CN115851510B - Salmonella and application thereof in co-production of tetrahydropyrimidine and polyhydroxyalkanoate - Google Patents

Abstract

The application provides a halomonas strainHalomonasThrough taking the strain as chassis fungus, the strain is used for over-expressing a tetrahydropyrimidine synthetic gene cluster by a molecular means and introducing an exogenous PHB synthetic way, the co-production of the tetrahydropyrimidine and the polyhydroxyalkanoate can be realized, and the yield of the tetrahydropyrimidine and the polyhydroxyalkanoate is greatly improved.

Description

Salmonella and application thereof in co-production of tetrahydropyrimidine and polyhydroxyalkanoate

Technical Field

The application relates to the technical field of synthetic biology, in particular to halomonas and application thereof in coproduction of tetrahydropyrimidine and polyhydroxyalkanoate.

Background

Tetrahydropyrimidine is a cyclic amino acid derivative, has hydrophilic and zwitterionic characteristics, and is one of typical microbiologically compatible solutes. It can be used as osmotic pressure compensation solute to balance the osmotic pressure inside and outside the cell, and also help protease, nucleic acid and biological film inside the cell and even the whole cell to resist the harmful effects of denaturants such as high temperature, freezing, drying, oxygen free radical radiation, urea and the like, and also assists in the proper assembly and folding of proteins within the cell, acting as chaperones. The tetrahydropyrimidine has strong biological macromolecules (extracellular polysaccharide, enzyme, DNA, antibody and the like) and cell stabilization effects, and can protect cells from extreme environments such as high osmotic pressure, high temperature and the like, so that the tetrahydropyrimidine has good application potential in the fields of fine chemical industry, environmental management, agricultural biotechnology, biomedicine and the like.

The existence of metabolic pathways in halomonas for the natural synthesis of tetrahydropyrimidine was originally reported. Through decades of research, the synthetic pathway of tetrahydropyrimidine has been deeply developed at the gene level, the enzyme level and the regulatory level. Among all the anabolic pathways of tetrahydropyrimidine, aspartate semialdehyde (L-aspartate-B-semialdehyde) in the lysine biosynthetic pathway is used as a precursor, and the evolution of a highly conserved linkage ectoABC gene cluster operon is relied on. The structural genes ectob, ectoa and ectoc respectively encode L-diaminobutyrate aminotransferase (ectB), L-diaminobutyrate acetyltransferase (ectA) and tetrahydropyrimidine synthase (ectC), and tetrahydropyrimidine is synthesized by 3-step catalysis.

The inventor performs metagenome sequencing analysis after salt lake sludge sampling, and obtains an ectoABC gene cluster with a brand new sequence through sequence comparison screening, compared with a traditional ectoABC gene cluster operon, the ectoABC gene cluster can realize one-step catalytic synthesis of tetrahydropyrimidine, but has a large rising space in terms of yield, and the inventor performs mutation design on the ectoABC gene cluster, so that the activity is enhanced, the conversion efficiency of the tetrahydropyrimidine is further improved, and the yield is further improved.

On the other hand, polyhydroxyalkanoates (PHA) are an intracellular polyester synthesized by many bacteria, exist mainly as a carbon source and a storage substance of energy source in organisms, and have many excellent properties similar to physical and chemical properties of synthetic plastics and biodegradability, biocompatibility, optical activity, piezoelectricity, gas-barrier property, and the like which synthetic plastics do not possess. The polyhydroxyalkanoate has wide application prospect in the aspects of biodegradable packaging materials, tissue engineering materials, slow-release materials, electrical materials and medical materials.

The inventors found that there is a PHA biosynthesis pathway in Halomonas sp.YL01 itself, mainly synthesized by the acetyl-CoA pathway, which forms poly-3-hydroxybutyrate (PHB) from two molecules of acetyl-CoA, in turn, via beta-ketothiolase (phaA), catalyzed by NADPH-dependent acetyl-CoA reductase (phaB) and PHB synthase (phaC). However, although the above-mentioned PHA-producing metabolic pathways are contained, the productivity is very low, limiting its industrial application.

The inventor further researches and discovers that in the Halomonas sp.YL01 strain, the extracellular transportation effect of the tetrahydropyrimidine is good and can reach more than 60 percent, and because of the advantage, the simultaneous realization of the combination of the tetrahydropyrimidine and the polyhydroxyalkanoate can be fully considered. Therefore, the inventor considers that the Halomonas sp.YL01 is directly adopted as chassis bacteria to co-produce the tetrahydropyrimidine and the polyhydroxyalkanoate, and the yield of the two products is improved simultaneously by over-expressing a tetrahydropyrimidine synthesis gene cluster and introducing an exogenous PHB synthesis way, so that the large-scale industrialization of the tetrahydropyrimidine and the polyhydroxyalkanoate is better realized.

Disclosure of Invention

The technical problem to be solved by the application is to provide a Halomonas sp.YL01 strain, which is used as chassis bacteria, and through over-expressing a tetrahydropyrimidine synthetic gene cluster by a molecular means and introducing an exogenous PHB synthetic way, the coproduction of the tetrahydropyrimidine and polyhydroxyalkanoate can be realized, and the yield of the both can be greatly improved.

Based on the above, the application provides an application of Halomonas sp.YL01 in co-production of tetrahydropyrimidine and polyhydroxyalkanoate.

The Halomonas sp.YL01 strain is preserved in the microbiological institute of the university of Guangdong province (microbiological analysis and detection center of Guangdong province) at 2022, 4 months and 24 days, and is deposited with the accession number GDMCC.No62420.

The Halomonas sp.YL01 strain comprises a gene cluster ectABC which at least comprises 3 genes, namely:

the ectoA gene and the nucleic acid sequence are shown in SEQ ID NO. 1;

the ectoB gene and the nucleic acid sequence are shown as SEQ ID NO. 2;

the ecto gene and the nucleic acid sequence are shown in SEQ ID NO. 3.

The application provides a Halomonas sp.YL01-1 strain, which is obtained by over-expressing an ectABC gene cluster on the Halomonas sp.YL01 strain.

The application also provides a preparation method of the Halomonas sp.YL01-1 strain, which comprises the following steps:

firstly, constructing a suicide plasmid pRE112-ectABC carrying a gene cluster ectABC;

step two, suicide plasmid pRE112-ectABC is transformed into escherichia coli S17-1;

and thirdly, joining to Halomonas sp.YL01 of the chassis bacteria to obtain the strain with the over-expressed ectoABC gene cluster, which is named as Halomonas sp.YL01-1.

The application provides a Halomonas sp.YL01-2 strain, which is obtained by adopting PCT540 gene heterologous expression on Halomonas sp.YL01-1 strain.

The application provides a preparation method of Halomonas sp.YL01-2, which comprises the following steps:

firstly, constructing suicide plasmid pRE112-PCT 540;

second, suicide plasmid pRE112-PCT540 is transformed into E.coli S17-1;

and thirdly, joining to the Halomonas sp.YL01-1 to obtain the Halomonassp.YL01 strain expressed by the heterologous expression of the PCT540 gene, which is named as Halomonas sp.YL01-2.

The application also provides a method for co-producing the tetrahydropyrimidine and the polyhydroxyalkanoate, which comprises the following steps:

firstly, preparing Halomonas sp.YL01-2 seed liquid;

secondly, preparing fermentation liquor;

thirdly, fermenting and culturing to co-produce the tetrahydropyrimidine and the polyhydroxyalkanoate.

The application has the beneficial technical effects that: the Halomonas sp.YL01 strain is used as chassis bacteria, and the molecular means is adopted to overexpress a tetrahydropyrimidine synthetic gene cluster and introduce an exogenous PHB synthetic path, so that the coproduction of the tetrahydropyrimidine and the polyhydroxyalkanoate can be realized, and the yield of the both can be greatly improved.

Drawings

FIG. 1 is a diagram of a Salmonella pcr containing the ectoABC gene cluster obtained from a salt lake sludge sample from Qinghai province in example 1;

FIG. 2 is a schematic diagram of recombinant expression patterns of the gene cluster ectABC;

FIG. 3 is a schematic diagram of E.coli induced tetrahydropyrimidine production;

FIG. 4 is a schematic diagram of suicide plasmid map of the gene cluster ectABC;

FIG. 5 is a diagram of suicide plasmid map of gene pct 540.

Biological material preservation information

YL01, classified as Halomonas sp.YL01, deposited at the university of Guangdong microbiological analysis and detection center of Guangdong province, with a strain deposit number of GDMCC.No62420, a deposit date of 2022, 04 months and a deposit address of the institute of microbiological analysis and detection center of Guangdong province, national institute of sciences, microbiological analysis and detection center of Guangdong province

Detailed Description

Embodiments of the present application are described in detail below, examples of which are illustrated in the accompanying drawings, wherein like or similar reference numerals refer to like or similar elements or elements having like or similar functions throughout. The embodiments described below by referring to the drawings are illustrative and intended to explain the present application and should not be construed as limiting the application.

The following disclosure provides many different embodiments, or examples, for implementing different embodiments of the application. In order to simplify the present disclosure, specific embodiments or examples are described below. Of course, they are merely examples and are not intended to limit the application. In addition, one of ordinary skill in the art will recognize the applicability of other processes and/or the use of other materials, as examples of the various specific processes and materials provided by the present application. The practice of the present application will employ, unless otherwise indicated, conventional techniques in the fields of chemistry, molecular biology, etc., which are within the ability of a person skilled in the art.

The application is described below by way of illustrative specific examples, which are not intended to limit the scope of the application in any way. Specifically described are: the reagents used in the present application are commercially available unless otherwise specified.

It should be noted that unless otherwise defined, technical or scientific terms used in the embodiments of the present application should be given the ordinary meaning as understood by one of ordinary skill in the art to which this disclosure belongs.

Experimental materials and reagents

1. Culture medium of recombinant escherichia coli DH5 alpha and batch feed fermentation nutrient component

(1) LB medium (g/L): 5-20 parts of peptone, 3-10 parts of yeast powder, 10-30 parts of sodium chloride and 6-10 parts of pH modulation, and is used for culturing recombinant escherichia coli JM 109; the plate is prepared by adding 1.5-2% agarose.

(2) MM medium (g/L): 10-30 parts of glucose, 0.5-10 parts of urea, 0-10 parts of aspartic acid, 1-20 parts of yeast powder, 0.05-0.6 part of anhydrous magnesium sulfate, 1.5-5.5 parts of monopotassium phosphate, 5-30 parts of sodium chloride and Fe (III) -NH ₄ -Citrate 0.05-0.1，CaCl ₂ ·2H ₂ O0.02-0.2，ZnSO ₄ ·7H ₂ O 0.1-0.2，MnCl ₂ ·4H ₂ O 0.03-0.09，H ₃ BO ₃ 0.3-1，CoCl ₂ ·6H ₂ O 0.2-0.8，CuSO ₄ ·5H ₂ O 0.01-0.08，NiCl ₂ ·6H ₂ O 0.02-0.1，NaMoO ₄ ·2H ₂ O0.03-0.12, and is used for fermenting recombinant Escherichia coli JM 109.

(3) Feed supplement I (g/L): 300-1000 parts of glucose, 20-100 parts of urea and 0-15 parts of aspartic acid; feed II (g/L): 500-1000 parts of glucose and 2-20 parts of urea.

2. Halomonas sp.YL01 medium

(1) 60LB medium (g/L): 5-20 parts of peptone, 3-10 parts of yeast powder, 60-80 parts of sodium chloride and 8-10 parts of pH modulation, and are used for sieving and culturing Halomonas sp.YL01; the plate is prepared by adding 1.5-2% agarose.

EXAMPLE 1 acquisition of Halomonas sp.YL01

Taking 1g of Qinghai salt lake silt, continuously diluting with sterile water, coating on an LB plate containing NaCl (60 g/L), culturing at 37 ℃ for 48h, picking single bacterial colony after bacterial colony grows out, continuing streak subculturing for 30d, domesticating and screening until pure bacteria are obtained. Amplifying, sequencing and comparing the obtained pure bacteria 16S rDNA to obtain Halomonas sp.YL01 with the biological deposit number: gdmcc.no62420. The genome was then sent to sequencing analysis by Guangzhou Huada, to obtain an ectobc gene cluster, as shown in fig. 1.

The ectABC gene cluster comprises

The ectoA gene and the nucleic acid sequence are shown in SEQ ID NO. 1;

the ectoB gene and the nucleic acid sequence are shown as SEQ ID NO. 2;

the ecto gene and the nucleic acid sequence are shown in SEQ ID NO. 3.

SEQ ID NO.1：ectA

ATGACAATGAACGCAACCACCGAGCCCTTCACACCCTCCGCCGACCTGGCACGCCCCACCGTGGCGGACGCCGTGGTCGGTCACGAGGCCTATCCGCTGTTCATCCGCAAGCCCAACCCCGATGACGGCTGGGGCATCTACGAGCTGGTCAAGTCCTGCCCCCCGCTGGACGTCAACTCCGCCTATGCCTACCTGCTGCTGGCGACCCAGTTCCGCGACAGTTGTGCCGTGGCCACCAACGAGGAGGGCGAGATCGTCGGTTTCGTCTCCGGCTACGTGAAGAGCAACGCCCCGGACACCTACTTCCTGTGGCAGGTGGCGGTCGGCGAGAAGGCGCGCGGCACCGGCCTGGCCCGGCGCCTGGTGGAAGCCGTGATGACCCGCCCGGAGATGGCCGAGGTCCACCACCTCGAGACCACCATCACCCCCGACAACCAGGCCTCCTGGGGCCTGTTCCGGCGGCTTGCCGAACGCTGGCAGGCGCCGCTCAACAGCCGCGAGTACTTCTCCACCGACCAGCTCGGTGGCGAGCACGACCCGGAAAACCTCGTGCGCATCGGCCCCTTCCAGACCGATCGCATCTGA

SEQ ID NO.2：ectB

ATGCAGACCCAGATCCTCGAACGCATGGAGTCCGAAGTTCGGACCTATTCCCGCTCCTTTCCGGTGGTCTTCACCAAGGCCCGGAATGCCCGTCTGACCGACGAGGACGGCCGCGAGTACATCGACTTCCTGGCCGGTGCCGGCACCCTGAACTACGGCCACAACAACCCGCACATCAAGCAGGCGCTGCTCGACTACCTGGCCGAGGACAACATCATCCATGGCCTGGACTTCTGGACCGCCGCCAAGCGTGACTACCTCGAGGCCCTCGACGAGGTGATCCTCAAGCCGCGCGGCCTGGACTACAAGGTCCAGTTCCCTGGACCGACCGGCACCAATGCCGTCGAGGCGGCCATCCGCCTGGCCCGCAACGCCAAGGGCCGCCACAACATCGTCACCTTCACCAACGGCTTCCACGGCGTGACCATGGGGGCGCTGGCCACCACCGGTAACCGCAAGTTCCGCGAGGCCACGGGCGGCGTGCCCACGGTCGGCGGGAGCTTCATGCCCTTCGACGGCTACCTGGGCGAGGGCGCCGACACCCTGGATTACTTCGAGAAGCTGCTCGGCGACAAGTCCGGCGGCCTGGACATCCCGGCGGGGGTGATCGTCGAGACCGTGCAGGGCGAGGGCGGTATCAACGTCGCTGGCCTCGACTGGCTCAAGCGCCTCGAGGGCATCTGCCGCGCCCATGACATCCTGCTGATCGTCGACGACATCCAGGCCGGCTGCGGCCGCACCGGCAAGTTCTTCAGCTTCGAACACGCCGACGTCGTTCCCGATATCGTCACCAACTCCAAGTCGCTCTCCGGCCTCGGCCTGCCGTTCTCCCAGGTGCTGATGCGTCCTGAACTCGATGTCTGGAAGCCGGGCCAGTACAACGGCACCTTCCGCGGCTTCGCGCTTGCCTTCACCACCGCGGCCGCCGCCTTGCGCCACTATTGGAGCGACGACGCCCTGGCCCAGGACGTGGCGCGCAAGGGCGAGGTGGTCGCCAAGCGCTTCCAGAAGATCGCCGGCATGCTCGGCGAACTGGGCATCGAGGCCTCCGAGCGTGGCCGCGGCCTGATGCGCGGGATCGACGTGGGTAGCGGTGACATCGCCGACAAGATCACCCACAAGGCCTTTGAGAACGGGCTGGTCATCGAGACCAGCGGTCAGGACGGCGAGGTAGTCAAGTGCCTCTGCCCGCTGACCATCACCGATGAGGAGCTGGACATGGGCCTCGATATTCTCGAGACCAGCACCAAGCAGGCGCTTAGCTGA

SEQ ID NO.3：ectC

ATGATCGTTCGCAATCTCGATGACGCCCGCAAGACCGACCGCCTGGTCAAGGCCGAAAACGGCAACTGGGACAGCACCCGCCTGAGTCTGGCCGATGATGGCGGCAACTGCTCCTTCCATATCACGCGTATCTACGAAGGCACCGAGACCCACATCCACTACAAGCATCACTTCGAGGCCGTTTTCTGCATCGAAGGCGAGGGCGAGGTGGAAACCCTGGCCGACGGCAAGATCTGGCCGATCAAGCCGGGTGACATCTACATCCTCGACCAGCACGACGAGCACCTGCTGCGCGCCAGCAAGACCATGCACCTGGCCTGCGTGTTCACGCCGGGCCTGACCGGCAACGAGGTGCACCGCGAGGATGGCTCCTACGCGCCGGCCGAGGCCGACGACAAGAAGCCGCTCTGA

EXAMPLE 2 recombinant expression of Gene cluster ectABC

FIG. 2 shows a schematic diagram of recombinant expression patterns of the gene cluster ectABC, specifically as follows:

1. halomonas sp.YL01 genome extraction

Inoculating Halomonas sp.YL01 on a 60LB non-antibiotic plate, culturing for 24 hours at 37 ℃ in an inverted mode, selecting a monoclonal strain to a shaking tube of 5mL 60LB culture solution, and culturing for 12 hours at 37 ℃ with shaking at 180 rpm; 2mL of the bacterial solution was used to extract Halomonas sp.YL01 genome according to the bacterial genome DNA extraction kit (purchased from Tiangen Biochemical technology Co., ltd.).

2. PCR amplification of pSEVA321 skeleton and gene cluster ectoABC sequence of expression vector

According to the expression vector pSEVA321 and the sequence information of the gene cluster ectABC, primers are designed by using Snapgene software (Version 8.02), and the sequences of the primers are as follows:

expression vector-F: cccgcgggtg agtaatgata ctagtagcgg ccgctc

Expression vector-R: tattggcgta ctcatctagt atttcccctc tttctctagt attaaacaaa attatttgt

ectoabc gene cluster-F: gaggggaaat actagatgag tacgccaata acacctttta ccc

ectoabc gene cluster-R: ccgctactag tatcattact cacccgcggg tgc

The vector pSEVA321 and the Halomonas sp.YL01 genome obtained in 1 above were used as templates, respectively, and the following components shown in Table 1 were added in sequence to a 0.2mL PCR tube in a total reaction volume of 50. Mu.L:

TABLE 1

After uniform mixing, the mixture is centrifuged instantaneously, and the reaction parameters are as follows: denaturation at 98℃for 30sec; denaturation at 98℃for 10sec, annealing at 65℃for 30sec, elongation at 72℃for 1.5min, and final elongation at 72℃for 2min after 35 cycles. The pSEVA321 backbone and the gene cluster ectABC were recovered using a universal DNA purification kit (available from Tiangen Biochemical technologies Co., ltd.) and operated as provided in the product instructions.

3. Construction of recombinant expression plasmids

(1) Connecting the pSEVA321 skeleton and the gene cluster ectABC obtained in the step 2 to construct a recombinant expression plasmid: ligation was performed by T4DNA ligation (available from New England Biolabs) in a total reaction volume of 20. Mu.L, and the following ingredients shown in Table 2 were added sequentially to a 0.2mL PCR tube:

TABLE 2

After mixing, the mixture was centrifuged instantaneously and connected overnight at 16℃to obtain a connected product.

(2) Preparation of E.coli DH5 alpha chemically transformed competent cells

1) Using LB plate culture medium, picking Escherichia coli (-20 ℃ glycerol storage strain) with inoculating loop, grading and streaking on the plate, and culturing at 37deg.C for 14-16 hr;

2) Picking an activated E.coli DH5 alpha single colony from an LB plate, inoculating the single colony into 5mL of LB liquid medium, and carrying out shaking culture for 12h at 37 ℃;

3) The culture was prepared as a culture medium 1:100 is inoculated into 100mL of LB liquid medium, and is cultured at 37 ℃ in a shaking way until the OD ₆₀₀ About=0.5, stop culturing on ice;

4) Transferring 1mL of the bacterial liquid into a 1.5mL centrifuge tube, centrifuging at 4000rpm and 4 ℃ for 10min, and discarding the supernatant; then according to Competent Cell Preparation Kit (Takara company, kit for preparing large intestine competence);

5) Competent cells were packed in 50. Mu.L/tube on ice and stored at-80℃to obtain competent cells DH 5. Alpha.

(3) Ligation product transformation of competent cells DH 5. Alpha. Of large intestine

The competent cells DH 5. Alpha. Of the above (2) were taken from a-80℃refrigerator and thawed in an ice bath rapidly. Adding the connection product obtained in the step (1) into escherichia coli competent cells DH5 alpha, lightly mixing, carrying out ice bath for 30min, carrying out water bath heat shock for 90s at 42 ℃, immediately carrying out ice bath for 2min, adding 0.75mL of LB liquid medium, and carrying out resuscitation for 2h at 37 ℃. 100. Mu.L of the bacterial liquid was spread on LB plates containing Cm resistance (final concentration 100. Mu.g/mL), and cultured upside down at 37℃for 12 to 16 hours.

The positive single colony is picked and inoculated into 5mL LB liquid medium containing Cm resistance (the final concentration is 100 mug/mL), and cultured at 37 ℃ and 180rpm overnight, and the positive single colony is verified by bacterial liquid PCR and sequencing analysis shows that the recombinant plasmid construction is successful.

EXAMPLE 3 fermentative production of tetrahydropyrimidine

1. Seed liquid preparation

(1) Taking an inoculating loop, scribing the recombinant escherichia coli DH5 alpha strain on an ultra-clean workbench, activating for 24 hours at 37 ℃ and growing a monoclonal;

(2) selecting the monoclonal in the step 1, inoculating the monoclonal in a shaking tube filled with 5mL of seed culture medium (LB), and culturing for 12 hours at 37 ℃ and 200 rpm;

(3) 200. Mu.L of the bacterial liquid in the above 2 was inoculated into a 150mL Erlenmeyer flask containing 20mL of a seed culture medium (LB), and cultured at 37℃for 12 hours at 200 rpm.

2. Tetrahydropyrimidine shake flask fermentation production

Adding 50mL LB and 50 μl chloramphenicol into 500mL conical flask, adjusting pH to 7-10 with NaOH, inoculating seed solution at 2.5-5% volume ratio, controlling temperature at 35-38deg.C and rotation speed at not higher than 220rpm during fermentation, and changing inducer concentration (10) ^-4 -10 ^-2 M), fermentation culture for 48h, and after fermentation, OD, tetrahydropyrimidine and dry weight (DCM) were measured.

As can be seen from FIG. 3, the gene cluster ectABC can play a role in the synthesis of tetrahydropyrimidine, and the addition of different concentrations of inducer arabinose in a fermentation system indicates that the promoter can normally express ectABC, when the concentration of the inducer is 10 ^-3 At M, the whole cell growth, the tetrahydropyrimidine content and the dry weight of the cell showed the optimum level.

Example 4 overexpression of Gene cluster ectABC to achieve tetrahydropyrimidine stimulation

1. Construction of the carrying Gene Cluster ectABC suicide plasmid (pRE 112-ectABC)

PCR amplification of pRE112 skeleton and gene cluster ectABC sequence of expression vector

Expression vector-F: ggcaccggac gctaaggtga tatagagtgt atcgcgcaaa

Expression vector-R: gcggtgtgga ggcatgatag tctcgaatct tccgaccaat ga

ectoabc gene cluster-F:

agattcgaga ctatcatgcc tccacaccgc tcgtcacatc ctgttgcgtt cactggaatc ccagtataaa gt

ectoabc gene cluster-R: ccgctactag tatcattact cacccgcggg tgc

The construction procedure of the plasmid was the same as in example 2.

2. Transformation of suicide plasmid pRE112-ectABC into E.coli S17-1 and conjugation to Halomonas sp.YL01

(1) The plasmid constructed in this example 1 was used to extract pRE112-ectABC using a plasmid miniprep kit (available from Tiangen Biochemical technologies Co., ltd.) and the procedure was followed as provided in the product specification, and the extracted plasmid was stored at-20℃until transformation was completed.

(2) Preparation of E.coli S17-1 chemically transformed competent cells (same as in example 2)

(3) Ligation product transformation of competent cells S17-1 of the large intestine (same as in example 2)

The positive single colony is picked and inoculated into 5mL LB liquid medium containing Cm resistance (the final concentration is 100 mug/mL), and cultured at 37 ℃ and 180rpm overnight, and the positive single colony is verified by bacterial liquid PCR and sequencing analysis shows that the recombinant plasmid construction is successful.

(4) Joining of

Culturing donor bacteria (S17-1) and acceptor bacteria (Halomonas sp.YL01) in LB and 60LB liquid culture media with corresponding resistance respectively at 37 ℃ overnight for 12-14h, diluting the culture media respectively according to the volume ratio of 1:100-3:100, culturing for 2-3h to the earlier period of index, respectively taking 1ml of culture fluid, placing the culture fluid into a 1.5ml centrifuge tube, centrifuging at 5000rpm for 2min, discarding supernatant, reserving 100 mu L of supernatant to resuspend the bacteria, then mixing the donor bacteria and the acceptor bacteria, dripping the mixture on 60LB solid culture media with the resistance, and placing the mixture into a culture box with the temperature of 37 ℃ for positive culture for 3h or so as to grow fungus coating. 200 mu L of non-antibody 60LB liquid culture medium is dripped on the lawn, the lawn is spread, the flat plate is inverted and placed into a 37 ℃ incubator for culturing for 48 hours, and monoclonal is grown.

(5) Homologous recombination

And (3) continuing streak subculturing the monoclonal antibody in the step (4) for one week to obtain a strain with the over-expressed ectoABC gene cluster, which is named Halomonas sp.YL01-1.

Fermenting the constructed strain Halomonas sp.YL01-1 and strain Halomonas sp.YL01 in 500ml shake flask and 6L fermenter system respectively, and comparing the contents of generated tetrahydropyrimidine and PHB

EXAMPLE 5 overexpression of the Strain Halomonas sp.YL01-1 and fermentation of the Strain Halomonas sp.YL01 to give tetrahydropyrimidine and PHB

(1) Preparation of Halomonas sp.YL01 shake flask seed liquid

(1) Strain activation

The strains are taken in a refrigerator at the temperature of minus 80 ℃ in a laboratory, the strains are picked up by a gun head, streaked and inoculated on a flat solid culture medium (yeast powder 5g/L; tryptone 10g/L; sodium chloride 60g/L; pH 8.5), and cultured for 24 hours at the temperature of 37 ℃.

(2) Primary seed culture:

single colonies were picked up and inoculated into 12ml of shaking tubes (5 ml of 60LB medium: 5g/L of yeast powder; 10g/L of tryptone; 60g/L of sodium chloride; pH 8.5), and the culture broth was placed in a shaking table at 37℃and 220rpm for 12 hours.

(3) Secondary seed culture:

the primary bacterial liquid (1-2% of inoculation amount) is sucked up, inoculated into 150ml conical flask (20 ml 60LB medium) and placed on a shaking table at 37 ℃ and cultured for 12h at 220 rpm.

(2) Preparation of Halomonas sp.YL01-1 shake flask seed liquid

(1) Strain activation

The strains are taken in a refrigerator at the temperature of minus 80 ℃ in a laboratory, the strains are picked up by a gun head, streaked and inoculated on a flat solid culture medium (yeast powder 5g/L; tryptone 10g/L; sodium chloride 60g/L, pH 8.5 and chloramphenicol 1 mill), and cultured for 24 hours at the temperature of 37 ℃.

(2) Primary seed culture:

single colonies were picked up and inoculated into 12ml of shaking tubes (5 ml of 60LB medium: 5g/L of yeast powder, 10g/L of tryptone, 60g/L of sodium chloride, pH 8.5, 1 millof chloramphenicol), and the culture broth was placed in a shaking table at 37℃for 12 hours at 220 rpm.

(3) Secondary seed culture:

the primary bacterial liquid (1-2% of inoculation amount) is sucked and inoculated in a 150ml conical flask (20 ml 60LB culture medium; chloramphenicol 1 mill) and placed in a shaking table at 37 ℃ and cultured for 12h at 220 rpm.

(3) Preparation of seed liquid from Halomonas sp.YL01 fermenter

(1) Strain activation and first-level seed liquid culture are the same as above (1)

(2) Culturing a secondary seed solution:

the primary bacterial liquid (1-2% of inoculation amount) is sucked up, inoculated into 500ml conical flask (100 ml 60LB medium) and placed on a shaking table at 37 ℃ and cultured for 12h at 220 rpm.

(4) Preparation of seed liquid from Halomonas sp.YL01-1 fermenter

(1) Strain activation and first-level seed liquid culture are the same as above (2)

(2) Culturing a secondary seed solution:

the primary bacterial liquid (1-2% of inoculation amount) is sucked up, inoculated into a 500ml conical flask (100 ml 60LB culture medium; chloramphenicol 1 mill) and placed in a shaking table at 37 ℃ and cultured for 12h at 220 rpm.

(5) Fermentation broth preparation

Component I: mgSO (MgSO) ₄ 10g/L；CO(NH ₂ ) ₂ 30g/L；

Component II: KH (KH) ₂ PO ₄ 175g/L

Component III 5g/L Fe (III) -NH ₄ Citrack and 2g/L CaCl ₂ ·2H ₂ Taking 100ml of O; 10ml of solution (containing ZnSO) ₄ ·7H ₂ O 0.1g/L；MnCl ₂ ·4H ₂ O 0.03g/L；H ₃ BO ₃ 0.3g/L；CoCl ₂ ·6H ₂ O 0.2g/L；CuSO ₄ ·5H ₂ O

0.01g/L；NiCl ₂ ·6H ₂ O 0.02g/L；NaMoO ₄ ·2H ₂ O0.03 g/L) and 90ml deionized water are added to mix, and finally pH is adjusted to 4.5-5.5 by 5M NaOH

And (3) backing materials: 50g/L of sodium chloride; yeast paste 1g/L

Carbon source: glucose 30g/L

(6) Fermentation culture

Inoculating the seed solution into 500ml conical flask (bottom material 45ml; component I1ml; component II 1ml; component III 1ml; glucose 1ml;5M NaOH to adjust pH to 8.5-9.5), and culturing at 220rpm for 48 hr at 37deg.C.

Inoculating the seed solution into a 6L fermentation tank (the total volume of the culture medium is 3.6L) according to 2.5-5% for 40-48h.

Note that: the plasmid-containing strain Halomonas sp.YL01-1 is fermented with the addition of 1% chloramphenicol.

(7) Extraction and determination of tetrahydropyrimidine products

Cell Dry Weight (CDW) 15ml of fermented bacterial liquid is placed in a 50ml centrifuge tube, centrifuged for 6min at 8000rpm and room temperature, and the supernatant is removed; washing with deionized water twice; freeze drying for 15 hours by a freeze dryer; and (5) weighing.

Extraction of tetrahydropyrimidine product, taking 5ml of bacterial liquid remained after fermentation into a 50ml centrifuge tube (adding ddH ₂ Diluting the bacterial liquid by 10 times by O or deionized water), crushing cells by a high-pressure cell crusher, and centrifuging at 12000rpm at room temperature for 10min; the supernatant was filtered through a 0.22 μm filter and stored in a liquid chromatography sample bottle.

And (3) determining the content of tetrahydropyrimidine: high Performance Liquid Chromatography (HPLC) using a C18 column; the mobile phase is acetonitrile (solution a) and pure water (solution B) and a: b=70:30; the sample injection amount is 10 mu L; the flow rate is 1mL/min; the detection wavelength is 210nm. Detection by HPLC.

(8) PHB extraction and content determination

Cell Dry Weight (CDW) 15ml of fermented bacterial liquid is placed in a 50ml centrifuge tube, centrifuged for 6min at 8000rpm and room temperature, and the supernatant is removed; washing with deionized water twice; freeze drying for 15 hours by a freeze dryer; and (5) weighing.

Determination of PHB content: then, 2ml of an esterified liquid (comprising methanol, 3% (v/v) concentrated sulfuric acid (98%, w/w) and 1g/L benzoic acid) and 2ml of chloroform were added to 40mg of the lyophilized cells, and the cells were esterified at 100℃for about 4 hours. PHB standard 40mg was treated as a reference in the same manner.

After methanolysis, the samples were assayed for PHB content on a GC-2014 gas chromatograph (Shimadzu). The initial temperature is maintained at 80 ℃ for 1.5min;

in the first stage, the temperature is increased to 140 ℃ at a rate of 30 ℃/min;

in the second stage, the temperature is increased to 240 ℃ at a speed of 40 ℃/min, and the process takes 2min;

the total analysis time was 8min;

the injection temperature was 240℃and the detector temperature was 250 ℃

(9) Fermentation results

The measurement of the content of the different products was carried out by different instruments and the results are shown in Table 3.

TABLE 3 determination of tetrahydropyrimidine and PHB content in different fermentation systems

As can be seen from the results in Table 3, the content of tetrahydropyrimidine produced by the strain Halomonas sp.YL01-1 of the overexpressing gene cluster ectABC is remarkably increased, the dry weight of cells is also improved to some extent, but the productivity of PHB is required to be improved.

EXAMPLE 6 overexpression of PCT540 Gene in Halomonas sp.YL01-1 Strain

PCT540 is allenyl-coa transferase from strain Clostridium propionicum (PCT with a gene mutation at V193A and four nucleotide mutations T78C, T669C, A1125G, and T1158C) (Choi et al 2016). It can specifically obtain 3HB-coA, and greatly increase the PHB-producing content.

Construction of suicide plasmid pRE112-PCT540

PCR amplification of the pRE112 backbone and PCT540 sequence of the expression vector

Expression vector-F:

gctggcattg aacacatgcc tccacaccgc tcgtcacatc ctgttgcgtt cactggaatc ccagtatagc at

expression vector-R: ctacgcgagc agtaacccct aactcccccc tg

PCT540-F：atgagaaagg ttcccattat taccgcagat gaggctg

PCT540--R：tcaggacttc atttccttca gacccattaa gccttctgca

The construction procedure of the plasmid was the same as in example 2.

Suicide plasmid pRE112-PCT540 was transformed into E.coli S17-1 and ligated into Halomonas sp.YL01-1 (same as in example 3) to give a strain of Halomonas sp.YL01 expressed by heterologous expression of PCT540 gene, designated Halomonas sp.YL01-2.

Example 7Halomonas sp.YL01-1, comparison of Halomonas sp.YL01-2 with Halomonas sp.YL01 fermentation

(1) Preparation of seed liquid

As in example 5.

(2) Fermentation broth preparation

Component I: mgSO (MgSO) ₄ 10g/L；CO(NH ₂ ) ₂ 30g/L；

Component II: KH (KH) ₂ PO ₄ 175g/L

Component III: 5g/L Fe (III) -NH ₄ Citrack and 2g/L CaCl ₂ ·2H ₂ Taking 100ml of O; 10ml of solution (containing ZnSO) ₄ ·7H ₂ O 0.1g/L；MnCl ₂ ·4H ₂ O 0.03g/L；H ₃ BO ₃ 0.3 g/L；CoCl ₂ ·6H ₂ O 0.2g/L；CuSO ₄ ·5H ₂ O

0.01g/L；NiCl ₂ ·6H ₂ O 0.02g/L；NaMoO ₄ ·2H ₂ O0.03 g/L) and 90ml deionized water are added to mix, and finally pH is adjusted to 4.5-5.5 by 5M NaOH

And (3) backing materials: 50g/L of sodium chloride; yeast paste 1g/L

Carbon source: glucose 50g/L

(3) Fermentation culture

Inoculating the seed solution into 500ml conical flask (bottom material 45ml; component I1ml; component II 1ml; component III 1ml; glucose 3ml;5M NaOH is added to adjust pH to 8.5-9.5; 1%chloramphenicol is added to plasmid-containing strain), and culturing at 220rpm for 48 hr at 37deg.C.

(4) Extraction and determination of tetrahydropyrimidine and PHB

The procedure was the same as in example 5.

(5) Fermentation results

Comparison of the tetrahydropyrimidine and PHB contents produced by different strains under the same culture conditions are shown in Table 2.

TABLE 2 fermentation results of different strains

The PHB content is increased remarkably by introducing PCT540 gene, and the yield of basic tetrahydropyrimidine is not reduced remarkably.

Example 8Halomonas sp.YL01-2 comparison with other halomonas fermentations

By the same technical scheme of the cases, strains which are obtained by modifying the same molecules of the example 4 and the example 6 by using different chassis Halononas sp.DSM2581, halomonas sp.TD01 and Halomonas sp.B01 and co-producing tetrahydropyrimidine and PHB have the codes of Halononas sp.DSM2581-2, halomonas sp.TD01-2 and Halomonas sp.B01-2 respectively. The tetrahydropyrimidine and PHB contents produced by the different strains under the same culture conditions as in example 7 are shown in Table 3.

TABLE 3 fermentation results of different strains

By modifying different chassis, the effect of Halomonas sp.YL01-2 co-production of tetrahydropyrimidine and PHB is better, and the cell dry weight, the tetrahydropyrimidine and the PHB content are all at the upstream level.

All of the above-described primary implementations of this intellectual property are not intended to limit other forms of implementing this new product and/or new method. Those skilled in the art will utilize this important information and the above modifications to achieve a similar implementation. However, all modifications or adaptations belong to the reserved rights based on the new products of the application.

The above description is only a preferred embodiment of the present application, and is not intended to limit the application in any way, and any person skilled in the art may make modifications or alterations to the disclosed technical content to the equivalent embodiments. However, any simple modification, equivalent variation and variation of the above embodiments according to the technical substance of the present application still fall within the protection scope of the technical solution of the present application.

Claims (5)

1. Salmonella spHalomonas sp.) YL01-2, characterized in that: the preservation number is GDMCC No. 62420Salt monad @Halomonas sp.) over-expression on YL01ectABCGene cluster acquisitionHalomonas sp, YL01-1 strain, and inHalomonas sp, YL01-1 basedPCT540Heterologous expression of genesHalomonas sp, YL01-2, wherein,

ectAthe gene and the nucleic acid sequence are shown in SEQ ID NO. 1;

ectBthe gene and the nucleic acid sequence are shown in SEQ ID NO. 2;

ectCthe gene and the nucleic acid sequence are shown in SEQ ID NO. 3.

2. The halomonas sp according to claim 1Halomonas sp.) preparation method of YL01-2, characterized in thatHalomonas The construction method of sp, YL01-1 comprises,

first step, carrying Gene clustersectABCSuicide plasmidpRE112-ectABCIs constructed according to the following steps;

second step, suicide plasmidpRE112-ectABCTransforming into Escherichia coli S17-1;

third step, the strain is joined to the chassis fungusHalomonas sp, YL01, giveectABCGene cluster overexpressed strain designatedHalomonas sp. YL01-1。

3. The preparation method according to claim 2, characterized in that: the saidHalomonas The construction method of sp, YL01-2 comprises,

first step, suicide plasmidpRE112-PCT540Is constructed according to the following steps;

second step, suicide plasmidpRE112-PCT540Transforming into Escherichia coli S17-1;

a third step of joining to the method of claim 1Halomonas sp, YL01-1, givePCT540Heterologous expression of genesHalomonas sp, YL01-1 strain, designatedHalomonas sp. YL01-2。

4. A method for co-producing tetrahydropyrimidine and polyhydroxyalkanoate, comprising:

in the first step, the first step is to provide,the halomonas of claim 1Halomonas sp.) preparation of YL01-2 seed solution;

secondly, preparing fermentation liquor;

thirdly, fermenting and culturing to co-produce the tetrahydropyrimidine and the polyhydroxyalkanoate.

5. The halomonas of claim 1Halomonas sp.) use of YL01-2 in the synthesis of tetrahydropyrimidine and/or polyhydroxyalkanoates.