CN1560256A - Expression carrier of low oxygen inducing microorganusm and constructure process and application thereof - Google Patents
Expression carrier of low oxygen inducing microorganusm and constructure process and application thereof Download PDFInfo
- Publication number
- CN1560256A CN1560256A CNA2004100061247A CN200410006124A CN1560256A CN 1560256 A CN1560256 A CN 1560256A CN A2004100061247 A CNA2004100061247 A CN A2004100061247A CN 200410006124 A CN200410006124 A CN 200410006124A CN 1560256 A CN1560256 A CN 1560256A
- Authority
- CN
- China
- Prior art keywords
- plasmid
- expression vector
- hypoxia inducible
- microbial expression
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention discloses a hypoxia-induced microbe expression carrier and its constructing mehtd and application, and it is a microbe particle expression carrier containing a vgb starter sequence or a nar starter sequence in E. coli regulated and controlled by fumarate and nitrate reductase mediator FNR. The constructing method: connecting the vgb or nar starter sequence at a polyclonal site of microbe expression carrier to obtain it. As using the expression carrier for fermenting, it can achieve the effect of still keeping stable plasmid inheritance without adding in antibiotics; it can meet the demand of cell growth on high-dissolved oxygen, reducing the requirement of stirring and aerating; it can conveniently and economically induce the expression of exogenous object protein, having a wide prospect in industrial application.
Description
Technical field
The present invention relates to a kind of hypoxia inducible microbial expression vector and construction process and application in the genetically engineered field.
Background technology
The intestinal bacteria heterologous gene expression system is widely used in eucaryon and the proteic expression of protokaryon, is one of gordian technique of conversion technology product research exploitations such as the animal and plant growth factor, genetically engineered drug, vaccine.
But in these microbial cultivation process, especially scale operation and high density fermentation have all run into more inevitable contradictions: produce bacterial strain to the demand of oxygen and the keeping ability of fermentation equipment, continuously ferment and the unstable heredity of plasmid target protein expression condition and fermentation costs etc.
The cell that contains natural plasmid is the result of long-term natural selection, and these are included in the intravital natural plasmid of bacterium generally can both stably pass to filial generation, thereby keeps the stability of plasmid in the population, and natural Loss Rate is very low.Its reason is that mainly these plasmids have a lot of controlling elements.For the low copy number plasmid, two main controlling elements are arranged, one is the par site, has the isolating function of control plasmid, can coordinate cell fission and plasmid replication, obtains a copy at least to guarantee each cell; The 2nd, " suppress cell fission system " (Control of celldivision is called for short ccd),, this system can make the division of the daughter cell that does not obtain plasmid be suppressed, the status thereby the cell that guarantees to contain plasmid is had the advantage in cell colony.For high copy number plasmid, mainly be random assignment, guarantee that daughter cell obtains plasmid, but high copy number plasmid tend to aggregate into polymer by multiple copied, influence distributes, the natural plasmids of therefore many high copies often also have the polymer system (multimerresolution system) of dissociating, and make plasmid resolve into monomer before distributing, and can both obtain plasmid to guarantee each daughter cell, thereby realize the genetic stability (Mao Muling of plasmid, Lassana T B, Shen Ping, Peng Zhenrong.The structure and the stability study thereof that contain the recombinant plasmid pSJM3 in par site.The biotechnology journal, 1998,14 (1): 64-69).The par site of plasmid pSC101 is the cis acting site that a size is 300bp, can and intracellular some factor with ad hoc fashion in conjunction with also plasmid when the cell fission evenly distribute in daughter cell, play effect (the Meacock P A that stablizes plasmid, Cohen S N.Partitioning of bacteria plasmid during celldivision:a cis-acting locus that accomplishes stable plasmid inheritance.Cell, 1980,20:529-542).This site is in different plasmids, pACYC184 for example, R1, oriC, miniF, p15A, RK2 etc. also have effect (Conley D L, Cohen S N.Isolationand characterization of plasmid mutations that enable partitioning of pSC101replicons lacking the partition (par) locus.J.Bacteriol of stable plasmid heredity, 1995,177:1086-1089).Plasmid pBR327 (derivative of plasmid pBR322 has the ColE1 replication origin) is inserted in the par site, the stability of the plasmid pBR327par that obtains greatly improves (ZuritaM, Bolivar F, SoberonX.Construction of plasmid pBR327par, a completely sequenced, stablederivative of pBR327 containing the par locus of pSC101.Gene, 1984,28:119-122).Yet also there is effect (Miller C A in the par site for the uncompatibility of plasmid, Cohen S N.The partition (par) locus of pSC101 is an enhancer of plasmid incompatibility.Mol Microbiol, 1993,9:695-702).
Bacterium Vitreoscilla (Vitreoscilla) is strict aerobic, but be grown in the oxygen deprivation environment more, this is because it can synthesize a kind of reduced hematin (Vitreoscilla hemoglobin of solubility, VHb) (DikshitK L, Webster D A.Cloning, characterization and expression of the bacteriaglobin gene from Vitreoscilla in Escherichia coli.Gene, 1988,70:377-386) to adapt to the oxygen deprivation environment, this proteic gene of encoding is Vitreoscilla hemoglobin gene (Vitreoscillahemoglobin gene, vgb) (Fish P A, Webster D A, Stark B C.Vitreoscillahemoglobin enhances the first step in 2,4-dinitroluene degradation in vitroand at low aeration in vivo, Journal of Molecular Catalysis B:Enzymatic, 2000,9:75-82).VHb participates in the metabolism relevant with oxygen with the oxygenate attitude, by oxygen is passed to respiratory chain, regulates the activity of terminal oxidase, changes the efficient of oxidative phosphorylation, and then changes the pathways metabolism under the hypoxia condition, so that have influence on some expression of gene.It can improve the reorganization bacterium from molecular level oxygen utilized ability (Jacobsen J R, Khosla C.New directions in metabolic engineering.CurrentOpinion in Chemical Biology 1998,2:133-137).Some reported in literature the application example of vgb gene, show that it has and promote cell growth, the effect that improves cell culture density and exogenous gene expression.Can be as the expression of vgb gene in streptomyces aureus with synthetic 40%-60% (first month of spring, Ye Qin, Shi Xianai, Qiu Li, Song Siyang, the Guo Yanghao of improving of product.The cloning and expression of Vitreoscilla hemoglobin gene in streptomyces aureus.The microorganism journal, 2002,42 (3): 305-310); The expression of vgb gene in streptomycete (Stretomyces lividans) can promote thalli growth (Zhu Yifei, Zhu Chunbao, Zhu Baoquan.The cloning and expression of Vitreoscilla hemoglobin gene in streptomycete.Chinese Journal of Pharmaceuticals, 1998,29 (6): 253-258); The vgb gene is being produced polyhydroxybutyrate [poly (β-hydroxybutyrate), PHB] recombination bacillus coli E.coli in express, effectively raise output (the Yu H M of cell stand density and PHB, Shi Y, Zhang Y P, Yang S L, Shen Z Y.Effect of Vitreoscilla hemoglobin biosynthesis in Escherichia colion production of poly (the and fermentative parameters.FEMSMicrobiology Letters of β-hydroxybutyrate), 2002,214:223-227) etc.
The intestinal bacteria exogenous gene expression carrier of at present existing multiple different regulation and control models, comprising: (1) based on the expression system of the promotor that derives from the lac operon, promotor tac, trc and lac are subjected to lactose and analogue induction regulating controlling thereof; (2) expression system that regulated and control by the T7 phage rna polymerase for example in the pET serial carrier, utilizes the control of natural t7 rna polymerase promotor or so-called T7lac promotor, the bound energy blocking-up transcription initiation of lac repressor; (3) have lambda particles phage P
LThe regulator control system of promotor, because this promotor is regulated and control by temperature sensitivity repressor cI ts857, thus when high temperature, can initially transcribe, very useful for expressing to the deleterious product of intestinal bacteria.In industrialization is produced, be crucial to the selection of external source gene expression regulation pattern.The chemical induction pattern will be because the adding of inductor will cause production cost to rise greatly.When the temperature adjusting pattern is used in the large volume fermentor tank, can heat up slowly because of fermentor tank, and cause regulation and control sensitive inadequately.The oxyty regulation and control model is more suitable in production process by contrast.VHb and promotor thereof be successful expression (Dikshit K L in intestinal bacteria, Webster D A.Cloning, characterization and expression of the bacteria globingene from Vitreoscilla in Escherichia coli.Gene, 1988,70:377-386).In intestinal bacteria, can effective initial VHb albumen and other expression of exogenous gene (Dikshit K L, DikshitR P, Webster D A.Study of Vitreoscilla globin (vgb) gene expression andpromoter activity in E.coli through transcriptional fusion.Nucleic AcidsRes, 1990,18:4149-4155).When the environment dissolved oxygen is reduced to 5%-2% saturated oxygen concentration, the initial transcriptional capability of vgb promotor can be activated (Khosla C by the overwhelming majority, Bailey J E.Characterization ofthe oxygen dependent promoter of the Vitreoscilla hemoglobin gene inEscherichia.coli.J.Bacteriol, 1989,171:5990-6004).All one's effort of vgb promotor is induced down in intestinal bacteria, the expression of beta-galactosidase enzymes can reach 10% (Khosla C of whole cell total amount, Curtis J E, Bydalek P, Swartz J R, Bailey J E.Expression of recombinantproteins in Escherichia.coli using an oxygen-responsive promoter.Bio/Technology, 1990,8:554-558).
The innovation and creation content
The purpose of this invention is to provide a kind of hypoxia inducible microbial expression vector.
Hypoxia inducible microbial expression vector provided by the present invention is to contain to be subjected to fumarate and nitrate reductase to reconcile the microorganism plasmid expression vector of the nar promoter sequence of sub-FNR regulation and control in vgb promoter sequence or the intestinal bacteria.
In order to increase the hypoxia inducible effect, above-mentioned hypoxia inducible microbial expression vector also contains vgb operon sequence or tubercule bacillus hemoglobin gene operon sequence.
In order to increase the stability of above-mentioned hypoxia inducible microbial expression vector, described hypoxia inducible microbial expression vector also contains one of following sequence: par site sequence, from the pemK/pemI gene order of plasmid R100, from the ccdA/ccdB gene order of plasmid F, from the hok/sok gene order of plasmid R1 or from the parDE sequence of IncP α plasmid RK2.
Wherein, above-mentioned par site sequence can be par site sequence from plasmid pSC101, from the par site sequence of plasmid prophage P1, P7 or from the par site sequence of plasmid pTAR, is preferably the par site sequence from plasmid pSC101.
The mentioned microorganism expression vector can be procaryotic cell expression carrier and eukaryotic expression vector.The carrier of described procaryotic cell expression carrier for can in intestinal bacteria or genus bacillus, expressing; The carrier of described eukaryotic expression vector for can in yeast, expressing.
Above-mentioned hypoxia inducible microbial expression vector is preferably hypoxia inducible coli expression carrier pKVp, pKVpP, pKVpV, pKVpPV, pKVpPII, pKVpPIII, pKVpPIV, pKVpPVI or pKVpPVII.
Second purpose of the present invention provides a kind of method that makes up above-mentioned hypoxia inducible microbial expression vector.
The method of the above-mentioned hypoxia inducible microbial expression vector of structure provided by the present invention, be will be subjected in vgb promoter sequence or the intestinal bacteria fumarate and the nitrate reductase nar promoter sequence of reconciling sub-FNR regulation and control connect into the multiple clone site of microorganism plasmid expression vector, obtain the hypoxia inducible microbial expression vector.
The nar promoter sequence that is subjected to fumarate and nitrate reductase to reconcile sub-FNR regulation and control in above-mentioned vgb promoter sequence or the intestinal bacteria can be obtained by conventional pcr amplification.
In the present invention, the Vitreoscilla hemoglobin VHb that Vitreoscilla hemoglobin gene vgb operon is expressed can improve the cell growing state, improves expression of exogenous object protein amount and activity; Vgb promotor P
VgbCan under low dissolved oxygen envrionment conditions, induce the downstream gene transcriptional expression; The par site can keep the genetic stability of expression vector in the microbiological culture media that is with or without the microbiotic adding; Vgb promotor P
VgbBeing subjected to fumarate and nitrate reductase to reconcile sub-FNR regulation and control expression promoter under low dissolved oxygen in the also available intestinal bacteria replaces; The genetic stability that also can keep expressing expression vector from the par site of plasmid prophage P1, P7, from the par site of plasmid pTAR, from the pemK of plasmid R100 and pemI gene, from the ccdA of plasmid F and ccdB gene, from the hok of plasmid R1 and sok gene, from the par operon (parDE) of IncP α plasmid RK2.
Experiment showed, that under low dissolved oxygen condition, the expression of exogenous object protein vigor is apparently higher than high dissolved oxygen condition when fermenting with hypoxia inducible escherichia coli plasmid expression vector of the present invention; The hypoxia inducible escherichia coli plasmid expression vector that contains the par site, under the condition that antibiotic-free adds, can be in intestinal bacteria at least 100 generations of genetic stability; The hypoxia inducible escherichia coli plasmid expression vector that contains the vgb operon, the vigor of bacteria concentration and purpose foreign protein tod is greatly improved.With the carrier that comprises tac promotor and similar replicon in contrast, the maximum green fluorescin vigor that the pKVpP carrier can reach approximately is 1.7 times of contrast, thereby will be apparently higher than this type of promotor on promotor intensity.In green fluorescent protein and the detection of tod vigor, can find that the startup of vgb promotor obviously is subjected to the adjusting of environment dissolved oxygen: under high dissolved oxygen condition, express greatly about the logarithm later stage by the target protein of its startup; Under low dissolved oxygen condition, express greatly about the logarithm prometaphase by the target protein of its startup.By on can obtain the control methods of a kind of new expression exogenous object protein in intestinal bacteria: in shake-flask culture, by regulating shaking speed and inoculum size, the expression of target protein can be grown any stage of logarithmic phase by initial at cell, is stronger the logarithmic phase intestinal bacteria for outside atmosphere and the adaptability to changes that self changes; In large scale fermentation is produced, speed, the initial inoculum size of rotating speed, bubbling air or oxygen by regulating rotor and the mode that adopts secondary inoculation, the expression of target protein can be grown any stage of logarithmic phase by initial at cell, if feed a certain amount of pure oxygen, the expression of target protein can also be in the stationary phase of intestinal bacteria growth, and this has the albumen of certain toxic action or its product that very important using value is arranged for producing to the host bacterium.
Use hypoxia inducible microbial expression vector of the present invention fermentation, can not reach and need add the effect that microbiotic still keeps the plasmid genetic stability; Can satisfy demand of cell growth on high-dissolved oxygen, reduce requirement stirring and ventilating; And can make things convenient for and induce expression of exogenous object protein economically; Has wide prospect in industrial application.
Description of drawings
Fig. 1 is plasmid pKVp, pKVpP, pKVpV and pKVpPV building process synoptic diagram
Fig. 2 is plasmid pKVp, pKVpP, the stability analysis curve of pKVpV and pKVpPV
Fig. 3 is plasmid pKVp-E, pKVpP-E, the active histogram that detects of the green fluorescent protein of pKVpV-E and pKVpPV-E
Fig. 4 is plasmid pKVp-E, pKVpP-E, the stability analysis curve of pKVpV-E and pKVpPV-E
Fig. 5 is plasmid pKVp-T, pKVpP-T, pKVpV-T and pKVpPV-T tod activity curve
Fig. 6 is the tod activity curve of plasmid pKVpPV-TII
Embodiment
Embodiment 1, hypoxia inducible coli expression carrier pKVp, pKVpP, the structure of pKVpV and pKVpPV and stability thereof, Vitreoscilla hemoglobin VHb detection of expression
Bacterial classification: intestinal bacteria E.coli JM83
Substratum 1 is (g/l): peptone 10, and yeast extract 5, NaCl 10, acillin 60 μ g/l.
1, hypoxia inducible coli expression carrier pKVp, pKVpP, the structure of pKVpV and pKVpPV
Hypoxia inducible coli expression carrier pKVp, pKVpP, the composition of pKVpV and pKVpPV is as shown in table 1, its building process as shown in Figure 1, concrete steps are as follows:
Table 1 coli expression carrier pKVp, pKVpP, the composition of pKVpV and pKVpPV
The expression vector system important component part
PKVp vgb promotor
PKVpP vgb promotor is from the par site of plasmid pSC101
PKVpV vgb promotor, the vgb operon
PKVpPV vgb promotor is from the par site of plasmid pSC101, vgb operon
1) as shown in Figure 1, under the polymerase chain reaction condition of standard, promoter sequence (KhoslaC with the vgb gene, Bailey J E.Characterization of the oxygen dependent promoter of theVitreoscilla hemoglobin gene in Escherichia.coli.J.Bacteriol, 1989,171:5990-6004) be template, with P
Vgb-up:GCA
CATATG(NdeI) ACAGGACGCTGGGGTTAAAAG and P
Vgb-do:GGC
GAATTC(EcoRI) GAGGGTCTTCCTTAAGTT is the DNA cloning segment that primer obtains 143bp, and this segment contains the promotor of vgb gene, uses restriction enzyme EcoRI, after the NdeI enzyme is cut processing, be inserted into the EcoRI of plasmid pKK223-3, between the NdeI site, obtain plasmid pKVp.
2) as shown in Figure 1, under the polymerase chain reaction condition of standard, with the par site among the plasmid pSC101 is template (Zurita M, Bolivar F, Soberon X.Construction of plasmid pBR327par, a completely sequenced, stable derivative of pBR327 containing the par locusof pSC101.Gene, 1984,28:119-122), with par-up:GTA
CATATG(NdeI) GACAGTAAGACGGGTAAGCC and par-do:GAC
CATATG(NdeI) CGGGCAAATCGCTGAATATT is the DNA cloning segment that primer obtains 367bp, this segment contains the par site of plasmid pSC101, after cutting processing with restriction enzyme NdeI enzyme, be inserted into the NdeI site of the plasmid pKVp that handles through dephosphorylation, obtain plasmid pKVpP.
3) as shown in Figure 1, under the polymerase chain reaction condition of standard, with the vgb operon is template (Kosla C, Bailey J E.The Vitreoscilla hemoglobin gene:molecular cloning, nucleotidesequence and genetic expression in Escherichia coli.Mol.Gen.Genet, 1988,214:158-161), with vgb-up:GCA
CATATG(NdeI) ACAGGACGCTGGGGTTAA and vgb-do:GCA
ATTAAT(AseI) GGTGAAGCGCAACGGGT is the DNA cloning segment that primer obtains 993bp, this segment contains complete vgb operon, after cutting processing with restriction enzyme A se I and Nde I enzyme, be inserted into the NdeI site of the plasmid pKVp that handles through dephosphorylation, obtain plasmid pKVpV.
4) as shown in Figure 1, under the polymerase chain reaction condition of standard, with the par site among the plasmid pSC101 is template (Zurita M, Bolivar F, Soberon X.Construction of plasmid pBR327par, acompletely sequenced, stable derivative of pBR327 containing the par locusof pSC101.Gene, 1984,28:119-122), with par-up:GTA
CATATG(NdeI) GACAGTAAGACGGGTAAGCC and par-do:GAC
CATATG(NdeI) CGGGCAAATCGCTGAATATT is the DNA cloning segment that primer obtains 367bp, this segment contains the par site of plasmid pSC101, after cutting processing with restriction enzyme NdeI enzyme, be inserted into the NdeI site of the plasmid pKVpV that handles through dephosphorylation, obtain plasmid pKVpPV.
2, plasmid stability experiment
1) reference literature (Easter C L, Sobecky P A, Helinski D R.Contribution ofdifferent segment of the par region to stable maintenance of thebroad-host-range plasmid RK2.J.Bacteriol, 1997,179:6472-6479) carry out the plasmid stability experiment:
4 kinds of expression vectors that make up in the step 1 are pressed CaCl
2Facture is transformed into escherichia coli E.coli JM83 respectively, obtains containing the recombination bacillus coli of above-mentioned four kinds of plasmids, and the recombination bacillus coli that will contain above-mentioned four kinds of plasmids is inoculated in the liquid nutrient medium 1 37 ℃ and cultivated 12 hours.The part nutrient solution is gradient dilution 10 in the substratum 1 of preheating
6Doubly, be inoculated into then in the substratum 1 of antibiotic-free, be cultured to mid-log phase.This circulation is defined as 20 generations of intestinal bacteria logarithmic growth.So cultivate until 100 generations of reorganization bacterium logarithmic growth.The part nutrient solution suitably dilutes back coating LB flat board.The utilization of gained bacterium colony is xeroxed flat board and was cultivated 16-20 hour on the antibiotic LB flat board to containing or not having, and detects to keep plasmid cell shared per-cent in total cell.Culture condition wherein is set at: do not have in the baffle flask at 250ml, add the 50ml liquid nutrient medium, 200 rpms as the oxygen supply sufficient condition; Do not have in the baffle flask at 250ml, add the 150ml liquid nutrient medium, 100 rpms as the oxygen supply lean conditions.The plasmid stability detected result as shown in Figure 2, A represents the oxygen supply sufficient condition, B represents the oxygen supply lean conditions.Fig. 2 shows plasmid pKVpP, the pKVpPV that has plasmid pSC101 par site, no matter under oxygen supply sufficient condition and the oxygen supply lean conditions, still keeps nearly 100% cell to include exogenous plasmid during through 100 generations.
3, Vitreoscilla hemoglobin VHb detection of expression
Reference literature (Dikshit K L, Webster D A.Cloning, characterization andexpression of the bacteria globin gene from Vitreoscilla in Escherichia coli.Gene, 1988, method 70:377-386) detects the expression of Vitreoscilla hemoglobin VHb: the overnight culture after centrifugal is resuspended in phosphate buffered saline buffer (100mmol/L, pH7.5) in, and add excessive (0.1g/ml) Na respectively
2S
2O
3, reduce processing.The CO differential spectra is analyzed: the CO differential spectra is the CO complex state of VHb and goes back the poor of ortho states spectrum, reference end and sample end at ultraviolet spectrophotometer UV-8500 add the sample that 1ml handles through reduction respectively, feed 5minCO gas at the sample end, spectrophotometer scans the differential spectra of 400-460nm down again.VHb concentration detected result shows that Vitreoscilla hemoglobin concentration is respectively: 65.55 ± 3.56nmol/g and 66.53 ± 3.81nmol/g in containing the recombination bacillus coli E.coli JM83 of plasmid pKVpV and pKVpPV.Wherein, the molar extinction coefficient of VHb is:
Definition c
0Be wet mycoplasma amount concentration (mg/ml), c
vAmount (nmol/g) for contained VHb in the wet bacterium then has
Bacterial classification: intestinal bacteria E.coli JM83
Foreign gene: green fluorescent protein
Substratum 1 is (g/l): peptone 10, and yeast extract 5, NaCl 10.Acillin 60 μ g/l.
1, with pKVp, pKVpP, pKVpV and pKVpPV are the structure of the required plasmid of vector expression green fluorescent protein:
Plasmid pEGFP-N1 contains green fluorescence protein gene (egfp).Under the polymerase chain reaction condition of standard, be template (available from Clontech company) with plasmid pEGFP-N1, with eGFP-up:GTA
GAATTC(EcoR I) ATGGTGAGCAAGGGCGAGG and eGFP-do:GAC
AAGCTT(Hind III) TTACTTGTACAGCTCGTCC is the green fluorescent protein dna segment that primer amplification obtains 717bp, and the segment two ends have EcoR I and BamH I restriction enzyme site.Be inserted into carrier pKVp, pKVpP, the corresponding restriction enzyme site of pKVpV and pKVpPV place constructs plasmid pKVp-E, pKVpP-E, pKVpV-E and pKVpPV-E.
2, green fluorescent protein is active detects
Detect the OD of unit with the Hitachi spectrophotofluorometer
600Fluorescence intensity.With plasmid pKVp-E, pKVpP-E, pKVpV-E and pKVpPV-E press CaCl
2Facture is transformed into escherichia coli E.coli JM83 respectively.Include plasmid pKVp-E, pKVpP-E, the E.coli JM83 of pKVpV-E and pKVpPV-E cultivates under oxygen supply sufficient condition and oxygen supply lean conditions, and sampling detects in the time of 24 hours.With the intestinal bacteria E.coli JM83 that comprises pKVp-E under the oxygen supply sufficient condition, the bacteria concentration OD of unit
600Fluorescence excitation intensity is as relative intensity of fluorescence 1.The result shows that the green fluorescent protein activity of the unit bacteria concentration under the oxygen supply lean conditions is the highest in comprising plasmid pKVpP-E intestinal bacteria E.coli JM83 as shown in Figure 3.Wherein, culture condition is set at: do not have in the baffle flask at 250ml, add the 50ml liquid nutrient medium, 200 rpms as the oxygen supply sufficient condition; Do not have in the baffle flask at 250ml, add the 150ml liquid nutrient medium, 100 rpms as the oxygen supply lean conditions.
3, plasmid stability experiment
Method is with the step 2 among the embodiment 1.The plasmid stability detected result as shown in Figure 4, A represents the oxygen supply sufficient condition, B represents the oxygen supply lean conditions.Fig. 4 shows plasmid pKVpP-E, the pKVpPV-E that has the par site, no matter under oxygen supply sufficient condition and the oxygen supply lean conditions, still keeps nearly 100% cell to include exogenous plasmid during through 100 generations.Wherein, culture condition is set at: do not have in the baffle flask at 250ml, add the 50ml liquid nutrient medium, 200 rpms as the oxygen supply sufficient condition; Do not have in the baffle flask at 250ml, add the 150ml liquid nutrient medium, 100 rpms as the oxygen supply lean conditions.
Embodiment 3, utilize hypoxia inducible coli expression carrier pKVp, structure and protein-active that pKVpP, pKVpV and pKVpPV express the required plasmid of tod detect
Bacterial classification: intestinal bacteria E.coli JM83
Foreign gene: tod
Substratum 1 is (g/l): peptone 10, and yeast extract 5, NaCl 10.Acillin 60 μ g/l.
1, make up with pKVp, pKVpP, pKVpV and pKVpPV are the plasmid of vector expression tod
Plasmid pKST11 contains tod gene (tod).Under the polymerase chain reaction condition of standard, with plasmid pKST11 is template (Zylstra G J, Gibson D T.Toluene degradation by Pseudomonasputida F1:nucleotide sequence of the todC1C2BADE genes and their expressionin Escherichia coli.J B C, 1989.264:14940-14946.), with TDO-up:GAC
GAATTC(EcoRI) CTAATGAATCAGACCGACACATC and TDO-do:GAO
GGATOC(BamHI) TCACGTTAGGTCTCCTTCAT is the tod dna segment that primer amplification obtains 3.6Kb, and the segment two ends have EcoR I and BamH I restriction enzyme site.Be inserted into carrier pKVp, pKVpP, the corresponding restriction enzyme site of pKVpV and pKVpPV place makes up and obtains plasmid pKVp-T, pKVpP-T, pKVpV-T and pKVpPV-T.
2, tod is active detects
Reference literature (Woo H J, Sanseverino J, Cox C D, Robinson K G, Sayler G S.Themeasurement of toluene dioxygenase activity in biofilm culture of Psedomonasputida F1.Journal of Microbiological Methods, 2000, method 40:181-191) detects the dioxygenase enzyme and lives: after detecting bacteria concentration, the 1ml nutrient solution is transferred in the centrifuge tube at once.After centrifugal (14, centrifugal 1 minute of 000rpm is at 4 ℃), remove supernatant, resuspended with the phosphoric acid buffer of pH value 7.2.Add 25 μ l0.1M indoles and be dissolved in the solution of dimethyl formamide.Detect OD600 with spectrophotometer, the sample that does not add indoles is determined indigo growing amount in contrast.The beginning half an hour in indigo formation speed be defined as the reorganization bacterium enzyme activity (indigo mg/min).With plasmid pKVp-T, pKVpP-T, pKVpV-T and pKVpPV-T press CaCl
2Facture is transformed into escherichia coli E.coli JM83 respectively.The intestinal bacteria that include plasmid pKVpP-T and pKVpPV-T are cultivated under oxygen supply sufficient condition and oxygen supply lean conditions, detect every sampling in 2 hours.The result as shown in Figure 5, as seen in comprising plasmid pKVpPV-T intestinal bacteria, the tod activity of unit bacteria concentration is the highest.Among Fig. 5, A represents the oxygen supply sufficient condition, and B represents the oxygen supply lean conditions.Wherein, culture condition is set at: do not have in the baffle flask at 250ml, add the 50ml liquid nutrient medium, 200 rpms as the oxygen supply sufficient condition; Do not have in the baffle flask at 250ml, add the 150ml liquid nutrient medium, 100 rpms as the oxygen supply lean conditions.
Embodiment 4, vgb promotor P
VgbForm hypoxia inducible expression vector and detection thereof with tubercule bacillus oxyphorase operon sequence
1, the structure of the hypoxia inducible coli expression carrier pKVpPVII of genetic stability
1) under the polymerase chain reaction condition of standard, with the glb0 operon is template (Couture M, Yeh S R, Wittenberg B A, Wittenberg J B, Ouellet Y, Rousseau D L, Guertin M.Acooperative oxygen-binding hemoglobin from Mycobacterium tuberculosis.ProcNatl Acad Sci U S A.1999,96:11223-8)), with glbO-up:GCACATATG (NdeI) AGTAGGTTGAGGCCG and glbO-do:GCA
ATTAAT(AseI) TGGCGAGAAAGGAAG is the DNA cloning segment that primer obtains 956bp, this segment contains complete glb0 operon, after cutting processing with restriction enzyme A seI and NdeI enzyme, be inserted into the NdeI site of the plasmid pKVp that handles through dephosphorylation, obtain plasmid pKVpVII.
2) under the polymerase chain reaction condition of standard, with the par site among the plasmid pSC101 is template (ZuritaM, Bolivar F, Soberon X.Construction of plasmid pBR327par, a completelysequenced, stable derivative of pBR327 containing the par locus of pSC101.Gene, 1984,28:119-122), with par-up:GTA
CATATG(NdeI) GACAGTAAGACGGGTAAGCC and par-do:GAC
CATATG(NdeI) CGGGCAAATCGCTGAATATT is the DNA cloning segment that primer obtains 367bp, this segment contains the par site of plasmid pSC101, after cutting processing with restriction enzyme Nde I enzyme, be inserted into the Nde I site of the plasmid pKVpVII that handles through dephosphorylation, obtain plasmid pKVpPVII.
2, plasmid stability experiment
1) reference literature (Easter C L, Sobecky P A, Helinski D R.Contribution ofdifferent segment of the par region to stable maintenance of thebroad-host-range plasmid RK2.J.Bacteriol, 1997,179:6472-6479) carry out the plasmid stability experiment:
The expression vector pKVpPVII that makes up in the step 1 is pressed CaCl
2Facture transformed into escherichia coli E.coliJM83 obtains containing the recombination bacillus coli of purpose plasmid, recombination bacillus coli is inoculated in the liquid nutrient medium 1 37 ℃ cultivated 12 hours.The part nutrient solution is gradient dilution 10 in the substratum 1 of preheating
6Doubly, be inoculated into then in the substratum 1 of antibiotic-free, be cultured to mid-log phase.This circulation is defined as 20 generations of intestinal bacteria logarithmic growth.So cultivate until 100 generations of reorganization bacterium logarithmic growth.The part nutrient solution suitably dilutes back coating LB flat board.The utilization of gained bacterium colony is xeroxed flat board and was cultivated 16-20 hour on the antibiotic LB flat board to containing or not having, and detects to keep plasmid cell shared per-cent in total cell.Culture condition wherein is set at: do not have in the baffle flask at 250ml, add the 50ml liquid nutrient medium, 200 rpms as the oxygen supply sufficient condition; Do not have in the baffle flask at 250ml, add the 150ml liquid nutrient medium, 100 rpms as the oxygen supply lean conditions.The plasmid stability detected result shows the plasmid pKVpPVII that has plasmid pSC101 par site, no matter under oxygen supply sufficient condition and the oxygen supply lean conditions, still keeps nearly 100% cell to include this exogenous plasmid during through 100 generations.
3, structure and the protein-active that utilizes hypoxia inducible coli expression carrier pKVpPVII to express the required plasmid of tod detects
1) making up with pKVpPVII is the plasmid of vector expression tod
Plasmid pKST11 contains tod gene (tod).Under the polymerase chain reaction condition of standard, with plasmid pKST11 is template (Zylstra G J, Gibson D T.Toluene degradation by Pseudomonasputida F1:nucleotide sequence of the todC1C2BADE genes and their expressionin Escherichia coli.J B C, 1989.264:14940-14946), with TDO-up:GACGAATTC (EcoRI) CTAATGAATCAGACCGACACATC and TDO-do:GACGGATCC (BamHI) TCACGTTAGGTCTCCTTCAT is the tod dna segment that primer amplification obtains 3.6Kb, and the segment two ends have EcoRI and BamHI restriction enzyme site.Be inserted into the corresponding restriction enzyme site of carrier pKVpPVII place, make up and obtain plasmid pKVpPV-TII.
2) tod is active detects
Reference literature (Woo H J, Sanseverino J, Cox C D, Robinson K G, Sayler G S.Themeasurement of toluene dioxygenase activity in biofilm culture of Psedomonasputida F1.Journal of Microbiological Methods, 2000, method 40:181-191) detects the dioxygenase enzyme and lives: after detecting bacteria concentration, the 1ml nutrient solution is transferred in the centrifuge tube at once.After centrifugal (14, centrifugal 1 minute of 000rpm is at 4 ℃), remove supernatant, resuspended with the phosphoric acid buffer of pH value 7.2.Add 25 μ l0.1M indoles and be dissolved in the solution of dimethyl formamide.Detect OD with spectrophotometer
600, the sample that does not add indoles is determined indigo growing amount in contrast.The beginning half an hour in indigo formation speed be defined as the reorganization bacterium enzyme activity (indigo mg/min).Plasmid pKVpPV-TII is pressed CaCl2 facture transformed into escherichia coli E.coli JM83 respectively.The intestinal bacteria that include plasmid pKVpPV-TII are cultivated under oxygen supply sufficient condition and oxygen supply lean conditions, detect every sampling in 2 hours.The result as shown in Figure 6, as seen in comprising plasmid pKVpPV-TII intestinal bacteria, the tod activity of unit bacteria concentration is higher.Among Fig. 6, A represents the oxygen supply sufficient condition, and B represents the oxygen supply lean conditions.Wherein, culture condition is set at: do not have in the baffle flask at 250ml, add the 50ml liquid nutrient medium, 200 rpms as the oxygen supply sufficient condition; Do not have in the baffle flask at 250ml, add the 150ml liquid nutrient medium, 100 rpms as the oxygen supply lean conditions.
Embodiment 5, comprise from the pemK of plasmid R100 and pemI gene, from the ccdA of plasmid F and ccdB gene, from the hok of plasmid R1 and sok gene, from the parDE of IncP α plasmid RK2 influence for the expression vector genetic stability
1, the hypoxia inducible coli expression carrier pKVpPII of genetic stability, pKVpPIII, the structure of pKVpPIV and pKVpPVI
1) under the polymerase chain reaction condition of standard, pemK/pemI gene order (Tsuchimoto S with plasmid R100, Ohtsubo H, Ohtsubo E.Two genes pemK and pemI, responsiblefor stable maintenance of resistance plasmid R100.J.Bacteriol, 1988,170:1461-1466) be template, pR100-up:GTA
CATATG(Nde I) GAAGCAACCACGCTGG and pR100-do:GTC
CATATG(Nde I) GCTGCGCTTGGAATT is the DNA cloning segment that primer obtains 847bp, this segment contains the pemK/pemI gene order, after cutting processing with restriction enzyme NdeI enzyme, be inserted into the NdeI site of the plasmid pKVp that handles through dephosphorylation, obtain plasmid pKVpPII.
2) under the polymerase chain reaction condition of standard, ccdA/ccdB gene order (Ogura T with plasmid F, Hiraga S.Mini-F plasmid genes that couple host cell division to plasmidproliferation.Proc Natl Acad Sci USA, 1983,80:4784-4788) be template, pF-up:GTA
CATATG(NdeI) AATACATAAGGCTTAC and pF-do:ATC
CATATG(NdeI) AACGGAGCCTGACAT is the DNA cloning segment that primer obtains 651bp, this segment contains the ccdA/ccdB gene order, after cutting processing with restriction enzyme Nde I enzyme, be inserted into the NdeI site of the plasmid pKVp that handles through dephosphorylation, obtain plasmid pKVpPIII.
3) under the polymerase chain reaction condition of standard, hok/sok gene order (Gerdes K with plasmid R1, Thisted T, Martinussen J.Mechanism of post-segregational killing by thehok/sok system of plasmid R1:sok antisense RNA regulates formation of a hokmRNA species correlated with killing of plasmid-free cells.Mol.Microbiol.1990,4:1807-1818) be template, pR1-up:ATC
CATATG(NdeI) AACAAACTCCGGGAGG and pR1-do:GTC
CATATG(NdeI) ACAACATCAGCAAGG is the DNA cloning segment that primer obtains 596bp, this segment contains the hok/sok gene order, after cutting processing with restriction enzyme Nde I enzyme, be inserted into the NdeI site of the plasmid pKVp that handles through dephosphorylation, obtain plasmid pKVpPIV.
4) under the polymerase chain reaction condition of standard, parDE gene order (EasterC L with IncP α plasmid RK2, Sobecky P A, Helinski D R.Contribution of different segments of thebroad-host-range plasmid RK2.J.Bacteriol, 1997,179:6472-6479) be template, pRK2-up:GTA
CATATG(Nde I) ACGCAATTTAAATGC and pRK2-do:GTC
CATATG(Nde I) AGTACGCCATCAGGAC is the DNA cloning segment that primer obtains 712bp, this segment contains the parDE gene order, after cutting processing with restriction enzyme Nde I enzyme, be inserted into the Nde I site of the plasmid pKVp that handles through dephosphorylation, obtain plasmid pKVpPVI.
2, plasmid stability experiment
1) reference literature (Easter C L, Sobecky P A, Helinski D R.Contribution ofdifferent segment of the par region to stable maintenance of thebroad-host-range plasmid RK2.J.Bacteriol, 1997,179:6472-6479) carry out the plasmid stability experiment:
4 kinds of expression vectors that make up in the step 1 are pressed CaCl
2Facture is transformed into escherichia coli E.coli JM83 respectively, obtains containing the recombination bacillus coli of above-mentioned four kinds of plasmids, and the recombination bacillus coli that will contain above-mentioned four kinds of plasmids is inoculated in the liquid nutrient medium 1 37 ℃ and cultivated 12 hours.The part nutrient solution is gradient dilution 10 in the substratum 1 of preheating
6Doubly, be inoculated into then in the substratum 1 of antibiotic-free, be cultured to mid-log phase.This circulation is defined as 20 generations of intestinal bacteria logarithmic growth.So cultivate until 100 generations of reorganization bacterium logarithmic growth.The part nutrient solution suitably dilutes back coating LB flat board.The utilization of gained bacterium colony is xeroxed flat board and was cultivated 16-20 hour on the antibiotic LB flat board to containing or not having, and detects to keep plasmid cell shared per-cent in total cell.Culture condition wherein is set at: do not have in the baffle flask at 250ml, add the 50ml liquid nutrient medium, 200 rpms as the oxygen supply sufficient condition; Do not have in the baffle flask at 250ml, add the 150ml liquid nutrient medium, 100 rpms as the oxygen supply lean conditions.The plasmid stability detected result shows escherichia coli expression vector pKVpPII, pKVpPIII, pKVpPIV and the pKVpPVI (plasmid of existing pKVpPV by name among the embodiment 1 of front, now change it into pKVpPVI), no matter under oxygen supply sufficient condition and the oxygen supply lean conditions, still keep nearly 100% cell to include exogenous plasmid during through 100 generations.
The experimental result of the foregoing description shows so that the plasmid pKVpP in par site to be arranged, pKVpPV, pKVpPVII, pKVpPII, pKVpPIII, pKVpPIV and pKVpPVI are expression vector, under the condition that antibiotic-free adds, this plasmid can be in intestinal bacteria at least 100 generations of genetic stability and obviously do not lose (in the limit of error less than 4%).In the large-scale industry fermentation, use the plasmid pKVpP that has the par site, pKVpPV, pKVpPVII, pKVpPII, pKVpPIII, pKVpPIV and pKVpPVI can avoid to keeping the plasmid genetic stability to add the input that microbiotic brings.Satisfied high dissolved oxygen condition in the needed cell of target protein mass production by the effect of vgb promotor, reduced requirement, for large-scale industrial production provides feasibility to stirring and ventilating.Embodiment 2 shows hypoxia inducible coli expression carrier pKVp, pKVpP, the exogenous object protein vigor that pKVpV and pKVpPV express under low dissolved oxygen condition is apparently higher than high dissolved oxygen condition, utilize pKVpP as the expression vector expressing green fluorescent protein, under low dissolved oxygen condition, can reach the highest vigor.Do not contain the vgb gene among the plasmid pKVpP, and expression effect is better than pKVpPV, may to be VHb albumen be less than the negatively influencing of two kinds of albumen for low thing and energy competition for the enhancing of green fluorescent protein vigor to reason.By embodiment 3 as seen, with plasmid pKVpV and pKVpPV that the vgb operon is arranged is expression vector, the vigor of bacteria concentration and purpose foreign protein tod has further raising, and to be VHb albumen be greater than the negatively influencing of two kinds of albumen for substrate and energy competition for the enhancing of tod enzyme activity to possible reason.Because also there is effect in the par site for plasmid incompatibility, so when carrying out coexpression with the plasmid that comprises the pSC101 replication origin, plasmid pKVp, the effect that pKVpV will have superiority.When using vgb promotor P
VgbWhen carrying out the expression of tod enzyme activity with tubercule bacillus oxyphorase operon sequence composition hypoxia inducible expression vector, this enzyme activity also improves.Utilization comprises from the pemK of plasmid R100 and pemI gene, from the ccdA of plasmid F and ccdB gene, from the hok of plasmid R1 and sok gene, makes up new expression vector pKVpPII from the parDE fragment of IncP α plasmid RK2, pKVpPIII, pKVpPIV and pKVpPVI, the line stabilization detection of going forward side by side.This series plasmid is no matter under oxygen supply sufficient condition and the oxygen supply lean conditions, under the condition that antibiotic-free adds, can be in intestinal bacteria at least 100 generations of genetic stability and obviously do not lose (in the limit of error less than 4%).
Sequence table
＜110〉Tsing-Hua University
＜120〉hypoxia inducible microbial expression vector and construction process thereof and application
<130>CGGNA40356
<160>2
<210>1
<211>17
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>1
gcacatatga?caggacgctg?gggttaa 17
<210>2
<211>16
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>2
gcaattaatg?gtgaatcgca?acgggt 16
Claims (10)
1, a kind of hypoxia inducible microbial expression vector is to contain to be subjected to fumarate and nitrate reductase to reconcile the microorganism plasmid expression vector of the nar promoter sequence of sub-FNR regulation and control in vgb promoter sequence or the intestinal bacteria.
2, hypoxia inducible microbial expression vector according to claim 1 is characterized in that: described hypoxia inducible microbial expression vector also contains the vgb operon sequence.
3, hypoxia inducible microbial expression vector according to claim 1 is characterized in that: described hypoxia inducible microbial expression vector also contains tubercule bacillus hemoglobin gene operon sequence.
4, according to claim 1,2 or 3 described hypoxia inducible microbial expression vectors, it is characterized in that: described hypoxia inducible microbial expression vector also contains one of following sequence: par site sequence, from the pemK/pemI gene order of plasmid R100, from the ccdA/ccdB gene order of plasmid F, from the hok/sok gene order of plasmid R1, from the parDE sequence of IncP α plasmid RK2.
5, hypoxia inducible microbial expression vector according to claim 4 is characterized in that: described par site sequence is for from the par site sequence of plasmid pSC101, from the par site sequence of plasmid prophage P1, P7 or from the par site sequence of plasmid pTAR.
6, according to claim 1,2 or 3 described hypoxia inducible microbial expression vectors, it is characterized in that: described microbial expression vector is procaryotic cell expression carrier and eukaryotic expression vector.
7, hypoxia inducible microbial expression vector according to claim 6 is characterized in that: the carrier of described procaryotic cell expression carrier for expressing in intestinal bacteria or genus bacillus; The carrier of described eukaryotic expression vector for can in yeast, expressing.
8, hypoxia inducible microbial expression vector according to claim 7 is characterized in that: described hypoxia inducible microbial expression vector is pKVp, pKVpP, pKVpV, pKVpPV, pKVpPII, pKVpPIII, pKVpPIV, pKVpPVI or pKVpPVII.
9, a kind of method that makes up the described hypoxia inducible microbial expression vector of claim 1, be will be subjected in vgb promoter sequence or the intestinal bacteria fumarate and the nitrate reductase nar promoter sequence of reconciling sub-PNR regulation and control connect into the multiple clone site of microbial expression vector, obtain the hypoxia inducible microbial expression vector.
10, the application of the described hypoxia inducible microbial expression vector of claim 1 in the production exogenous object protein.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200410006124 CN1246463C (en) | 2004-03-03 | 2004-03-03 | Expression carrier of low oxygen inducing microorganusm and constructure process and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200410006124 CN1246463C (en) | 2004-03-03 | 2004-03-03 | Expression carrier of low oxygen inducing microorganusm and constructure process and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1560256A true CN1560256A (en) | 2005-01-05 |
| CN1246463C CN1246463C (en) | 2006-03-22 |
Family
ID=34439712
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200410006124 Expired - Fee Related CN1246463C (en) | 2004-03-03 | 2004-03-03 | Expression carrier of low oxygen inducing microorganusm and constructure process and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1246463C (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101058799B (en) * | 2007-04-19 | 2010-06-09 | 清华大学 | Method of producing polyhydroxyalkanoates and special-purpose engineering bacterium for the same |
| CN103275915A (en) * | 2013-06-05 | 2013-09-04 | 中国农业大学 | Recombinant mutant strain capable of producing polyhydroxyalkanoate |
| CN103403021A (en) * | 2010-09-22 | 2013-11-20 | 英美烟草(投资)有限公司 | Transgenic plants |
| CN107636146A (en) * | 2015-03-02 | 2018-01-26 | 同生公司 | It is engineered to treat the bacterium of the disease for the gastrointestinal mucosal barrier benefited from the alimentary canal inflammation of reduction and/or tightened up |
| CN113373171A (en) * | 2021-05-26 | 2021-09-10 | 中国农业科学院哈尔滨兽医研究所（中国动物卫生与流行病学中心哈尔滨分中心） | Yeast-escherichia coli shuttle plasmid stably inherited in escherichia coli and construction method thereof |
| US11384359B2 (en) | 2014-12-22 | 2022-07-12 | Synlogic Operating Company, Inc. | Bacteria engineered to treat diseases that benefit from reduced gut inflammation and/or tightened gut mucosal barrier |
| US11685925B2 (en) | 2015-10-30 | 2023-06-27 | Synlogic Operating Company, Inc. | Bacteria engineered to treat diseases that benefit from reduced gut inflammation and/or tightened gut mucosal barrier |
-
2004
- 2004-03-03 CN CN 200410006124 patent/CN1246463C/en not_active Expired - Fee Related
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101058799B (en) * | 2007-04-19 | 2010-06-09 | 清华大学 | Method of producing polyhydroxyalkanoates and special-purpose engineering bacterium for the same |
| CN103403021A (en) * | 2010-09-22 | 2013-11-20 | 英美烟草(投资)有限公司 | Transgenic plants |
| US9322029B2 (en) | 2010-09-22 | 2016-04-26 | British American Tobacco (Investments) Limited | Transgenic plants with reduced nitrate content |
| CN103275915A (en) * | 2013-06-05 | 2013-09-04 | 中国农业大学 | Recombinant mutant strain capable of producing polyhydroxyalkanoate |
| US11384359B2 (en) | 2014-12-22 | 2022-07-12 | Synlogic Operating Company, Inc. | Bacteria engineered to treat diseases that benefit from reduced gut inflammation and/or tightened gut mucosal barrier |
| CN107636146A (en) * | 2015-03-02 | 2018-01-26 | 同生公司 | It is engineered to treat the bacterium of the disease for the gastrointestinal mucosal barrier benefited from the alimentary canal inflammation of reduction and/or tightened up |
| US11685925B2 (en) | 2015-10-30 | 2023-06-27 | Synlogic Operating Company, Inc. | Bacteria engineered to treat diseases that benefit from reduced gut inflammation and/or tightened gut mucosal barrier |
| CN113373171A (en) * | 2021-05-26 | 2021-09-10 | 中国农业科学院哈尔滨兽医研究所（中国动物卫生与流行病学中心哈尔滨分中心） | Yeast-escherichia coli shuttle plasmid stably inherited in escherichia coli and construction method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1246463C (en) | 2006-03-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110468092B (en) | Genetically engineered bacterium capable of producing L-valine at high yield, and construction method and application thereof | |
| CN110964683B (en) | Genetically engineered bacterium for producing L-arginine and construction method and application thereof | |
| Carnes | Fermentation design for the manufacture of therapeutic plasmid DNA | |
| CN1225125A (en) | Stable recombinant yeasts for fermenting xylose to ethanol | |
| CN101076597A (en) | Process for plasmid DNA fermentation | |
| CN116004500A (en) | Genetically engineered bacterium for producing L-valine and construction method and application thereof | |
| CN113278655B (en) | Recombinant microorganism for producing L-valine and construction method and application thereof | |
| CN113278641B (en) | Recombinant escherichia coli for producing L-valine as well as construction method and application thereof | |
| US11639512B2 (en) | Corynebacterium constitutive expression vector promoter screened on the basis of transcriptome sequencing, screening method thereof, and applications thereof | |
| CN1246463C (en) | Expression carrier of low oxygen inducing microorganusm and constructure process and application thereof | |
| CN1353192A (en) | Method for producing objective fermentation product | |
| CN113278568A (en) | Recombinant escherichia coli for producing L-valine and application thereof | |
| US20220411837A1 (en) | Recombinant methanotrophic bacteria for indigo biosynthesis and methods thereof | |
| CN106635945A (en) | Recombinant strain and preparation method thereof and method for producing L-threonine | |
| Liu et al. | Enhanced production of ε-poly-l-lysine by immobilized Streptomyces ahygroscopicus through repeated-batch or fed-batch fermentation with in situ product removal | |
| JP7151049B2 (en) | How to grow microorganisms | |
| CN1908159A (en) | D-amino acid preparation strain and construction method thereof | |
| CN103667374A (en) | Method for producing D-lactic acid by taking recombined serratia marcescens as bacterium | |
| CN1156180A (en) | Producing tryptophane from colibacillus | |
| CN105907778B (en) | Streptomyces fuscosporivii recombinant expression plasmid, engineering bacterium and application | |
| RU2473683C1 (en) | METHOD OF COMMERCIAL E.coli STRAIN CULTURE PREPARED OF BL21(DE3) STRAIN CARRYING POLYMERASE T7 RNA GENE UNDER CONTROL OF lacUV5 PROMOTER WITH INCREASED BIOMASS SYNTHESIS AND HIGHER END PROTEIN YIELD IN INCLUSION BODIES | |
| JP2003530823A (en) | Method for increasing the yield of recombinant protein in a microbial fermentation process | |
| CN1639339A (en) | Fermentation process | |
| CN1148441C (en) | Novel engineering colibacillus G830 | |
| CN1829800A (en) | Metabolically engineered bacterial strains having enhanced 2-keto-D-gluconate accumulation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20060322 |