiolase (β-ketothiolase, phaA) and NADPH dependent acetoacetyl-CoA reductase (phaB) -Provides a transformed methanogen for producing a hydroxypropionate copolymer.

In addition, the inventors have made intensive research efforts on a method using biomass such as methane as a more environmentally friendly and economical method for producing 3-hydroxybutyrate-3-hydroxypropionate copolymer. As a result, surprisingly, the present invention It was confirmed that the production of 3-hydroxybutyrate-3-hydroxypropionate copolymer is possible when using a transformed methanogen of . The production of 3-hydroxybutyrate-3-hydroxypropionate copolymer through methanogenic bacteria using methane as the sole carbon source is not known at all, and it is very significant in that it was first developed through the present invention. can do.

In the present invention, the term "3-hydroxybutyrate-3-hydroxypropionate copolymer (Poly(3-hydroxybytyrate-co-3-hydroxypropionate)" is a kind of polyhydroxyalkanoate (PHA), A copolymer in which 3-hydroxybutyrate and poly3-hydroxypropionate are bonded, and can be represented by the following formula 1. The substance is a metabolite of the transformed methanogen of the present invention, starting from acetyl CoA As a substance, it is finally produced through acetoacetyl-CoA, 3-hydroxybutyryl CoA or malonyl CoA, malonic semialdehyde, 3-hydroxypropionic acid, and 3-hydroxypropionyl-CoA. Although not limited thereto, in one embodiment of the present invention, M. trichosporium A metabolic pathway for synthesizing the substance was introduced into OB3b, and the strain was produced by culturing methane as a carbon source.

In the present invention, the term “metahnotroph” refers to bacteria using methane as a major carbon source or energy source. The methanogenic bacteria may mean a host strain to be transformed in the present invention, and for the purpose of the present invention, acetoacetyl-CoA, 3-hydroxybutyryl CoA, or malonyl using methane as a carbon source and acetyl-CoA as a starting material CoA, malonic semialdehyde, 3-hydroxypropionic acid, 3-hydroxypropionyl-CoA, as long as it can finally produce 3-hydroxybutyrate-3-hydroxypropionate copolymer is not particularly limited thereto. In addition, it is apparent to those skilled in the art that a strain capable of using methane together among methylotrophs using C1 compounds such as methane, methanol, and methylamine as an energy source may also be included in the methanating bacteria of the present invention.

The methanogenic bacteria is not particularly limited thereto, as long as it can use a C1 compound such as methane as an energy source, but Methylomonas, Methylobacter, Methylococcus, methylose Methylosphaera, Methylocaldum, Methyloglobus, Methylosarcina, Methyloprofundus, Methylothermus ), genus Methylohalobius, genus Methylogaea, genus Methylomarinum, genus Methylovulum, genus Methylomarinovum, genus Methyloloverum Methylorubrum, Methyloparacoccus, Methylocystis, Methylocella, Methylocapsa, Methylofurula, Methylacid It may be a phyllum genus (Methylacidiphilum), a methylacidimicrobium genus (Methylacidimicrobium), a methylomicrobium genus or a methylosinus genus (Methylosinus) strain, specifically, Methylosinus trichosporium) It may be OB3b.

In the case of the bioconversion process using such methane magnetizing bacteria, relatively inexpensive methane can be used as a carbon source, which is economically advantageous, and in that methane in the atmosphere can be used, there are environmental advantages such as prevention of greenhouse gas emission. In addition, there is no loss of oxygen compared to the conventional process using glucose, so the yield of the final product is also high.

In the present invention, the term "transformed methanogenic bacteria" refers to a strain transformed by introducing or removing the gene of the methanogenic bacteria.

Specifically, the transformed methanogen of the present invention is malonyl-CoA reductase (malonyl-CoA reductase); acetyl-CoA carboxylase and/or Methylmalonyl-CoA carboxyltransferase; ATP-dependent acyl-CoA synthetase and/or 3-hydroxypropionyl-CoA synthetase; PHA synthesis gene (phaC), β-ketothiolase (β-ketothiolase, phaA) and NADPH-dependent acetoacetyl-CoA reductase (NADPH-dependent acetoacetyl-CoA reductase, phaB) activity may be enhanced, but is not limited thereto does not In the present name, the transformed methanogenic bacteria produced 3-hydroxybutyrate-3-hydroxypropionate copolymer compared to the wild type without the ability to produce 3-hydroxybutyrate-3-hydroxypropionate copolymer. performance may be significantly improved.

As used herein, the term "malonyl-CoA reductase (MCR)" refers to an enzyme that catalyzes a reaction that converts malonyl-CoA to malonic semialdehyde and further produces 3-hydroxypionic acid therefrom. means

The gene (mcr) encoding the malonyl-CoA reductase may be derived from Chloroflexus aurantiacus, and specifically may be composed of the nucleotide sequence of SEQ ID NO: 1. More specifically, the sequence of SEQ ID NO: 1 and more specifically, 70% or more, specifically 80% or more, more specifically 90% or more, even more specifically 95% or more, the sequence of SEQ ID NO: 1 and more, Most specifically, if it is possible to express a protein having substantially malonyl-CoA reductase activity as a nucleotide sequence showing 99% or more homology, it may be included without limitation.

As used herein, the term “acetyl-CoA carboxylase (ACC)” refers to an enzyme that catalyzes a reaction for producing malonyl-CoA from acetyl-CoA synthesized from methane.

The gene (acc) encoding the acetyl-CoA carboxylase may be derived from Methylosinus trichosporium OB3b, and specifically may be composed of the nucleotide sequence of SEQ ID NO: 2. More specifically, 70% or more, specifically 80% or more, more specifically 90% or more, even more specifically 95% or more, most specifically 99% or more homology with the sequence of SEQ ID NO: 3 If a protein having substantially acetyl-CoA carboxylase activity can be expressed as a base sequence, it may be included without limitation.

As used herein, the term "methylmalonyl-CoA carboxyltransferase (MMC)" refers to an enzyme catalyzing the conversion of acetyl-CoA and oxaloacetate to malonyl-CoA and pyruvic acid.

The gene (mmc) encoding the methylmalonyl-CoA carboxyltransferase (Methylmalonyl-CoA carboxyltransferase) may be derived from Propionibacterium freudenreichii, specifically, with the nucleotide sequence of SEQ ID NO: 3 may be configured. More specifically, 70% or more, specifically 80% or more, more specifically 90% or more, even more specifically 95% or more, most specifically 99% or more homology with the sequence of SEQ ID NO: 3 If a protein having substantially methylmalonyl-CoA carboxyl transferase activity can be expressed as a base sequence, it may be included without limitation.

As used herein, the term "ATP-dependent acyl-CoA synthetase" refers to an enzyme that catalyzes the conversion of 3-hydroxypropionate to 3-hydroxypropionyl CoA.

Gene (acs) coding for the ATP-dependent acyl CoA synthetase may be a claw rope rack Versus Au is thiazol kusu (Chloroflexus aurantiacus) origin and may be specifically configured to the nucleotide sequence of SEQ ID NO: 4. More specifically, 70% or more, specifically 80% or more, more specifically 90% or more, even more specifically 95% or more, most specifically 99% or more homology with the sequence of SEQ ID NO: 4 If a protein having an ATP-dependent acyl-CoA synthetase activity is substantially expressed as a base sequence, it may be included without limitation.

As used herein, the term "3-hydroxypropionyl-CoA synthetase" refers to an enzyme that catalyzes the conversion of 3-hydroxypropionate to 3-hydroxypropionyl CoA. .

The gene encoding the 3-hydroxypropionyl CoA synthetase (3HPCS) is Metallosphaera sedula ) , and specifically may be composed of the nucleotide sequence of SEQ ID NO: 5. More specifically, 70% or more, specifically 80% or more, more specifically 90% or more, even more specifically 95% or more, most specifically 99% or more homology with the sequence of SEQ ID NO: 5 If a protein having a substantially 3-hydroxypropionyl CoA synthetase activity can be expressed as a base sequence, it may be included without limitation.

That is, the transformed methanogen of the present invention is a malonyl-CoA reductase (MCR) gene derived from Chloroflexus aurantiacus; Methylosinus trichosporium OB3b-derived acetyl-CoA carboxylase (ACC) gene; Methylmalonyl-CoA carboxyltransferase (MMC) gene derived from Propionibacterium freudenreichii; ATP-dependent acyl-CoA synthetase (ACS) gene derived from Chloroflexus aurantiacus; 3-hydroxypropionyl-CoA synthetase (3HPCS) gene from Metallosphaera sedula; and Restonia eutropha. eutropha )-derived PHA synthesis gene (phaC), β-ketothiolase (β-ketothiolase, phaA) and NADPH-dependent acetoacetyl-CoA reductase (NADPH-dependent acetoacetyl-CoA reductase, phaB) are introduced or overexpressed,

Although not limited thereto, the Chloroflexus aurantiacus-derived malonyl-CoA reductase (MCR) gene is the nucleotide sequence of SEQ ID NO: 1, Tylocinus tricosporium ( Methylosinus trichosporium) OB3b-derived acetyl-CoA carboxylase (acetyl-CoA carboxylase, ACC) gene is SEQ ID NO: 2; Methylmalonyl-CoA carboxyltransferase (MMC) gene derived from Propionibacterium freudenreichii is SEQ ID NO: 3; The ATP-dependent acyl-CoA synthetase (ACS) gene derived from Chloroflexus aurantiacus is SEQ ID NO: 4; 3-hydroxypropionyl-CoA synthetase (3HPCS) gene derived from Metallosphaera sedula is SEQ ID NO: 5; PHA synthetase (phaC), β-ketothiolase (phaA) and NADPH dependent acetoacetyl-CoA reductase (NADPH dependent acetoacetyl-CoA reductase, phaB) derived from Rastonia eutropha The gene encoding the phaCAB gene is characterized in that it consists of the nucleotide sequence of SEQ ID NO: 6.

In one embodiment of the present invention, Chloroflexus ATP-dependent acyl-CoA synthetase gene (acs) from aurantiacus or Metallosphaera sedula derived 3-Hydroxypropionyl CoA synthetase gene (3HPCS) overexpressed with MCR and ACC, type II methanogen Methylosinus As a result of further overexpression in trichosporium OB3b, the production of each 3-hydroxybutyrate-3-hydroxypropionate copolymer was 24.59 wt % and 24.86 wt % relative to the cell weight, wherein the 3-hydroxypropionate of the copolymer was 24.59 wt % and 24.86 wt %. The content of nate was 4.15 mol% and 8.09 mol%, and Rastonia was used to enhance the intracellular copolymer content. In the transgenic strain overexpressing the eutropha- derived phaCAB gene, it was confirmed that the copolymer content was increased, but the 3-hydroxypropionate molar ratio was relatively decreased.

Each of the above-described enzymes or proteins is an amino acid in which one or more amino acids at one or more positions of the amino acid sequence constituting each enzyme or protein are substituted, deleted, inserted, added or inverted as long as they exhibit the respective activity used in the present invention. It may include a sequence, as long as it shows the activity of each enzyme or protein, with respect to the amino acid sequence of each enzyme or protein, 80% or more, specifically 90% or more, more specifically 95% or more, more specifically It is apparent to those skilled in the art that amino acid sequences having substantially the same or corresponding activity as each enzyme or protein are included in the scope of the present invention as having a homology of 99% or more.

In the present invention, the term "weakened or inactivated" means that the activity of an enzyme or protein is reduced or not expressed at all compared to the wild-type or its intrinsic activity, or that the activity is absent or reduced even if it is expressed. Attenuation or inactivation of the enzyme or protein may be performed by any method known in the art. Specifically, deletion of a part or all of the polynucleotide encoding the enzyme, modification of the expression control sequence to decrease the expression of the nucleotide, modification of the nucleotide sequence on the chromosome to weaken the activity of the protein, or a combination thereof It may be carried out in the selected method, but is not particularly limited thereto.

The method of deleting part or all of the polynucleotide encoding the protein is performed by replacing a polynucleotide encoding an endogenous target protein in a chromosome with a polynucleotide or a marker gene in which a part of the nucleic acid sequence is deleted through a vector for chromosome insertion in bacteria. can be In the present invention, the term "enhancement" means that the activity of an enzyme or protein is increased compared to the wild type or its intrinsic activity. Enhancing the activity of the enzyme or protein may be performed by any method known in the art.

Another aspect of the present invention for achieving the above object is 3-hydroxybutyrate comprising the step of culturing a transformed methanogen for the production of the 3-hydroxybutyrate-3-hydroxypropionate copolymer, 3-hydroxybutyrate To provide a method for preparing a -3-hydroxypropionate copolymer. the malonyl-CoA reductase; acetyl-CoA carboxylase and/or Methylmalonyl-CoA carboxyltransferase; ATP-dependent acyl-CoA synthetase and/or 3-hydroxypropionyl-CoA synthetase; 3-hydroxybutyrate- with enhanced activity of PHA synthetase (phaC), β-ketothiolase (β-ketothiolase, phaA) and NADPH dependent acetoacetyl-CoA reductase (phaB) The 3-hydroxypropionate copolymer and the transformed methanogen are the same as described above.

In the present invention, the term "culture" refers to growth in environmental conditions artificially regulated, such as a target cell or tissue. The environmental conditions typically include nutrients, temperature, osmotic pressure, pH, gas composition, light, etc., but it is the medium that directly affects it, and the medium can be largely divided into a liquid medium and a solid medium. Culturing of the transformant methanogenic bacteria of the present invention can be performed using a method well known in the art.

Specifically, the culture is not particularly limited thereto, as long as it can produce 3-hydroxybutyrate-3-hydroxypropionate copolymer from the transformed methanogen, but a batch process or injection batch or repeated injection batch process ( It can be cultivated continuously in fed batch or repeated fed batch process). As the medium used for culture, NMS (nitrate mineral salts) medium known to be used for culturing of methanogenic bacteria can be used, and a medium in which the components contained in the medium or its content are appropriately adjusted according to the methanogenic bacteria can be used. However, it is not particularly limited thereto. In the present invention, the culture temperature of the transformant methanogenic bacteria may be 15 ℃ to 45 ℃, specifically 20 ℃ to 40 ℃, more specifically 25 ℃ to 35 ℃, for smooth contact between the methane and the strain, 150rpm to 300rpm , specifically 180rpm to 270rpm, more specifically 200rpm to 250rpm may be stirred, but is not limited thereto.

In the present invention, the method for preparing the 3-hydroxybutyrate-3-hydroxypropionate copolymer may include culturing the transformed methanogen in a culture medium containing a C1 carbon source.

In the present invention, the preparation method may further comprise the step of recovering 3-hydroxybutyrate-3-hydroxypropionate copolymer from the culture solution. The step of recovering the 1,3-butanediol may be performed by a suitable method known in the art depending on the culture method. Specifically, the known 3-hydroxybutyrate-3-hydroxypropionate copolymer recovery method is not particularly limited thereto, but centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, fractionation Methods such as dissolution (eg ammonium sulfate precipitation), chromatography (eg HPLC, ion exchange, affinity, hydrophobicity and size exclusion) may be used.

To achieve the above object, 3-hydroxybutyrate-3-hydroxy comprising a transformed methanogen having another 3-hydroxybutyrate-3-hydroxypropionate copolymer-producing ability of the present invention A composition for producing a propionate copolymer is provided.

the malonyl-CoA reductase; acetyl-CoA carboxylase and/or Methylmalonyl-CoA carboxyltransferase; ATP-dependent acyl-CoA synthetase and/or 3-hydroxypropionyl-CoA synthetase; Enhanced PHA synthesis gene (phaC), β-ketothiolase synthesis gene (phaA) and NADPH dependent acetoacetyl-CoA reductase synthesis gene (phaB) activity, The 3-hydroxybutyrate-3-hydroxypropionate copolymer and the transformed methanogen are the same as described above.

The transformed methanogen of the present invention can produce 3-hydroxybutyrate-3-hydroxypropionate copolymer from a C1 carbon source, and is environmentally friendly and economically 3-hydroxybutyrate-3-hydroxypropionate It can be usefully used for mass production of copolymers.

Figure 1 is a schematic view showing an overview of production of 3-hydroxy-propionate-3-hydroxybutyrate copolymer path by M. trichosporium OB3b transformed according to the present invention.
Figure 2 is about the 5 kinds of plasmids prepared to produce 3-hydroxypropionate-3-hydroxybutyrate copolymer.
3 shows the results of analysis of the standard product, 3-hydroxybutyrate-3-hydroxypropionate copolymer through GC-MS.
4 is a result of qualitative analysis of 3-hydroxybutyrate-3-hydroxypropionate copolymer extracted from transformed methanogen.

Hereinafter, the present invention will be described in detail by way of Examples. However, the following examples are only illustrative of the present invention, and the content of the present invention is not limited to the following examples.

Example 1. Wild-type M. trichosporium OB3b and transformation methanobacteria 3- used hydroxypropionate Cell culture and recovery for production of -3-hydroxybutyrate copolymer

M. trichosporium OB3b (NCIMB 11131) was cultured in NMS (nitrate mineral salt) medium containing 5 μM CuSO 4 as described in a previous study (Hwang et al., 2015). M. trichosporium OB3b cells were cultured in a 500 ml baffled flask containing 50 ml of NMS medium and sealed with a screw cap while stirring at 30° C. and 230 rpm. A final concentration of 30% (v/v) methane was supplied by gas exchange using a gas-tight syringe, and the headspace was replaced with a new one every day. After culturing under the same conditions for 4 days, the cells were transferred to a new NMS medium from which nitrate was removed and further cultured for 3 days. The optical density of the cell culture was measured on a Beckman spectrophotometer using a 1.5 ml cuvette with a 1 cm path length. Kanamycin (Km) with a final concentration of 50 μg/ml was used for selection of both M. trichosporium OB3b and E. coli containing recombinant plasmids. For the production of 3-hydroxypropionate-3-hydroxybutyrate copolymer, after culturing under the same conditions as above for 4 days, the cells were transferred to a new NMS medium from which nitrate was removed from the 5th day and further cultured for 3 days.

Example 2. 3-hydroxybutyrate-3-hydroxypropionate copolymer of analysis

Cells were harvested by centrifuging wild-type and transgenic methanogenic bacteria at 10,000 g for 10 minutes, washed once with distilled water, and dried using a freeze dryer. After methanolysis of 100-150 mg of dried cell weight, 3-hydroxybutyrate-3-hydroxyproate was performed through gas chromatography-mass spectrometry (GC-MSD, Agilent 7890B GC-5977B MSD, Korea Pty Ltd.). Cypionate copolymer content and composition were analyzed. For GC-MSD analysis, an HP-5MS capillary column was installed and a flame ionization detector (FID) was used. The split ratio was 1/50, helium was used as the mobile phase, and the inlet and detector temperatures were set to 250°C and 275°C, respectively. The oven temperature was raised to an initial temperature of 50 °C (maintained for 2 minutes), then at a rate of 20 °C/min to 110 °C, and then further heated to 250 °C at a rate of 20 °C/min. The amount of 3-hydroxybutyrate-3-hydroxypropionate copolymer in each sample was expressed as a percentage of the dry weight of the lyophilized cells.

Example 3. 3- hydroxypropionate -3- hydroxybutyrate Construction of a vector system for the construction of a copolymer biosynthetic pathway

The primers of the present invention were designed using Primer 3 software and synthesized by Macrogen (Seoul, Korea) [Table 1]. Chloroflexus aurantiacus , Propionibacterium freudenreichii shermanii , Metallosphaera gDNA of sedula , Rastonia eutropha and M. trichosporium OB3b was isolated using Wizard® Genomic DNA Purification Kit (Promega, USA), and all plasmids were constructed using Gibson assembly. Reverse PCR was used to prepare the linear vector pAWP89 with primers pAWP89-Tac-For/pAWP89-Tac-Rev (Puri et al., 2013).

The primer sequences used in the present invention are summarized in Table 1 below.

Name Sequence pAWP89-F TAGTTGTCGGGAAGATGCGT Primer for pAWP89 backbone amplification containing P _{tac promoter} pAWP89-R AGCTGTTTCCTGTGTGAATA CaMCR-F ttcacacaggaaacagct ATGAGCGGAACAGGACGACT A primer for substantiating the MCR gene isolated from C. aurantiacus,
The PCR product was inserted into the pAWP89 backbone to construct the pAWP89-MCR vector.
CaMCR-R gcatcttcccgacaacta TTACACGGTAATCGCCCGTC lacZ-F ttcacacaggaaacagct ATGACCATGATTACGCCAAGC The pBBR1MCS-2-derived lacZ gene was amplified by PCR and inserted into the pAWP89 backbone to construct the pAWP89-lacZ vector. lacZ-R gcatcttcccgacaacta TTACAATTTCCATTCGCCATTCAGG ACC-CT sub beta-F ggaacaaaagctgggtac ATTAAGCACTATCATATAAATTAAGAGGAGGTAATCAATGAACTGGTATTCGAATGT M. trichosporium To amplify the 4 subunits of the ACC gene from OB3b, the PCR product was ligated to the restriction site of pAWP89-lacZ to construct the pAWP89-lacZ-ACC vector. ACC-CT sub beta-R cgagggggggcccggtac TCAGGCGGCGCGCCGAGGCG Biotin carboxyl carrier-F tcgataagcttgatatcg ATGGCGCGCAAAGCTCCG Biotin carboxyl carrier-R gatccccccgggctgcagg CTATTCGATCACGATGAGGGGG Biotin carboxylase subunit-F atagcctgcagcccgggg ATGTTCGACAAGATCCTCAT Biotin carboxylase subunit-R gccgctctagaactagtg TCAGAAGGTCGGCTCTATGC CT subunit alpha-F gaccttctgacactagtt ATGCGTTTCTATCTCGACTT CT subunit alpha-R accgcggtggcggccgct TCAGATCTTGCGTCCGATCG pAWP89-F TAGTTGTCGGGAAGATGCGT Primer for pAWP89-MCR backbone amplification containing P _{tac promoter and MCR gene} pAWP89-MCR-R TTACACGGTAATCGCCCGTC ACC-4 subunit-F cgggcgattaccgtgtaa ATTAAGCACTATCATATAAATT To amplify the ACC gene from the pAWP89-lacZ-ACC vector, the PCR product was ligated to the pAWP89-MCR backbone to construct the pAWP89-MCR-ACC vector. ACC-4 subunit-R gcatcttcccgacaacta TCAGATCTTGCGTCCGATCG 3HPCS-EcoRI-F aaatgggtcgcggatccg AGGAAACAGCTATGTTTATGCGATATATTATGGT To amplify the 3HPCS gene from M. sedula , the PCR product was ligated to the pET28 vector to construct the pET28-3HPCS vector. 3HPCS-EcoRI-R gcttgtcgacggagctcg CTAGGAGGTCTTTAACTCCTTCT phaCAB-pET28-SacI-F aagacctcctagcgagct AGGAAACAGCTATGGCGACCGGCAAAGGC To amplify the phaCAB gene from R. eutropha , the PCR product was ligated into the pET28-3HPCS vector to construct the pET28-3HPCS-phaCAB vector. phaCAB-pET28-SacI-R aagcttgtcgacggagct TCAGCCCATATGCAGGCC 3HPCS-SpeI-F agagccgaccttctgaca AGGAAACAGCTATGTTTATGCGATAT To amplify the 3HPCS gene from the pET28-3HPCS vector, the PCR product was ligated into the pAWP89-MCR-ACC backbone to construct the pAWP89-MCR-ACC-3HPCS vector. 3HPCS-SpeI-R gtttttattatattccaa CTAGGAGGTCTTTAACTCCTTCT 3HPCS-SpeI-F agagccgaccttctgaca AGGAAACAGCTATGTTTATGCGATAT To amplify the 3HPCS-phaCAB gene from the pET28-3HPCS-phaCAB vector, the PCR product was ligated into the pAWP89-MCR-ACC backbone to construct the pAWP89-MCR-ACC-3HPCS-phaCAB vector. phaCAB-pAW-SpeI-R gtttttattatattccaa TCAGCCCATATGCAGGCC ACS-Ca-EcoRI-F aaatgggtcgcggatccg AGGAAACAGCTATGATCGACACTGCGCCC To amplify the ACS gene of C. aurantiacus , the PCR product was ligated to the pET28 vector to construct the pET28-ACS vector. ACS-Ca-EcoRI-R gcttgtcgacggagctcg TTATGTCACCGTCACTACCGC phaCAB-pET28-ACS-SacI-F acggtgacataacgagct AGGAAACAGCTATGGCGACCGGCAAAGGC To amplify the phaCAB gene from R. eutropha , the PCR product was ligated to the pET28-ACS vector to construct the pET28-ACS-phaCAB vector. phaCAB-pET28-SacI-R aagcttgtcgacggagct TCAGCCCATATGCAGGCC ACS-Ca-SpeI-F agagccgaccttctgaca AGGAAACAGCTATGATCGACAC To amplify the ACS gene from the pET28-ACS vector, the PCR product was ligated to the pAWP89-MCR-ACC backbone to construct the pAWP89-MCR-ACC-ACS vector. ACS-Ca-SpeI-R gtttttattatattccaa TTATGTCACCGTCACTACCG ACS-Ca-SpeI-F agagccgaccttctgaca AGGAAACAGCTATGATCGACAC To amplify the ACS-phaCAB gene from the pET28-ACS-phaCAB vector, the PCR product was ligated to the pAWP89-MCR-ACC backbone to construct the pAWP89-MCR-ACC-ACS-phaCAB vector. phaCAB-pAW-SpeI-R gtttttattatattccaa TCAGCCCATATGCAGGCC MMC(PF)-NheI-F cgcgcggcagccatatgg GGGATCTGATTAGGTTAAGAGAAAGGAGGTTGTTATGAGTCCGCGAGAAATTGAG To amplify the MMC gene from P. freudenreichii, the PCR product was ligated into the pET28-3HPCS vector to construct the pET28-MMC-3HPCS vector. MMC(PF)-NheI-R tgctgtccaccagtcatgt CAGCCGATCTTGATGAGACC MMC-F cgggcgattaccgtgtaa GGGATCTGATTAGGTTAAGAGA To amplify the MMC-3HPCS gene from the pET28-MMC-3HPCS vector, the PCR product was ligated to the pAWP89-MCR backbone to construct the pAWP89-MCR-MMC-3HPCS vector. 3HPCS-R gcatcttcccgacaacta CTAGGAGGTCTTTAACTCCTTCT

Plasmids pAWP89-MCR-ACC-ACS pAWP89-MCR-ACC-based backbone carrying ACS gene derived from C. aurantiacus OK-70-fl DSM 636 pAWP89-MCR-ACC-ACS-phaCAB pAWP89-MCR-ACC-ACS-based backbone-carrying phaCAB gene cluster derived from R. eutropha. pAWP89-MCR-ACC-3HPCS pAWP89-MCR-ACC based backbone carrying 3HPCS gene derived from M. sedula DSM 5348 pAWP89-MCR-ACC-3HPCS-phaCAB pAWP89-MCR-ACC-3HPCS-based backbone carrying the phaCAB gene cluster derived from R. eutropha pAWP89-MCR-MMC-3HPCS pAWP89-MCR-MMC-based backbone carrying 3HPCS gene originated from M. sedula DSM 5348

Example 4. M. of Vector System for constructing 3-hydroxybutyrate-3-hydroxypropionate copolymer biosynthetic pathway. trichosporium to OB3b transformation

In order to transform the recombinant expression vector obtained in Example 3 into M. trichosporium OB3b, a wild-type methanogen, conjugation was performed. M. trichosporium OB3b grown at OD600 to about 0.2 was used. 50 ml of M. trichosporium OB3b and 10 ml of donor E. coli S17-1 containing the plasmid to be introduced were washed with NMS. Thereafter, the mixed cells were applied to a 0.2 μm sterile nitrocellulose filter. The filter was placed on NMS agar medium containing 0.02% (w/v) proteose-peptone, and incubated for 24 hours at 30°C in the presence of methane (50% in air). Cells from NMS agar plates containing 0.02% (w/v) proteose-peptone were resuspended in 10 mL NMS medium, and concentrated by centrifugation at 7000 g for 5 minutes. Cell pellets were plated on NMS agar containing kanamycin and incubated with methane/air (1:1, v/v) for 2-3 weeks until single colonies appeared.

In order to select the transformed methanogenic bacteria, M. trichosporium OB3b was confirmed through 16s DNA analysis, and it was confirmed whether each gene was inserted using the primers used in Example 2. Table 3 shows the transformed methanogenic bacteria obtained through this.

strain name Relevant characteristics Methylosinus trichosporium OB3b Essential aerobic methane-oxidizing alpha proteobacteria used as host strains OB3b-MCRA-AS M. trichosporium OB3b harboring pAWP89-MCR- ACC-ACS OB3b-MCRA-ASP M. trichosporium OB3b harboring pAWP89-MCR- ACC-ACS-phaCAB OB3b-MCRA-3S M. trichosporium OB3b harboring pAWP89-MCR- ACC-3HPCS OB3b-MCRA-3SP M. trichosporium OB3b harboring pAWP89-MCR- ACC-3HPCS-phaCAB OB3b-MCRM-3S M. trichosporium OB3b harboring pAWP89-MCR- MMC-3HPCS

Example 5. Wild-type strain M. trichosporium with OB3b transformation methanobacteria used from methane 3- hydroxybutyrate -3- hydroxypropionate Copolymer production, extraction and quantitation

Method of Example 1 with the wild type strain M. trichosporium OB3b and transformed with methane bacteria magnetization (OB3b-MCRA-AS, OB3b -MCRA-ASP, OB3b-MCRA-3S, OB3b-MCRA-3SP and OB3b-MCRM-3S) conversion After culturing in NMS medium for 4 days, it was transferred to a new NMS medium from which the nitrogen source was removed from the 5th day and further cultured for 3 days. The harvested cells were analyzed and quantified for 3-hydroxybutyrate-3-hydroxypropionate copolymer produced by the method of Example 2.

As a result, in the wild-type strain, 3-hydroxybutyrate-3-hydroxypropionate copolymer was not produced, and malonyl-CoA reductase and acetyl-CoA carboxylase (acetyl-CoA) were not produced. carboxylase) the ATP-dependent acyl -CoA synthase (ATP-dependent acyl-CoA synthetase ) of 24.93%, based on the weight of the cells in the transgenic methane bacteria magnetization OB3b-MCRA-aS was more expressed in the 3- to the overexpression of M. trichosporium OB3b A hydroxybutyrate-3-hydroxypropionate copolymer was produced, and the content of 3-hydroxypropionate was measured to be 4.15 mol%.

In addition, PHA synthesis gene (phaC), β-ketothiolase (β-ketothiolase, phaA) and NADPH dependent acetoacetyl-CoA reductase (NADPH dependent acetoacetyl-CoA reductase, phaB) were added to the OB3b-MCRA-AS strain. When expressed, the proportion of 3-hydroxybutyrate-3-hydroxypropionate copolymer slightly increased to 25.59 wt%, but the content of 3-hydroxypropionate was rather decreased ( FIGS. 3 and 4 ).

In addition, in order to increase the conversion efficiency of 3-hydroxypropionate to 3-hydroxypropionyl CoA, malonyl-CoA reductase and acetyl-CoA carboxylase were used. In the transgenic methanogen OB3b-MCRA-3S, which was overexpressed with 3-hydroxypropionyl-CoA synthetase in M. trichosporium OB3b, 24.86% of 3-hydroxy Butyrate-3-hydroxypropionate copolymer was produced, of which the content of 3-hydroxypropionate was 8.09 mol %, which increased by 1.94 times compared to OB3b-MCRA-AS. (Table 4).

The higher the 3-hydroxypropionate content of the 3-hydroxybutyrate-3-hydroxypropionate copolymer, the better the physical properties. In addition, methylmalonyl-CoA carboxyltransferase (methylmalonyl-CoA carboxylase) instead of acetyl-CoA carboxylase to enhance the flux to 3-hydroxypropionate, a precursor of 3-hydroxypropionyl CoA. Methylmalonyl-CoA carboxyltransferase) and malonyl -CoA reductase (malonyl-CoA reductase) to that in the over-expressing M. trichosporium OB3b 3- hydroxy-propionyl -CoA synthase expression by adding (3-hydroxypropionyl-CoA synthetase) OB3b -MCRM-3S produced 25.62% of 3-hydroxybutyrate-3-hydroxypropionate copolymer based on the cell weight, and the content of 3-hydroxypropionate was 9.0 mol% of OB3b-MCRA- The intracellular copolymer ratio compared to 3S also increased by about 2%, and the 3-hydroxypropionate content also increased by about 1%.

strains PHA/CDW
(wt%) 3HB
(wt%) 3HP
(wt%) Composition 3HB
(mol%) 3HP
(mol%) WT 17.09 17.09 0 100 0 OB3b-MCRA-AS 24.93 24.03 0.9 95.85 4.15 OB3b-MCRA-ASP 25.59 24.68 0.91 95.91 4.09 OB3b-MCRA-3S 24.86 23.1 1.76 91.91 8.09 OB3b-MCRA-3SP 26.76 24.93 1.83 92.18 7.82 OB3b-MCRM-3S 25.62 23.6 2.02 91.00 9.00

From the above description, those skilled in the art to which the present invention pertains will understand that the present invention may be embodied in other specific forms without changing the technical spirit or essential characteristics thereof. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention, rather than the above detailed description, all changes or modifications derived from the meaning and scope of the claims described below and their equivalents.

<110> kyoung-hee university industry coorperation foundation <120> Production of poly(3HB-co-3HP) from methane by metabolic engineered methanotrophs <130> PN1910-487 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 3663 <212> DNA <213> Chloroflexus aurantiacus <400> 1 atgagcggaa caggacgact ggcaggaaag attgcgttaa ttaccggtgg cgccggcaat 60 atcggcagtg aattgacacg tcgctttctc gcagagggag cgacggtcat tattagtgga 120 cggaatcggg cgaagttgac cgcactggcc gaacggatgc aggcagaggc aggagtgccg 180 gcaaagcgca tcgatctcga agtcatggat gggagtgatc cggtcgcggt acgtgccggt 240 atcgaagcga ttgtggcccg tcacggccag atcgacattc tggtcaacaa tgcaggaagt 300 gccggtgccc agcgtcgtct ggccgagatt ccactcactg aagctgaatt aggccctggc 360 gccgaagaga cgcttcatgc cagcatcgcc aatttacttg gtatgggatg gcatctgatg 420 cgtattgcgg cacctcatat gccggtagga agtgcggtca tcaatgtctc gaccatcttt 480 tcaggggctg agtactacgg gcggattccg tatgtcaccc ctaaagctgc tcttaatgct 540 ctatctcaac ttgctgcgcg tgagttaggt gcacgtggca tccgcgttaa tacgatcttt 600 cccggcccga ttgaaagtga tcgcatccgt acagtgttcc agcgtatgga tcagctcaag 660 gggcggcccg aaggcgacac agcgcaccat tttttgaaca ccatgcgatt gtgtcgtgcc 720 aacgaccagg gcgcgcttga acgtcggttc ccctccgtcg gtgatgtggc agacgccgct 780 gtctttctgg ccagtgccga atccgccgct ctctccggtg agacgattga ggttacgcac 840 ggaatggagt tgccggcctg cagtgagacc agcctgctgg cccgtactga tctgcgcacg 900 attgatgcca gtggccgcac gacgctcatc tgcgccggcg accagattga agaggtgatg 960 gcgctcaccg gtatgttgcg tacctgtggg agtgaagtga tcatcggctt ccgttcggct 1020 gcggcgctgg cccagttcga gcaggcagtc aatgagagtc ggcggctggc cggcgcagac 1080 tttacgcctc ccattgcctt gccactcgat ccacgcgatc cggcaacaat tgacgctgtc 1140 ttcgattggg gggccggcga gaataccggc gggattcatg cagcggtgat tctgcctgct 1200 accagtcacg aaccggcacc gtgcgtgatt gaggttgatg atgagcgggt gctgaatttt 1260 ctggccgatg aaatcaccgg gacaattgtg attgccagtc gcctggcccg ttactggcag 1320 tcgcaacggc tccccccgg cgcacgtgcg cgtgggccgc gtgtcatttt tctctcgaac 1380 ggtgccgatc aaaatgggaa tgtttacgga cgcattcaaa gtgccgctat cggtcagctc 1440 attcgtgtgt ggcgtcacga ggctgaactt gactatcagc gtgccagcgc cgccggtgat 1500 catgtgctgc cgccggtatg ggccaatcag attgtgcgct tcgctaaccg cagccttgaa 1560 gggttagaat ttgcctgtgc ctggacagct caattgctcc atagtcaacg ccatatcaat 1620 gagattaccc tcaacatccc tgccaacatt agcgccacca ccggcgcacg cagtgcatcg 1680 gtcggatggg cggaaagcct gatcgggttg catttgggga aagttgcctt gattaccggt 1740 ggcagcgccg gtattggtgg gcagatcggg cgcctcctgg ctttgagtgg cgcgcgcgtg 1800 atgctggcag cccgtgatcg gcataagctc gaacagatgc aggcgatgat ccaatctgag 1860 ctggctgagg tggggtatac cgatgtcgaa gatcgcgtcc acattgcacc gggctgcgat 1920 gtgagtagcg aagcgcagct tgcggatctt gttgaacgta ccctgtcagc ttttggcacc 1980 gtcgattatc tgatcaacaa cgccgggatc gccggtgtcg aagagatggt tatcgatatg 2040 ccagttgagg gatggcgcca taccctcttc gccaatctga tcagcaacta ctcgttgatg 2100 cgcaaactgg cgccgttgat gaaaaaacag ggtagcggtt acatccttaa cgtctcatca 2160 tactttggcg gtgaaaaaga tgcggccatt ccctacccca accgtgccga tacgccgtc 2220 tcgaaggctg gtcagcgggc aatggccgaa gtctttgcgc gcttccttgg cccggagata 2280 cagatcaatg ccattgcgcc gggtccggtc gaaggtgatc gcttgcgcgg taccggtgaa 2340 cgtcccggcc tctttgcccg tcgggcgcgg ctgattttgg agaacaagcg gctgaatgag 2400 cttcacgctg ctcttatcgc ggctgcgcgc accgatgagc gatctatgca cgaactggtt 2460 gaactgctct tacccaatga tgtggccgca ctagagcaga atcccgcagc acctaccgcg 2520 ttgcgtgaac tggcacgacg ttttcgcagc gaaggcgatc cggcggcatc atcaagcagt 2580 gcgctgctga accgttcaat tgccgctaaa ttgctggctc gtttgcataa tggtggctat 2640 gtgttgcctg ccgacatctt tgcaaacctg ccaaacccgc ccgatccctt cttcacccga 2700 gcccagattg atcgcgaggc tcgcaaggtt cgtgacggca tcatggggat gctctacctg 2760 caacggatgc cgactgagtt tgatgtcgca atggccaccg tctattacct tgccgaccgc 2820 aatgtcagtg gtgagacatt ccacccatca ggtggtttgc gttacgaacg cacccctacc 2880 ggtggcgaac tcttcggctt gccctcaccg gaacggctgg cggagctggt cggaagcacg 2940 gtctatctga taggtgaaca tctgactgaa caccttaacc tgcttgcccg tgcgtacctc 3000 gaacgttacg gggcacgtca ggtagtgatg attgttgaga cagaaaccgg ggcagagaca 3060 atgcgtcgct tgctccacga tcacgtcgag gctggtcggc tgatgactat tgtggccggt 3120 gatcagatcg aagccgctat cgaccaggct atcactcgct acggtcgccc agggccggtc 3180 gtctgtaccc ccttccggcc actgccgacg gtaccactgg tcgggcgtaa agacagtgac 3240 tggagcacag tgttgagtga ggctgaattt gccgagttgt gcgaacacca gctcacccac 3300 catttccggg tagcgcgcaa gattgccctg agtgatggtg ccagtctcgc gctggtcact 3360 cccgaaacta cggctacctc aactaccgag caatttgctc tggctaactt catcaaaacg 3420 acccttcacg cttttacggc tacgattggt gtcgagagcg aaagaactgc tcagcgcatt 3480 ctgatcaatc aagtcgatct gacccggcgt gcgcgtgccg aagagccgcg tgatccgcac 3540 gagcgtcaac aagaactgga acgttttatc gaggcagtct tgctggtcac tgcaccactc 3600 ccgcctgaag ccgatacccg ttacgccggg cggattcatc gcggacgggc gattaccgtg 3660 taa 3663 <210> 2 <211> 3898 <212> DNA <213> Methylosinus trichosporium <400> 2 atgaactggt attcgaatgt cgttccgccg aagatcaaag ccctcatcaa gcgcgaggcg 60 cccgagaacg cctgggtcaa atgcccggag agcggccagc tcgtgttcca caaggacata 120 gaggacaatc tctatgtcat tccgggctcg ggctatcaca tgcgcatccc cgtcgaggcg 180 cggctcgcca gcctcttcga cgagggcgag cacgaattgc tgccgacgcc gggaggttccg 240 gccgatccgc tgaaattccg cgacatcaag cgctatgtcg acaagatcaa agagtatcgg 300 ttgaagaccg gccatatcga cgcggtgacg ctggccttcg gcaagctcga ggacgcgccg 360 gtcacggtcg cggtgcagga tttcgacttc atgggcggct cgctcggcat ggcggcgggc 420 gaggcgatcg tcaccggcat gacccatgcg ctggagaagc gcacgccatt catcatcttc 480 accgcctcgg gcggcgcgcg catgcaggag ggcatgttct cgctgatgca gatgccgcgc 540 accacggtcg cggtgcgccg gctgcgcgag gcgcgcttgc cttatatcgt cgtgctcacc 600 aatccgacca cgggcggcgt caccgcctcc tatgcgatgc tgggcgacat tcacatcgcc 660 gagcccggcg cgatcatcgg cttcgccggc gcgcgcgtca tcgagcagac gattcgcgag 720 aagctgccgc agggttttca gcgcgccgaa tatctgcgcg accatggcat ggtcgacatg 780 gtcgtgccgc gccccgagat gcgcgcgaca ttggcgcggc tctgcgctct gctgaccaaa 840 gcgcctcggc gcgccgcctg agtaccgggc cccccctcga ggtcgacggt atcgataagc 900 ttgatatcga gtactactca accaaaccag caagaaggag gttatatatg gcgcgcaaag 960 ctccgacgcg acgcaccccc ccagccaaac cgagagtcgc cgccgccgcc gagacgggcg 1020 tcgacgccgc gctgctgcgc gagatcgcca agctgctcgg cgagagcgat ctcaccgaaa 1080 tcgaggtcca gaaaggcgat ctgcgcataa gggcggcgcg catgccggcg ccggcgccgg 1140 cgatcgccca tggcgcgatc gcgctgccgc cctatgccgc gcagccttat gcgccgccct 1200 atgctgcgcc gccgccgccg gccaagcccg ccgcgcccgc gccggcgagc catgccgacg 1260 cgctgaaatc gccgatggtc ggcaccgcct atctgcgccc gagcccggac gcgcggccct 1320 tcatagaggt cggctcgcgc gtcaccgcgg gcgataagct gctgctcatc gaggcgatga 1380 agacattcaa cgacatcgtc gcgcccaagg gcggcgtcgt caccgccatt ctggtggagg 1440 acggacagcc ggtcgaatat ggcgagcccc tcatcgtgat cgaatagcct gcagcccggg 1500 gtatcgtaga tctacactaa taaagaagga ggtacataat gttcgacaag atcctcatcg 1560 ccaatcgcgg cgagatcgcg cttcgcatcc tgcgcgccgc caaggagctc ggcatcgcca 1620 cggtcgccgt gcattcgacg gcggacgcgg atgcgatgca tgtgaagctc gccgacgaat 1680 ccgtctgcat cggaccgccg gcggcgcgcg actcctatct caacattccc tcgctgctct 1740 cggcctgcga gatcaccggc gccgacgccg tgcatccggg ctatggcttc ctctcggaga 1800 acgcccgttt cgccgagatc gtggccgagc acgggctgac cttcatcggg ccgaaggccg 1860 agcacatccg gctgatgggc gacaagatcg aggccaaggc gacggcgcgg cgcctcggca 1920 ttccgtgcgt gccgggctcg gacggcccga tcgccgacga gatcgaaggc gcgcgcgtcg 1980 ccgcgaagat cggctatccg gtgctggtga aagcggcctc gggcggcggc ggacgcggca 2040 tgaaggtcgc gcgcaacgac accgagctcg ccatcgccat tcccactgcg cgcaccgagg 2100 caaaggccgc cttcggcgac gacacggtct atctcgagaa atatctcgag aagccgcgcc 2160 acatcgaaat ccaggtgttc ggcgacggca agggcgcagc catccatctc ggcgagcgcg 2220 attgctcgct tcagcgtcgc caccaaaaag tgtgggagga aagcccgtcg cccgcgctca 2280 acgacgagca gcgcgccgag atcggcgagg tctgcgccgc ggcgatgcgc gaattgaaat 2340 atgccggcgc cggcacgatc gaattcctct atgagaatgg cgccttctat ttcatcgaga 2400 tgaacacgcg catccaggtc gagcatccgg tgaccgaggc ggtgaccggc gtcgatctcg 2460 tcagcgagca aatccgggtc gcggccggct cgccgctgtc gatgcggcag gaagacatct 2520 ggttctgggg ccatgcgatc gagtgccgcg tcaacgccga gcacccgtcg agctttcggc 2580 cctcgcccgg gcgcatcgcc tattatcacc cgccgggcgg cgtcggcgtg cgcgtcgatt 2640 catcggccta tcagggctac acgatcccgc cgaactatga ctcgctgatc ggcaagctga 2700 tcgtgcatgg ccgcaatcgc accgaggcgc tgatgcgcct gcggcgcgcg ctcgacgaat 2760 tcatcgtcga cggcatcgac acgaccttgc cgttgttccg cacgctggtg cgcaacgccg 2820 atgtgcagaa cggagtctat gacatccact ggctcgagca ttttctggcg acgggcggca 2880 tagagccgac cttctgacac tagttggaat ataataaaaa cactaatcaa aaaggaggtc 2940 cacaatgcgt ttctatctcg acttcgaaaa gcccgtcgcc gagctcgaga ccaaggtcga 3000 ggagctgcgc gctctcgcct ccaagggcga cggcgtgtcg atcggcgagg agctgggcaa 3060 gctcgaggcc aaggccgcca aggcgctcgc cgatctctac gccactttga cgccctggca 3120 gaagatccag gtcgcgcgcc atccgcagcg gccgcatttc tccgattatg tgcgccagct 3180 gttcgacgag ttcacgccgc tcgccggcga tcgcgccttc ggcgaggatt tggctatcgt 3240 cggcggcttt gcgcgctttc gcggcgagcc ggtctgcatc atgggccagg agaagggctc 3300 ggacacgtcg agtcggctcg agcataattt cggcatggcg cggccggagg gctatcgcaa 3360 ggcggcgcgg ctgatggagc tcgccgaccg cttcggcctg ccggtcgtct cgctggtcga 3420 caccgcgggc gccttcccgg gcatagacgc cgaggagcgc ggccaggccg aggccatcgc 3480 ccgctcgacc gaagtgtcgc tgtcgctcgg cgttcccaat gtcgccgtgg tggtggggga 3540 gggcggctcc ggcggcgcca tcgccatcgc cacctgcaac aaggtgctga tgctggagca 3600 cgccgtgtac acggtggcct cgcccgaggc ttcggcctcg atcctgtggc gcgacgccac 3660 caaggcgcag gatgcggcca ccagcatgaa gatcaccgcg caggacctgc tcaaattcgg 3720 catcatcgac gtcatcgtcg ccgagcccgc gggcggcgcg catcgcgagc cgcaggccgc 3780 ggtgacggcg gtcggcgagg cgatcgacca tgcgctcgcc ggcctcggaa acctgtcgcg 3840 ggcgcagatc atcgacgccc gcgcggaaaa atttctgtcg atcggacgca agatctga 3898 <210> 3 <211> 3760 <212> DNA <213> Propionibacterium freudenreichii <400> 3 atgagtccgc gagaaattga ggtttccgag ccgcgcgagg ttggtatcac cgagctcgtg 60 ctgcgcgatg cccatcagag cctgatggcc acacgaatgg caatggaaga catggtcggc 120 gcctgtgcag acatgatgc tgccgggtac tggtcagtgg agtgttgggg tggtgccacg 180 tatgactcgt gtatccgctt cctcaacgag gatccttggg agcgtctgcg cacgttccgc 240 aagctgatgc ccaacagccg tctccagatg ctgctgcgtg gccagaacct gctgggttac 300 cgccactaca acgacgaggt cgtcgatcgc ttcgtcgaca agtccgctga gaacggcatg 360 gacgtgttcc gtgtcttcga cgccatgaat gatccccgca acatggcgca cgccatggct 420 gccgtcaaga aggccggcaa gcacgcgcag ggcaccattt gctacacgat cagcccggtc 480 cacaccgttg agggctatgt caagcttgct ggtcagctgc tcgacatggg tgctgattcc 540 atcgccctga aggacatggc cgccctgctc aagccgcagc cggcctacga catcatcaag 600 gccatcaagg acacctacgg ccagaagacg cagatcaacc tgcactgcca ctccaccacg 660 ggtgtcaccg aggtctccct catgaaggcc atcgaggccg gcgtcgacgt cgtcgacacc 720 gccatctcgt ccatgtcgct cggcccgggc cacaacccca ccgagtcggt tgccgagatg 780 ctcgagggca ccgggtacac caccaacctt gactacgatc gcctgcacaa gatccgcgat 840 cacttcaagg ccatccgccc gaagtacaag aagttcgagt cgaagacgct tgtcgacacc 900 tcgatcttca agtcgcagat ccccggcggc atgctctcca acatggagtc gcagctgcgc 960 gcccagggcg ccgaggacaa gatggacgag gtcatggcag aggtgccgcg cgtccgcaag 1020 gccgccggct tcccgcccct ggtcaccccg tccagccaga tcgtcggcac gcaggccgtg 1080 ttcaacgtga tgatgggcga gtacaagagg atgaccggcg agttcgccga catcatgctc 1140 ggctactacg gcgccagccc ggccgatcgc gatccgaagg tggtcaagtt ggccgaggag 1200 cagtccggca agaagccgat cacccagcgc ccggccgatc tgctgccccc cgagtgggag 1260 gagcagtcca aggaggccgc ggccctcaag ggcttcaacg gcaccgacga ggacgtgctc 1320 acctatgcac tgttcccgca ggtcgctccg gtcttcttcg agcatcgcgc cgagggcccg 1380 cacagcgtgg ctctcaccga tgcccagctg aaggccgagg ccgagggcga cgagaagtcg 1440 ctcgccgtgg ccggtcccgt cacctacaac gtgaacgtgg gcggaaccgt ccgcgaagtc 1500 accgttcagc aggcgtgagg atgattgcca atcatggctg aaaacaacaa tttgaagctc 1560 gccagcacca tggaaggtcg cgtggagcag ctcgcagagc agcgccaggt gatcgaagcc 1620 ggtggcggcg aacgtcgcgt cgagaagcaa cattcccagg gtaagcagac cgctcgtgag 1680 cgcctgaaca acctgctcga tccccattcg ttcgacgagg tcggcgcttt ccgcaagcac 1740 cgcaccacgt tgttcggcat ggacaaggcc gtcgtcccgg cagatggcgt ggtcaccggc 1800 cgtggcacca tccttggtcg tcccgtgcac gccgcgtccc aggacttcac ggtcatgggt 1860 ggttcggctg gcgagacgca gtccacgaag gtcgtcgaga cgatggaaca ggcgctgctc 1920 accggcacgc ccttcctgtt cttctacgat tcgggcggcg cccggatcca ggagggcatc 1980 gactcgctga gcggttacgg caagatgttc ttcgccaacg tgaagctgtc gggcgtcgtg 2040 ccgcagatcg ccatcattgc cggcccctgt gccggtggcg cctcgtattc gccggcactg 2100 actgacttca tcatcatgac caagaaggcc catatgttca tcaggggccc ccaggtcatc 2160 aagtcggtca ccggcgagga tgtcaccgct gacgaactcg gtggcgctga ggcccatatg 2220 gccatctcgg gcaatatcca cttcgtggcc gaggacgacg acgccgcgga gctcattgcc 2280 aagaagctgc tgagcttcct tccgcagaac aacactgagg aagcatcctt cgtcaacccg 2340 aacaatgacg tcagccccaa taccgagctg cgcgacatcg ttccgattga cggcaagaag 2400 ggctatgacg tgcgcgatgt cattgccaag atcgtcgact ggggtgacta cctcgaggtc 2460 aaggccggct atgccaccaa cctcgtgacc gccttcgccc gggtcaatgg tcgttcggtg 2520 ggcatcgtgg ccaatcagcc gtcggtgatg tcgggttgcc tcgacatcaa cgcctctgac 2580 aaggccgccg aattcgtgaa tttctgcgat tcgttcaaca tcccgctggt gcagctggtc 2640 gacgtgccgg gcttcctgcc cggcgtgcag caggagtacg gcggcatcat tcgccatggc 2700 gcgaagatgc tgtacgccta ctccgaggcc accgtgccga agatcaccgt ggtgctccgc 2760 aaggcctacg gcggctccta cctggccatg tgcaaccgtg accttggtgc cgacgccgtg 2820 tacgcctggc ccagcgccga gattgcggtg atgggcgccg agggtgcggc aaatgtgatc 2880 ttccgcaagg agatcaaggc tgccgacgat cccgacgcca tgcgcgccga gaagatcgag 2940 gagtaccaga acgcgttcaa cacgccgtac gtggccgccg cccgcggtca ggtcgacgac 3000 gtgattgacc cggctgatac ccgtcgaaag attgcttccg ccctggagat gtacgccacc 3060 aagcgtcaga cccgcccggc gaagaagcat ggaaacttcc cctgctgagc gaggagagaa 3120 attatggctg atgaggaaga gaaggacctg atgatcgcca cgctcaacaa gcgcgtcgcg 3180 tcattggagt ctgagttggg ttcactccag agcgataccc agggtgtcac cgaggacgta 3240 ctgacggcca tttcggccgc cgttgcggcc tatctcggca acgatggatc ggctgaggtc 3300 gtccatttcg ccccgagccc gaactgggtc cgcgagggtc gtcgggctct gcagaaccat 3360 tccattcgtt gatccgggag taactcacat gaaactgaag gtaacagtca acggcactgc 3420 gtatgacgtt gacgttgacg tcgacaagtc acacgaaaac ccgatgggca ccatcctgtt 3480 cggcggcggc accggcggcg cgccggcacc gcgcgcagca ggtggcgcag gcgccggtaa 3540 ggccggagag ggcgagattc ccgctccgct ggccggcacc gtctccaaga tcctcgtgaa 3600 ggagggtgac acggtcaagg ctggtcagac cgtgctcgtt ctcgaggcca tgaagatgga 3660 gaccgagatc aacgctccca ccgacggcaa ggtcgagaag gtccttgtca aggagcgtga 3720 cgccgtgcag ggcggtcagg gtctcatcaa gatcggctga 3760 <210> 4 <211> 2643 <212> DNA <213> Chloroflexus aurantiacus <400> 4 atgatcgaca ctgcgcccct tgccccacca cgggcgcccc gctctaatcc gattcgggat 60 cgagttgatt gggaagctca gcgcgctgct gcgctggcag atcccggtgc ctttcatggc 120 gcgattgccc ggacagttat ccactggtac gacccacaac accattgctg gattcgcttc 180 aacgagtcta gtcagcgttg ggaagggctg gatgccgcta ccggtgcccc tgtaacggta 240 gactatcccg ccgattatca gccctggcaa caggcgtttg atgatagtga agcgccgttt 300 taccgctggt ttagtggtgg gttgacaaat gcctgcttta atgaagtaga ccggcatgtc 360 atgatgggct atggcgacga ggtggcctac tactttgaag gtgaccgctg ggataactcg 420 ctcaacaatg gtcgtggtgg tccggttgtc caggagacaa tcacgcggcg gcgcctgttg 480 gtggaggtgg tgaaggctgc gcaggtgttg cgtgatctgg gcctgaagaa gggtgatcgg 540 attgctctga atatgccgaa tattatgccg cagattatt atacggaagc ggcaaaacga 600 ctgggtattc tgtacacgcc ggtcttcggt ggcttctcgg acaagactct ttccgaccgt 660 attcacaatg ccggtgcacg agtggtgatt acctctgatg gtgcgtaccg caacgcgcag 720 gtggtgccct acaaagaagc gtataccgat caggcgctcg ataagtatat tccggttgag 780 acggcgcagg cgattgttgc gcagaccctg gccaccttgc ccctgactga gtcgcagcgc 840 cagacgatca tcaccgaagt ggaggccgca ctggccggtg agattacggt tgagcgctcg 900 gacgtgatgc gtggggttgg ttctgccctc gcaaagctcc gcgatcttga tgcaagcgtg 960 caggcaaagg tgcgtacagt actggcgcag gcgctggtcg agtcgccgcc gcgggttgaa 1020 gctgtggtgg ttgtgcgtca taccggtcag gagattttgt ggaacgaggg gcgagatcgc 1080 tggagtcacg acttgctgga tgctgcgctg gcgaagattc tggccaatgc gcgtgctgcc 1140 ggctttgatg tgcacagtga gaatgatctg ctcaatctcc ccgatgacca gcttatccgt 1200 gcgctctacg ccagtattcc ctgtgaaccg gttgatgctg aatatccgat gtttatcatt 1260 tacacatcgg gtagcaccgg taagcccaag ggtgtgatcc acgttcacgg cggttatgtc 1320 gccggtgtgg tgcacacctt gcgggtcagt tttgacgccg agccgggtga tacgatatat 1380 gtgatcgccg atccgggctg gatcaccggt cagagctata tgctcacagc cacaatggcc 1440 ggtcggctga ccggggtgat tgccgaggga tcaccgctct tcccctcagc cgggcgttat 1500 gccagcatca tcgagcgcta tggggtgcag atctttaagg cgggtgtgac cttcctcaag 1560 acagtgatgt ccaatccgca gaatgttgaa gatgtgcgac tctatgatat gcactcgctg 1620 cgggttgcaa ccttctgcgc cgagccggtc agtccggcgg tgcagcagtt tggtatgcag 1680 atcatgaccc cgcagtatat caattcgtac tgggcgaccg agcacggtgg aattgtctgg 1740 acgcatttct acggtaatca ggacttcccg cttcgtcccg atgcccatac ctatcccttg 1800 ccctgggtga tgggtgatgt ctgggtggcc gaaactgatg agagcgggac gacgcgctat 1860 cgggtcgctg atttcgatga gaagggcgag attgtgatta ccgccccgta tccctacctg 1920 acccgcacac tctggggtga tgtgcccggt ttcgaggcgt acctgcgcgg tgagattccg 1980 ctgcgggcct ggaagggtga tgccgagcgt ttcgtcaaga cctactggcg acgtgggcca 2040 aacggtgaat ggggctatat ccagggtgat tttgccatca agtaccccga tggtagcttc 2100 acgctccacg gacgctctga cgatgtgatc aatgtgtcgg gccaccgtat gggcaccgag 2160 gagattgagg gtgccatttt gcgtgaccgc cagatcacgc ccgactcgcc cgtcggtaat 2220 tgtattgtgg tcggtgcgcc gcaccgtgag aagggtctga ccccggttgc cttcattcaa 2280 cctgcgcctg gccgtcatct gaccggcgcc gaccggcgcc gtctcgatga gctggtgcgt 2340 accgagaagg gggcggtcag tgtcccagag gattacatcg aggtcagtgc ctttcccgaa 2400 acccgcagcg ggaagtatat gcggcgcttt ttgcgcaata tgatgctcga tgaaccactg 2460 ggtgatacga cgacgttgcg caatcctgaa gtgctcgaag agattgcagc caagatcgct 2520 gagtggaaac gccgtcagcg tatggccgaa gagcagcaga tcatcgaacg ctatcgctac 2580 ttccggatcg agtatcaccc accaacggcc agtgcgggta aactcgcggt agtgacggtg 2640 aca 2643 <210> 5 <211> 1986 <212> DNA <213> Metallosphaera sedula <400> 5 atgtttatgc gatatattat ggttgaggaa cagaccctga agaccgggtc acaggaacta 60 gaggagaagg cagactataa catgagatat tacgctcacc tcatgaagtt gagtaaggaa 120 aaacctgcag agttctgggg atctctagca caggacctgc tagactggta tgagccttgg 180 aaggagacca tgagacagga agacccgatg acaaggtggt tcataggagg taagataaat 240 gcctcgtaca acgctgtcga cagacacctc aacggcccca gaaagttcaa ggctgcggtc 300 atctgggaaa gtgagttagg ggaaaggaag atcgtgacgt atcaggacat gttctatgag 360 gttaataggt gggccaatgc gctcagatcc ctaggagttg gtaaagggga tagggtgacc 420 atatacatgc ccctgacccc agagggaata gctgcaatgc tggcctcggc caggataggt 480 gcaattcata gcgtaatatt tgccggcttt ggttcgcaag ccatagccga cagggttgag 540 gacgccaagg cgaaggtagt gatcactgct gacgcctatc ccagaagggg aaaggttgtg 600 gagttaaaga agactgtcga cgaggcctta aactcccttg gagaaaggag cccagtacag 660 cacgtgctcg tgtataggag gatgaaaacg gatgtaaaca tgaaggaggg aagagacgtt 720 ttcttcgacg aggtcggcaa gtacaggtac gtggagcctg aaaggatgga ctccaatgat 780 ccactcttca ttctctacac ctctgggacc accggtaaac ctaagggaat tatgcactct 840 accggtggtt atctgaccgg gacagccgtt atgctactgt ggagctacgg ccttagccag 900 gagaacgacg ttctcttcaa cacctcagat attggttgga tagttggcca ctcctacatt 960 acctattccc cccttatcat ggggagaacg gttgtcattt acgagagcgc cccagactat 1020 ccctacccag acaagtgggc tgagattatt gagagataca gggcaaccac tttcggcacc 1080 tcagctacag ccttgcgtta cttcatgaag tatggggacg aatacgtgaa gaaccacgat 1140 ctctcgtcca tcaggataat tgtgacgaac ggggaagtgc ttaactactc tccgtggaag 1200 tgggggctag aagtgttagg tggaggaaag gtattcatgt cccatcagtg gtggcaaact 1260 gagacaggcg caccgaacct gggctacctt ccgggtataa tttacatgcc aatgaagtcg 1320 ggtccagcct caggcttccc tctacccggt aacttcgtgg aggttctgga cgagaacgga 1380 aatccctctg cccctagagt gagaggatac cttgtaatga ggccaccctt cccgcctaac 1440 atgatgatgg ggatgtggaa cgataatggg gagaggttga agaagacgta ctttagcaag 1500 ttcggttccc tgtattatcc aggagacttc gccatggtgg atgaggatgg atacatctgg 1560 gtgttgggta gggcagacga gactctaaaa attgcagccc acagaattgg agctggggaa 1620 gtggaatcag caatcacttc tcacccatcg gttgccgagg cagcagtcat aggcgtgcca 1680 gactcagtga aaggagaaga ggttcacgcg ttcgttgtgc taaagcaagg tacgctcct 1740 tcctctgaac tggctaagga catacagtca cacgttagga aggtcatggg gcccattgtt 1800 agtccgcaga ttcatttcgt ggataagttg cctaagacaa ggtctgggaa ggtcatgaga 1860 agggtgataa aggcagtgat gatgggttcg agtgctggcg acttaaccac catagaggac 1920 gaagcatcaa tggacgaaat aaagaaggct gtcgaggaac taaagaagga gttaaagacc 1980 tcctag 1986 <210> 6 <211> 3851 <212> DNA <213> Ralstonia eutropha <400> 6 atggcgaccg gcaaaggcgc ggcagcttcc acgcaggaag gcaagtccca accattcaag 60 gtcacgccgg ggccattcga tccagccaca tggctggaat ggtcccgcca gtggcagggc 120 actgaaggca acggccacgc ggccgcgtcc ggcattccgg gcctggatgc gctggcaggc 180 gtcaagatcg cgccggcgca gctgggtgat atccagcagc gctacatgaa ggacttctca 240 gcgctgtggc aggccatggc cgagggcaag gccgaggcca ccggtccgct gcacgaccgg 300 cgcttcgccg gcgacgcatg gcgcaccaac ctcccatatc gcttcgctgc cgcgttctac 360 ctgctcaatg cgcgcgcctt gaccgagctg gccgatgccg tcgaggccga tgccaagacc 420 cgccagcgca tccgcttcgc gatctcgcaa tgggtcgatg cgatgtcgcc cgccaacttc 480 cttgccacca atcccgaggc gcagcgcctg ctgatcgagt cgggcggcga atcgctgcgt 540 gccggcgtgc gcaacatgat ggaagacctg acacgcggca agatctcgca gaccgacgag 600 agcgcgtttg aggtcggccg caatgtcgcg gtgaccgaag gcgccgtggt cttcgagaac 660 gagtacttcc agctgttgca gtacaagccg ctgaccgaca aggtgcacgc gcgcccgctg 720 ctgatggtgc cgccgtgcat caacaagtac tacatcctgg acctgcagcc ggagagctcg 780 ctggtgcgcc atgtggtgga gcagggacat acggtgtttc tggtgtcgtg gcgcaatccg 840 gacgccagca tggccggcag cacctgggac gactacatcg agcacgcggc catccgcgcc 900 atcgaagtcg cgcgcgacat cagcggccag gacaagatca acgtgctcgg cttctgcgtg 960 ggcggcacca ttgtctcgac cgcgctggcg gtgctggccg cgcgcggcga gcacccggcc 1020 gccagcgtca cgctgctgac cacgctgctg gactttgccg acacgggcat cctcgacgtc 1080 tttgtcgacg agggccatgt gcagttgcgc gaggccacgc tgggcggcgg cgccggcgcg 1140 ccgtgcgcgc tgctgcgcgg ccttgagctg gccaatacct tctcgttctt gcgcccgaac 1200 gacctggtgt ggaactacgt ggtcgacaac tacctgaagg gcaacacgcc ggtgccgttc 1260 gacctgctgt tctggaacgg cgacgccacc aacctgccgg ggccgtggta ctgctggtac 1320 ctgcgccaca cctacctgca gaacgagctc aaggtaccgg gcaagctgac cgtgtgcggc 1380 gtgccggtgg acctggccag catcgacgtg ccgacctata tctacggctc gcgcgaagac 1440 catatcgtgc cgtggaccgc ggcctatgcc tcgaccgcgc tgctggcgaa caagctgcgc 1500 ttcgtgctgg gtgcgtcggg ccatatcgcc ggtgtgatca acccgccggc caagaacaag 1560 cgcagccact ggactaacga tgcgctgccg gagtcgccgc agcaatggct ggccggcgcc 1620 atcgagcatc acggcagctg gtggccggac tggaccgcat ggctggccgg gcaggccggc 1680 gcgaaacgcg ccgcgcccgc caactatggc aatgcgcgct atcgcgcaat cgaacccgcg 1740 cctgggcgat acgtcaaagc caaggcatga cgcttgcatg agtgccggcg tgcgtcatgc 1800 acggcgccgg caggcctgca ggttccctcc cgtttccatt gaaaggacta cacaatgact 1860 gacgttgtca tcgtatccgc cgcccgcacc gcggtcggca agtttggcgg ctcgctggcc 1920 aagatcccgg caccggaact gggtgccgtg gtcatcaagg ccgcgctgga gcgcgccggc 1980 gtcaagccgg agcaggtgag cgaagtcatc atgggccagg tgctgaccgc cggttcgggc 2040 cagaaccccg cacgccaggc cgcgatcaag gccggcctgc cggcgatggt gccggccatg 2100 accatcaaca aggtgtgcgg ctcgggcctg aaggccgtga tgctggccgc caacgcgatc 2160 atggcgggcg acgccgagat cgtggtggcc ggcggccagg aaaacatgag cgccgccccg 2220 cacgtgctgc cgggctcgcg cgatggtttc cgcatgggcg atgccaagct ggtcgacacc 2280 atgatcgtcg acggcctgtg ggacgtgtac aaccagtacc acatgggcat caccgccgag 2340 aacgtggcca aggaatacgg catcacacgc gaggcgcagg atgagttcgc cgtcggctcg 2400 cagaacaagg ccgaagccgc gcagaaggcc ggcaagtttg acgaagagat cgtcccggtg 2460 ctgatcccgc agcgcaaggg cgacccggtg gccttcaaga ccgacgagtt cgtgcgccag 2520 ggcgccacgc tggacagcat gtccggcctc aagcccgcct tcgacaaggc cggcacggtg 2580 accgcggcca acgcctcggg cctgaacgac ggcgccgccg cggtggtggt gatgtcggcg 2640 gccaaggcca aggaactggg cctgaccccg ctggccacga tcaagagcta tgccaacgcc 2700 ggtgtcgatc ccaaggtgat gggcatgggc ccggtgccgg cctccaagcg cgccctgtcg 2760 cgcgccgagt ggaccccgca agacctggac ctgatggaga tcaacgaggc ctttgccgcg 2820 caggcgctgg cggtgcacca gcagatgggc tgggacacct ccaaggtcaa tgtgaacggc 2880 ggcgccatcg ccatcggcca cccgatcggc gcgtcgggct gccgtatcct ggtgacgctg 2940 ctgcacgaga tgaagcgccg tgacgcgaag aagggcctgg cctcgctgtg catcggcggc 3000 ggcatgggcg tggcgctggc agtcgagcgc aaataaggaa ggggttttcc ggggccgcgc 3060 gcggttggcg cggacccggc gacgataacg aagccaatca aggagtggac atgactcagc 3120 gcattgcgta tgtgaccggc ggcatgggtg gtatcggaac cgccatttgc cagcggctgg 3180 ccaaggatgg ctttcgtgtg gtggccggtt gcggccccaa ctcgccgcgc cgcgaaaagt 3240 ggctggagca gcagaaggcc ctgggcttcg atttcattgc ctcggaaggc aatgtggctg 3300 actgggactc gaccaagacc gcattcgaca aggtcaagtc cgaggtcggc gaggttgatg 3360 tgctgatcaa caacgccggt atcacccgcg acgtggtgtt ccgcaagatg acccgcgccg 3420 actgggatgc ggtgatcgac accaacctga cctcgctgtt caacgtcacc aagcaggtga 3480 tcgacggcat ggccgaccgt ggctggggcc gcatcgtcaa catctcgtcg gtgaacgggc 3540 agaagggcca gttcggccag accaactact ccaccgccaa ggccggcctg catggcttca 3600 ccatggcact ggcgcaggaa gtggcgacca agggcgtgac cgtcaacacg gtctctccgg 3660 gctatatcgc caccgacatg gtcaaggcga tccgccagga cgtgctcgac aagatcgtcg 3720 cgacgatccc ggtcaagcgc ctgggcctgc cggaagagat cgcctcgatc tgcgcctggt 3780 tgtcgtcgga ggagtccggt ttctcgaccg gcgccgactt ctcgctcaac ggcggcctgc 3840 atatgggctg a 3851

Claims (6)

malonyl-CoA reductase (MCR); acetyl-CoA carboxylase (ACC); Methylmalonyl-CoA carboxyltransferase (MMC); ATP-dependent acyl-CoA synthetase (ACS); 3-hydroxypropionyl-CoA synthetase (3HPCS); PHA synthetic gene (phaC); β-ketothiolase (phaA) and NADPH dependent acetoacetyl-CoA reductase (NADPH dependent acetoacetyl-CoA reductase, phaB) are introduced or overexpressed to induce 3-hydroxybutyrate-3-hydroxypropionate As a transformed methanogen having a copolymer-producing ability,
The transformed methanogenic bacteria include: OB3b-MCRA-AS strain transformed with a vector containing MCR, ACC, and ACS;
OB3b-MCRA-ASP strain transformed with a vector containing MCR, ACC, ACS, and phaCAB;
OB3b-MCRA-3P strain transformed with a vector containing MCR, ACC, and 3HPCS;
OB3b-MCRA-3SP strain transformed with a vector containing MCR, ACC, 3HPCS, and phaCAB; and
It is a strain selected from the group consisting of OB3b-MCRM-3S strain transformed with a vector containing MCR, MMC, and 3HPCS,
The transformed methanogenic bacteria using methane as a substrate, methanogenic bacteria.
The method of claim 1,
The malonyl-CoA reductase (malonyl-CoA reductase, MCR) is SEQ ID NO: 1;
Acetyl-CoA carboxylase (ACC) is SEQ ID NO: 2;
Methylmalonyl-CoA carboxyltransferase (MMC) is SEQ ID NO: 3;
ATP-dependent acyl-CoA synthetase (ACS) is SEQ ID NO: 4;
3-hydroxypropionyl-CoA synthetase (3HPCS) is SEQ ID NO: 5;
The PHA synthesis gene (phaC), β-ketothiolase (β-ketothiolase, phaA) and NADPH dependent acetoacetyl-CoA reductase (phaB) are genes consisting of the nucleotide sequence of SEQ ID NO: 6 Transformed methanogenic bacteria, characterized in that each is encoded.
The method of claim 1,
The methanobacteria are genus Methylomonas, genus Methylobacter, genus Methylococcus, genus Methylosphaera, genus methylocaldum (Methylocaldum), methyloglobus Methyloglobus, Methylosarcina, Methyloprofundus, Methylothermus, Methylohalobius, Methylogaea , genus Methylomarinum, genus Methylovulum, genus Methylomarinovum, genus Methylorubrum, genus Methyloparacoccus, genus Methyloparacoccus (Methylocystis), genus Methylocella, genus Methylocapsa, genus Methylofurula, genus Methylacidiphilum, genus Methylacidimicrobium, methylomicro Bium (Methylomicrobium) genus and methyl locinus genus (Methylosinus) will be selected from the group comprising strains, transformed methanogenic bacteria.
According to claim 1,
The methanogenic bacteria is methylosinus trichosporium (Methylosinus trichosporium) OB3b, the transformed methanogen.
A composition for producing a 3-hydroxybutyrate-3-hydroxypropionate copolymer comprising methane as a substrate and the methanogenic bacteria of any one of claims 1 to 4.
Inducing a conversion reaction by culturing the methanogenic bacteria of any one of claims 1 to 4 in a medium containing methane as a substrate; and
Method for producing 3-hydroxybutyrate-3-hydroxypropionate copolymer comprising the step of recovering 3-hydroxybutyrate-3-hydroxypropionate copolymer from the medium.

Images