CN1712533A - Superhalophilic antient bacteria plasmid and its derivative plasmid carrier - Google Patents

Abstract

Extremehalophile plasmid and its derived plasmid carrier are disclosed. The plasmid is pSCM201 from extremehalophile AS7094 and has nucleotide sequence in sequence 3. PSCM201 derived plasmid consists of pSCM204 and pSCM206. It can be used for extremehalophile research.

Description

A kind of extremely halophilic archaea plasmid and the plasmid vector of deriving thereof

Technical field

The present invention relates to a kind of extremely halophilic archaea plasmid and the plasmid vector of deriving thereof.

Background technology

Ancient bacterium grows in extreme physical environment more, is considered to and bacterium and eukaryote the third form arranged side by side, life.Studies show that ancient bacterium is similar to eukaryote at (as dna replication dna, transcribe, translation etc.) aspect the transmission of genetic information; Then approaching aspect central metabolism (as production capacity) with bacterium.Therefore, study ancient bacterium and not only be significant, and help to understand comparatively complicated more Eukaryotic important biomolecules processes for the secret of aspects such as the basic law of illustrating life movement, announcement origin of life and spore.From the angle of development biotechnology, the extreme enzyme that the ancient bacterium of extreme environment is produced more can tolerate rigor condition (as high temperature, soda acid, organic solvent etc.) than normal enzyme, thereby has a good application prospect in a lot of fields.

The suitableeest growing environment of extremely halophilic archaea (Extremely Halophilic Archaea) contains 2-5M NaCl, is main extreme halotolerant environmental microorganism.Extremely halophilic archaea is positioned at the top of the Euryarchaeta of branch (wide ancient bacterium) of archeobacteria in systematic evolution tree, form (the Proc Natl Acad Sci USA1996 of a relatively independent colony, 93 (17): 9188-9193), with hyperthermophilic archaeon strain with produce the ancient bacterium of methane and compare, halophilic archaea is a monoid of the easiest cultivation.Extremely halophilic archaea is of a great variety, comprises Halobacterium, Halococcus, Haloarcula, Haloferax, Halorubrum, Halobaculum, Halogeome tricum, Haloterrigrna, Halorhabdus, Natrialba, Natronobacterium, Natronococcus, Natronomonas, Natrinema, Natronorubrum, 16 genus such as Haloalcalophilium.Halobacterium wherein, Haloferax etc. are the neutral pole terminal halophilic archaea, Natronobacterium, Natronococcus etc. have a liking for the ancient bacterium of alkali for extreme halotolerant.Extremely halophilic archaea has DEVELOPMENT PROSPECT, in a large number can be as in this quasi-microorganism, having for the extreme enzyme of exploitation, and biologically active factors, the precursor substance of degradable plastics has the bacteria rhodopsin of development biological computation machine chip potentiality etc.

The research and development of extremely halophilic archaea needs corresponding genetic operating system, but its genetic operating system is also quite deficient at present, the several systems (J Bacteriol 1990, the 172:756-761 that have made up in the neutral pole terminal halophilic archaea; J Biol Chem 1992 267:5829-5843) can only be used for limited several genus, and this has limited the theoretical investigation and the genetically engineered exploitation of this class important microbe to a great extent.Therefore the new genetic operating system of novel strain type of researching and developing extremely halophilic archaea is significant.The extreme microorganism genetic operating system is not only research extreme environment microbial genetics, and the first-selected system of expressing extreme enzyme and extreme microorganism biologically active factors, and this system also has other valuable feature.The structure of extreme halotolerant microorganism hereditary operating system will be the deep development of such extreme microorganism resource, and as the bio-modification of biological nano material purple membrane, the genetic engineering of biodegradable plastic precursor PHA etc. provide first-selected tool system.

PUC pUC is the principal mode of microorganism biological genetic operating system.The gene transformation of microorganism being carried out success must meet the following conditions: physics such as the gene (DNA) that 1) is used to transform must be by transforming such as electricity, and mineral ion is handled, the protoplastis fusion or chemical process import in this organism.2) enter biological intravital foreign gene (DNA) and must be able to be replicated (self-replicating or duplicate as the part of host genome).In actually operating, can make up replicating plasmid vector by gene recombination then by from desiring to be separated the host transformed its wild plasmid, foreign DNA is cloned into the purpose that just can realize well behind the above-mentioned plasmid vector with plasmid replication.3) use one or more selective markers, the conversion physical efficiency is selected from the non-transformed cell group.

Summary of the invention

The purpose of this invention is to provide a kind of extremely halophilic archaea plasmid.

Extremely halophilic archaea plasmid provided by the present invention, name is called pSCM201, derives from extremely halophilic archaea AS7094, has the nucleotide sequence of sequence 3 in the sequence table.

After measured, the 16S rDNA of extremely halophilic archaea AS7094 (sequence 1) and salt box Pseudomonas (Haloarcula sp.) 16S rDNA have 98% homology, its cR sequence (sequence 2) has 99% homology with salt box Pseudomonas (Haloarcula sp.) cR sequence, can affirm that AS7094 is salt box Pseudomonas (Haloarcula sp.).

Sequence 3 is made up of 3463 Nucleotide in the sequence table.Wherein, in the sequence 3 is an open reading frame Orf1 from 5 ' end 90-1289 bit base, and the Orf1 coding has the trans-acting factor Orf1 of the amino acid residue sequence of sequence 4 in the sequence table; In the sequence 3 is second open reading frame Orf2 from 5 ' end 1291-1698 bit base, and the Orf2 coding has the trans-acting factor Orf2 of the amino acid residue sequence of sequence 5 in the sequence table; In the sequence 3 is the 3rd open reading frame Orf3 from 5 ' end 1771-2409 bit base, and the Orf3 coding has the trans-acting factor Orf3 of the amino acid residue sequence of sequence 6 in the sequence table.In the sequence 3 from 5 ' end 1699-1770 bit base, the 2410-89 bit base is the cis-acting elements of plasmid.

The protein that sequence 4 in the sequence table is made up of 399 amino-acid residues, the protein that the sequence 5 in the sequence table is made up of 135 amino-acid residues, the protein that the sequence 6 in the sequence table is made up of 212 amino-acid residues.

PSCM201 is the double-stranded DNA plasmid, and the topology shape is a ring-type, can be used to transform halophilic archaea.Extremely halophilic archaea AS7094 can grow on perfect medium, and bacterium colony is rounded, neat in edge, and 7-10 days bacterium colonies of 37 ℃ of growths are red.

The physical map of plasmid pSCM201 as shown in Figure 1, it common restriction endonuclease sites that comprises has ClaI, Hind III, restriction enzyme sites such as Nco I each one, two Sal I restriction enzyme sites.Wherein, in the sequence 3 from 5 ' end 1-6 bit base is a Hind III restriction enzyme site; In the sequence 3 is Cla I restriction enzyme site from 5 ' end 656-661 bit base; Sequence 3 from 5 ' end 3224-3229 bit base is the NcoI restriction enzyme site; The white 5 ' end 2221-2226 bit base in 5 ' end 1642-1647 bit base and sequence 1 in the sequence 3 is two SalI restriction enzyme sites.Plasmid pSCM201 does not contain Apa I, BamH I, Bgl II, EcoR I, EcoR V, Kpn I, NdeI, Pvu II, Sac II, Sma I, Sph I, common restriction enzyme sites such as Xba I, so these restriction enzyme sites can be used as the multiple clone site of the derivative vector of pSCM201.

Expression vector based on plasmid pSCM201 of the present invention makes up also belongs to protection domain of the present invention as pSCM204 and pSCM206.

Since plasmid pSCM201 can be in halophilic archaea self-replicating, what it provided in assurance duplicates under the complete prerequisite of required element, to wherein introducing other clear and definite function DNA fragment of character, can constitute the recombinant vectors that can transform extremely halophilic archaea or the plasmid vector of deriving.

At the non-coding region introducing escherichia coli plasmid replicon of plasmid pSCM201 and the resistant maker gene that is suitable in intestinal bacteria, screening, be introduced in effective resistance selection gene in the extreme ancient bacterium on this basis, can constitute the E.coli-Halobacteria cloning vector that shuttles back and forth, conveniently in intestinal bacteria, carry out genetic manipulation and in extremely halophilic archaea, carry out genetic analysis and applied research.As the resistant maker gene Amp that between 5 ' end the 2614th to 2703 bit base, introduces escherichia coli plasmid replicon ColE1 ori and be suitable in intestinal bacteria, screening at plasmid pSCM201 ^RAnd multiple clone site, between multiple clone site EcoRI and KpnI, be introduced in effective resistance selection gene M ev in the extreme ancient bacterium ^R, can constitute the E.coli-Halobacteria cloning vector pSCM204 (its physical map as shown in Figure 2) that shuttles back and forth.

PSCM204 contain from pSCM201 complete in extremely halophilic archaea, duplicate required replication origin, i.e. the dna sequence dna pSCM201 ori that obtains by PCR; Contain and in intestinal bacteria, duplicate required replication origin, be i.e. escherichia coli plasmid replicon ColE1 ori; And contain intestinal bacteria and in extremely halophilic archaea the screening transformant resistance selectable marker gene Amp ^RAnd Mev ^R, and be used for cloning site such as the Kpn I that foreign gene inserts, Pst I, NdeI etc.PSCM204 is the effective E.coli-Halobacteria cloning vector that shuttles back and forth, but transformed into escherichia coli and extremely halophilic archaea, and clonal expression foreign gene therein.The stability experiment of pSCM204 in host Haloarcula.hispanica shown this shuttle vectors was grown for 200 generations under the condition that the non-resistant selective pressure exists, the conservation rate of plasmid vector still surpasses 98%.Useful proteins matter provides reliable guarantee to the high stability of pSCM204 in the extremely halophilic archaea for its further construction of expression vector is expressed.

Wherein two open open reading frame (Orf2, Orf3) indoor design primer at pSCM201 comes out whole plasmid amplification, construction strategy by pSCM204 makes up corresponding cloning vector then, is used for studying Orf2, Orf3 and whether is that pSCM201 duplicates is necessary.For example adopt PCR method in the indoor design of Orf2 a pair of primer whole plasmid amplification is come out directly to link on the pUCm-T carrier then, add Mev ^RBe built into pSCM206 (its physical map as shown in Figure 3), this plasmid can be from the function of some aspect research Orf2.

Based on the cloning vector that shuttles back and forth (as pSCM204), introduce suitable promotor in its multiple clone site, can introduce goal gene in the promotor downstream simultaneously, transform corresponding host bacterium (as Haloarcula.hispanica), be induced the target protein that obtains q.s with appropriate condition.As with pSCM201 for the fundamental construction expression vector research purple membrane protein of tool application potential in halophilic archaea at present, also be the research direction of a very attractive.Therefore, make up based on pSCM201 and form various expression vectors all at the row of this patent protection.

Transform resulting microorganism by the extremely halophilic archaea plasmid of the present invention and the plasmid vector of deriving thereof and also belong to protection scope of the present invention.

The extremely halophilic archaea plasmid of the present invention and the plasmid vector of deriving thereof provide tool system for the research and development of extremely halophilic archaea, will play a significant role in the research and development of extremely halophilic archaea.

The present invention will be further described below in conjunction with specific embodiment.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.

Description of drawings

Fig. 1 is the physical map of plasmid pSCM201

Fig. 2 is the physical map of recombinant vectors pSCM204

Fig. 3 is the physical map of recombinant vectors pSCM206

Embodiment

The method of embodiment 1, acquisition plasmid pSCM201

67 strain extremely halophilic archaeas are carried out plasmid generaI investigation, and the result shows contain a miniplasmids, called after pSCM201 in the AS7094 bacterial strain.Conscientiously test making enzyme after the pSCM201 extraction, find that it contains two single endonuclease digestion sites, i.e. HindIII, NcoI.Link after pSCM201 cut with the HindIII enzyme and make the pBluescriptII SK-that same enzyme is cut; Link after the NcoI enzyme is cut and do to check order on the pUCm-T carrier replication form that same enzyme cuts.Sequencing result shows, plasmid pSCM201 has the nucleotide sequence of sequence 3 in the sequence table, wherein, in the sequence 3 is an open reading frame Orf1 from 5 ' end 90-1289 bit base, and the Orf1 coding has the required trans-acting factor of plasmid replication of the amino acid residue sequence of sequence 4 in the sequence table; In the sequence 3 is second open reading frame Orf2 from 5 ' end 1291-1698 bit base, and the Orf2 coding has the required trans-acting factor of plasmid replication of the amino acid residue sequence of sequence 5 in the sequence table; In the sequence 3 is the 3rd open reading frame Orf3 from 5 ' end 1771-2409 bit base, and the Orf3 coding has the required trans-acting factor of plasmid replication of the amino acid residue sequence of sequence 6 in the sequence table; In the sequence 3 from 5 ' end 1699-1770 bit base, 2410-89 bit base be cis-acting elements.This plasmid also comprises each Cla I restriction enzyme site (in the sequence 1 from 5 ' end 656-661 bit base), HindIII (in the sequence 1 from 5 ' end 1-6 bit base) restriction enzyme site, Nco I restriction enzyme site (in the sequence 1 from 5 ' end 3224-3229 bit base); Two SalI restriction enzyme sites (in the sequence 1 in 5 ' end 1642-1647 bit base and sequence 1 from 5 ' end 2221-2226 bit base).

Embodiment 2, based on the structure of the recombinant vectors pSCM204 of plasmid pSCM201

With pSCM201 is template, is that primer carries out pcr amplification under following reaction system and cycling program with orf4F:CTAGATCTTGCCACCCCTATGACAGC and orf4R:GCCTCGAGTGTGCTATCTGATTCCTT.Wherein, reaction system: 10 * PCR buffer, 2.5 μ l, 2.5mM dNTP 2 μ l, 2.5mM Mg ²⁺1.5 μ l, orf4F (10 μ M) 1 μ l, orf4R (10 μ M) 1 μ l, pSCM201 1 μ l, Taq enzyme (5U/ μ l) 0.3 μ l, ddH ₂O15.7 μ l.More than used PCR reaction reagent all available from magnificent company.Cycling program: 94 ℃ of 3min; 94 ℃ of 1min, 57 ℃ of 1min, 72 ℃ of 3.5min, 30 circulations; 72 ℃ of 7min.The PCR product that obtains directly is connected with pUcm-T carrier (giving birth to worker bio-engineering corporation available from Shanghai), simultaneously nervinolin (mevinolin) resistant gene (Mev that Natrinema altunense sp is originated ^RJ Biol Chem 1992,267:5829-5834) the multiple clone site zone of replication form of introducing the pUcm-T carrier be connected with the pSCM201PCR product is as the resistance selectable marker gene in extremely halophilic archaea, the E.coli-Halobacteria of the type that the is applied cloning vector pSCM204 (as shown in Figure 2) that shuttles back and forth.Mev ^RResistant gene derive from the extremely halophilic archaea kind cloning vector pUBP2 that shuttles back and forth relatively commonly used (ProcNatl Acad Sci USA 1990,87:6772-6776).Introducing method is as follows: with EcoRI and KpnI pUBP2 is carried out double digestion with the replication form that is connected with the pUcm-T carrier of pSCM201 PCR product, reclaim the pUBP2 enzyme then and cut Mev in the product ^RResistant gene is connected transformed into escherichia coli JM109 with the replication form of the pUcm-T carrier that is connected with pSCM201 PCR product behind the double digestion.The pSCM204 that builds is transformed and the nearer Haloarcula.hispanica (DSMZ of Institute of Micro-biology) of AS7094 sibship, and (J.Bacteriol 1987,169:1341-1344) to transform employing protoplast transformation method.Plasmid is extracted in the transformant switching back that obtains, and sequencing result shows that the sequence of transformant is correct.Again transform Haloarcula.hispanica by the revolution e. coli jm109 and with the resulting plasmid of revolution e. coli jm109, all can access positive colony.PSCM204 is shown at the stability experiment of Haloarcula.hispanica this shuttle vectors can exist above 200 generations not to be lost under the condition that the non-resistant selective pressure exists.The stability experiment method is as follows: will (contain 5.0g acid hydrolysis casein (Difco) in every liter at the liquid A S-168 substratum that contains nervinolin (5 μ g/ml), 5.0g yeast extract (Difco), 1.0g Sodium Glutamate, 3.0g Trisodium Citrate, 200g NaCl, 20g MgSO ₄.7H ₂O, 2.0g KCl, 0.36g FeCl ₂.4H ₂O, 0.36mg MnCl ₂.4H ₂O, the Haioarcula.hispanica that grows to logarithm latter stage in pH7.2-7.4) are seeded in the liquid A S-168 substratum that does not contain nervinolin continuous passage and cultivate, switching in per 2 days once, with the rate calculations in 10 generations of every day, corotation connects 10 times.At every turn with the thalline dilution that obtains, separate application does not contain and contains the solid AS-168 substratum of nervinolin (5 μ g/ml), the colony number that statistics obtains, to contain colony number that colony number that the solid medium of nervinolin obtains obtains divided by the solid medium that does not contain nervinolin can obtain pSCM204 have a rate in Haloarcula.hispanica, the result shows that pSCM204 200 generations of growing exist rate still to reach 98% in the substratum that does not contain nervinolin, illustrate that this cloning vector is very stable, make up various shuttle expression carriers based on this after this position and lay a good foundation.

The structure of embodiment 3, pSCM206 and application thereof

In order to study the function of Orf2, made up carrier pSCM206 (its physical map as shown in Figure 4), its concrete construction process is as follows: adopt PCR method in the indoor design of Orf1 a pair of primer whole plasmid amplification is come out directly to link then on the pUCm-T carrier, connect Mev again ^RBe built into pSCM206.The PCR primer is that orf135dF:TGCCCGCTGTCTGATTCG and orf135dR:CCAGACGGAACCACCATC carry out pcr amplification under following reaction system and cycling program.Reaction system: 10 * PCR buffer, 2.5 μ l; 2.5mM dNTP 2 μ l; 2.5mM Mg ²⁺1.5 μ l; Orf135dF (10 μ M) 1 μ l; Orf135dR (10 μ M) 1 μ l; PSCM2011 μ l; Taq enzyme (5U/ μ l) 0.3 μ l; DdH ₂O 15.7 μ l.More than used PCR reaction reagent all available from magnificent company.Cycling program: 94 ℃ of 3min; 94 ℃ of 1min, 54 ℃ of 1min, 72 ℃ of 3.5min, 30 circulations; 72 ℃ of 7min.Connect Mev ^RMethod is with embodiment 2.PSCM206 is adopted protoplast transformation method (J.Bacteriol1987,169:1341-1344) transform Haloarcula.hispanica, though obtained transformant, but under the condition that no nervinolin is selected, it is stable that pSCM206 can not show a candle to pSCM204, though show that Orf2 is optional to duplicating of pSCM201, may in the distribution process of plasmid, play an important role.

Sequence table

<160>6

<210>1

<211>1474

<212>DNA

＜213〉salt box Pseudomonas (Haloarcula sp.)

<400>1

attccggttg?atcctgccgg?aggccattgc?catcggagtc?cgatttagcc?atgctagtcg 60

cacgagttca?gactcgtggc?atatagctca?gtaacacgtg?gccaaactac?cctacagacc 120

gcgataacct?cgggaaactg?aggccaatag?cggatataac?tctcaggctg?gagtgccgag 180

agttagaaac?gttccggcgc?tgtaggatgt?ggctgcggcc?gattaggtag?atggtggggt 240

aacggcccac?catgccgata?atcggtacgg?gttgtgagag?caagaacccg?gagacggtat 300

ctgagacaag?ataccgggcc?ctacggggcg?cagcaggcgc?gaaaccttta?cactgcacga 360

cagtgcgata?gggggactcc?gagtgcgagg?gcatatagcc?ctcgcttttc?tgtaccgtaa 420

ggtggtacag?gaacaaggac?tgggcaagac?cggtgccagc?cgccgcggta?ataccggcag 480

tccaagtgat?ggccgatatt?attgggccta?aagcgtccgt?agcttgctgt?gtaagtccat 540

tgggaaatcg?accagctcaa?ctggtcggcg?tccggtggaa?actacacagc?ttggggccga 600

gagactcaac?gggtacgtcc?ggggtaggag?tgaaatcctg?taatcctgga?cggaccacca 660

atggggaaac?cacgttgaga?gaccggaccc?gacagtgagg?gacgaaagcc?agggtctcga 720

accggattag?atacccgggt?agtcctggct?gtaaacaatg?ctcgctaggt?atgtcacgcg 780

ccatgagcac?gtgatgtgcc?gtagtgaaga?cgataagcga?gccgcctggg?aagtacgtcc 840

gcaaggatga?aacttaaagg?aattggcggg?ggagcaccac?aaccggagga?gcccgcggtt 900

tcattggact?caacgccgga?catctcaccg?gtcccgacag?tagtaatgac?ggtcagcttg 960

acgactttac?ttcgacgcta?ctgagaggag?gtgcatggcc?gccgtcagct?cgtaccgtga 1020

ggcgtcctgt?taagtcaggc?aacgagcgag?acccacactt?ctagttgcca?gcaacacccc 1080

tgcggtggtt?gggtacacta?ggaggactgc?cattgctaaa?atggaggaag?gaatgggcaa 1140

cggtaggtca?gtatgccccg?aatggaccgg?gcaacacgcg?ggctacaatg?gctctgacag 1200

tgggatgcaa?cgccgagagg?cggagctaat?ctccaaacgg?agtcgtagtt?cggattgcgg 1260

gctgaaaccc?gcccgcatga?agctggattc?ggtagtaatc?gcgtgtcaga?agcgcgcggt 1320

gaatacgtcc?ctgctccttg?cacacaccgc?ccgtcaaagc?acccgagtgg?ggtccggatg 1380

aggccgtcat?gcgacggtcg?aatctgggct?ccgcaagggg?gcttaagtcg?taacaaggta 1440

gccgtagagg?aatctgcggc?tggatcacct?ccta 1474

<210>2

<211>753

<212>DNA

＜213〉salt box Pseudomonas (Haloarcula sp.)

<400>2

atgccagaac?cagggagtga?agcgatatgg?ctgtggttag?gtacagcggg?catgttcctc 60

ggcatgctct?acttcatcgc?gcgcggctgg?ggtgagaccg?acagtaggcg?tcaaaagttc 120

tacatcgcga?caatactcat?cacggcaatc?gcgttcgtga?attacctcgc?gatggcgctt 180

ggcttcgggt?tgacgatcgt?cgagttcgcc?ggcgaggagc?accccatcta?ctgggcccga 240

tacagtgact?ggttgttcac?gacgccgtta?ctgttgtacg?acctcgggtt?gcttgccggg 300

gcagatcgta?acactatcac?ctcgctcgtc?agcctcgacg?tgctgatgat?cgggaccggg 360

ctggtcgcga?cgctgagcgc?aggaagcggc?gtgctgtcgg?ccggtgcgga?acggctggtc 420

tggtggggca?tcagtaccgc?cttcctgctg?gtcctgctgt?acttcctgtt?cagctcgctg 480

tccggtcggg?tcgcagactt?gcccagtgac?acgcgtagca?ccttcaagac?gctacgaaac 540

ctcgtgaccg?tcgtatggtt?ggtgtacccg?gtgtggtggc?tcatcgggac?cgaggggatc 600

ggcctcgtcg?ggatcggtat?cgagacggcc?ggcttcatgg?tcatcgacct?gaccgccaag 660

gtcggcttcg?gtatcatcct?gctccggagc?cacggcgtgc?tcgacggcgc?ggccgagacg 720

accggaactg?gcgcaacgcc?tgcagacgac?taa 753

<210>3

<211>3463

<212>DNA

＜213〉salt box Pseudomonas (Haloarcuia sp.)

<400>3

aagcttctga?gtttcggggg?gttcggctgt?tgcccccagt?tttcacgggg?tagaggctgt 60

gagaacctac?tgtactgggg?gtgtaataaa?tgaccccccc?ggaaaccacc?ccagttacgc 120

cggaactgga?ccgggagaag?gttcggcccg?aagcacccac?tacgttctac?gatggggacg 180

tacagatacc?cggttatggg?acgccaccgg?aacggtgccg?cgccctgtcg?ccagtgggct 240

tctgcgaggc?gggccacacg?atactcgggc?ggtcgtcgtg?tggcacccgg?tactgtcccg 300

atcactggcg?cgactggtgc?gaggacgcgg?tggtcagcgc?ggtcgcgcga?ctcgccgctt 360

atcggcacgc?ggttgacgga?gcggagaagc?gactaagcca?catcgtagcc?tcaccaccgc 420

aggaccggag?ctactcgaag?cgggcgatgt?gggagacgcg?gagcgaagcc?tacgacgtgc 480

tggaagatgc?gggtgtccgt?ggcggggtgt?cggtgacgca?cccgtaccgg?accaacgagc 540

ggggtgatat?gctgtttgag?acggctgttg?agtccggtga?gattcctgag?gaaaccgggc 600

ggtgggcgtt?cctacgggag?gtttctgagg?actgggagga?cttcacccgg?tatatcgatg 660

ccagcccaca?ctatcacacg?atagcagctg?ccccatcggt?ggaaccggga?gacgcaccgg 720

acgactgggt?ggtggagcgg?attcggacgc?taaagccgtt?ctacttccga?gatactgagg 780

cgtaccgggc?gatggtagcg?ccggtgtact?acacgctcac?ccacggtgcc?gtcgaggacg 840

cgaagcacac?cctgacttac?ttcggtgacg?tgcacccggc?gagcttcgac?ccagaggagg 900

aactgacggc?ggcgatatgg?tcgcggattc?agatagaggc?agagaaggcg?gttaaggaga 960

cgggagaaag?cggcgaggag?gaggcgatag?caggaccggc?ggagtgtcca?gaagacggtt 1020

gtgaggcggc?cactgtggac?gtgtactacc?tcgctgagta?catggatgat?gaggagtggg 1080

ttacgagtgt?gaagtgcgga?gtcggcgggc?gggagaagtg?gcttcgactg?aagggtgtgc 1140

tactctggtg?ggacgaggga?ggggaccggc?cgccgccgtc?agtccagggc?aacgagaaga 1200

agctacgaaa?ctggctagag?atgaaaggcg?aatcggtgac?gcctcggaag?caacaggtat 1260

cgctctcaac?ggcgctgatg?ggtgaatagg?ctattcgtcg?agggcgctgc?tgaagtcggg 1320

tgtttcaccc?ggtgcgtaat?cccggtgaag?catttccccg?tagccgtcga?gagtgtggtc 1380

aagacggccg?tatagagcca?actggtatcg?gtaggtgtcg?cggtattcaa?cagggtcgcc 1440

ctcgaagttc?cagcggggcc?gtgatggtgg?ttccgtctgg?aacatcagtg?catcgagtag 1500

gcgggcgatc?tcgttcggct?cgaagatgtc?ggcgttgttg?atttcgggac?tcgcagcgaa 1560

ctcgatgagt?tcctgaagtg?ccatccgtgc?ccgctgtctg?attcgggact?tcgcgttgta 1620

tcgggactgg?ccggtcagtt?cgtcgacacc?gttcagtaca?tcgcggcggg?agtcggtcag 1680

gaagatattt?tctaccatca?gtctaaccga?gtacctgagt?atctatcaag?ttttcccatg 1740

aaaaactgat?tagcatggct?gttcacagat?atggtacaca?tggcgaccac?agagaacagc 1800

ggcggagtta?gggcatggga?ttcagcgaag?caattcgctg?ttgaccggct?gaaagaggaa 1860

accgaatcgc?ttagtccgag?cgctctggcg?gaggaatacg?gctgctctgg?cgaccacatg 1920

cgccactgcc?ttgcggacct?cgcgaaagag?gaactggtag?agcgcatagg?acacggcgaa 1980

tatacggccg?gagaacaggc?cggagaacag?gttctccaac?acgaagacca?cacagactca 2040

cgtgatgagg?acagcccgga?ggacacggag?gacacgggca?atataggccc?ttctgtggat 2100

gggccagccc?ggtcggagga?ccccgataca?acgggtggaa?gcccggtaga?gattgaggag 2160

gacgagcggg?ccgaggtgga?gctgtccgag?agcgacgagg?aggacggcga?cggcgagcgc 2220

gtcgacgtag?atcgagacgg?cgacggtggc?cgctcggtgg?gcgtctacat?catcgctggg 2280

accgtcctgt?tggtgctggc?cgcgctgtgg?ctctcgatac?aggaccagtc?cgatgagacg 2340

cccgagcagc?ccggtcagga?tgaggaggaa?gaggaggcag?ttgacccgga?tgtgtggggt 2400

gcggagtgat?gcaggaccca?gaaccagaga?acattacggg?aacaaaacag?gtagttcacc 2460

gggttgagca?taacattcac?tgggggtacg?tggccggtgg?tgtcgggctg?ctggctgttg 2520

ccttcgtact?ctacaaactg?ctcgatttag?acggcgaaga?cgatgaaaac?gacatgtcta 2580

gtgtaacgtg?acaggtttta?tgttcccccg?ctcgaaggaa?tcagatagca?cagaaagtcc 2640

gtacacgact?ctcacgagtc?gggaaacgga?tggggagaat?ggaactcccc?atcactgtgc 2700

tgccacacct?atgacagcaa?gcaagcctac?cccaccgagt?ggggagagtg?tttcggacga 2760

gtcggcacag?tacagaaact?tcagtgagga?tttactatac?tacgccctac?agcgctctgc 2820

cgagcgttta?gagggtgaga?tgtgggaaac?ggtcagtcag?gcgtctaacg?gtatcctgag 2880

ccgtgagcag?taccagcgga?caatcgaggc?gttctacgat?ttcggggacg?tattggagtt 2940

tgtggaccgc?tacacccacg?agaagcagca?agtagccagt?gatgattcaa?tcaatcaatc 3000

agcggcgggt?actaacaccg?agcctgctga?aggagggtgt?agtaactcag?acacgtgaac 3060

gaagtgacgg?agaagggccg?tcaccccaga?acggcttggc?cggcacgttc?tgtactcagc 3120

ccttctcact?ccggcgacaa?aggctttcgg?cctgaatcga?cccggctggt?ttatcgctgt 3180

tcgttcgtcg?agatcggcgt?cgaggagctg?gtcgagcgat?gacccatggc?taccgttgcg 3240

gcctctccct?gcggttgcgg?tggcaccagc?gtcccgagcg?gcgcgagaac?acccgtctcg 3300

gagcgagcgg?agcgagcgag?aatacggcgt?ttcttggagc?gccgggaggg?ttcccgttac 3360

ccacctgagc?aaccggcgaa?ctgatgccag?tctaccccgc?agtacaggac?cctgcctact 3420

acgccccttc?gcggggtcaa?tacggccaga?atcgggcagt?aga 3463

<210>4

<211>399

<212>PRT

＜213〉salt box Pseudomonas (Haloarcula sp.)

<400>4

Met?Thr?Pro?Pro?Glu?Thr?Thr?Pro?Val?Thr?Pro?Glu?Leu?Asp?Arg?Glu

1 5 10 15

Lys?Val?Arg?Pro?Glu?Ala?Pro?Thr?Thr?Phe?Tyr?Asp?Gly?Asp?Val?Gln

20 25 30

Ile?Pro?Gly?Tyr?Gly?Thr?Pro?Pro?Glu?Arg?Cys?Arg?Ala?Leu?Ser?Pro

35 40 45

Val?Gly?Phe?Cys?Glu?Ala?Gly?His?Thr?Ile?Leu?Gly?Arg?Ser?Ser?Cys

50 55 60

Gly?Thr?Arg?Tyr?Cys?Pro?Asp?His?Trp?Arg?Asp?Trp?Cys?Glu?Asp?Ala

65 70 75 80

Val?Val?Ser?Ala?Val?Ala?Arg?Leu?Ala?Ala?Tyr?Arg?His?Ala?Val?Asp

85 90 95

Gly?Ala?Glu?Lys?Arg?Leu?Ser?His?Ile?Val?Ala?Ser?Pro?Pro?Gln?Asp

100 105 110

Arg?Ser?Tyr?Ser?Lys?Arg?Ala?Met?Trp?Glu?Thr?Arg?Ser?Glu?Ala?Thr

115 120 125

Thr?Cys?Trp?Lys?Met?Arg?Val?Ser?Val?Ala?Gly?Cys?Arg?Val?Thr?His

130 135 140

Pro?Tyr?Arg?Thr?Asn?Glu?Arg?Gly?Asp?Met?Leu?Phe?Glu?Thr?Ala?Val

145 150 155 160

Glu?Ser?Gly?Glu?Ile?Pro?Glu?Glu?Thr?Gly?Arg?Trp?Ala?Phe?Leu?Arg

165 170 175

Glu?Val?Ser?Glu?Asp?Trp?Glu?Asp?Phe?Thr?Arg?Tyr?Ile?Asp?Ala?Ser

180 185 190

Pro?His?Tyr?His?Thr?Ile?Ala?Ala?Ala?Pro?Ser?Val?Glu?Pro?Gly?Asp

195 200 205

Ala?Pro?Asp?Asp?Trp?Val?Val?Glu?Arg?Ile?Arg?Thr?Leu?Lys?Pro?Phe

210 215 220

Tyr?Phe?Arg?Asp?Thr?Glu?Ala?Tyr?Arg?Ala?Met?Val?Ala?Pro?Val?Tyr

225 230 235 240

Tyr?Thr?Leu?Thr?His?Gly?Ala?Val?Glu?Asp?Ala?Lys?His?Thr?Leu?Thr

245 250 255

Tyr?Phe?Gly?Asp?Val?His?Pro?Ala?Ser?Phe?Asp?Pro?Glu?Glu?Glu?Leu

260 265 270

Thr?Ala?Ala?Ile?Trp?Ser?Arg?Ile?Gln?Ile?Glu?Ala?Glu?Lys?Ala?Val

275 280 285

Lys?Glu?Thr?Gly?Glu?Ser?Gly?Glu?Glu?Glu?Ala?Ile?Ala?Gly?Pro?Ala

290 295 300

Glu?Cys?Pro?Glu?Asp?Gly?Cys?Glu?Ala?Ala?Thr?Val?Asp?Val?Tyr?Tyr

305 310 315 320

Leu?Ala?Glu?Tyr?Met?Asp?Asp?Glu?Glu?Trp?Val?Thr?Ser?Val?Lys?Cys

325 330 335

Gly?Val?Gly?Gly?Arg?Glu?Lys?Trp?Leu?Arg?Leu?Lys?Gly?Val?Leu?Leu

340 345 350

Trp?Trp?Asp?Glu?Gly?Gly?Asp?Arg?Pro?Pro?Pro?Ser?Val?Gln?Gly?Asn

355 360 365

Glu?Lys?Lys?Leu?Arg?Asn?Trp?Leu?Glu?Met?Lys?Gly?Glu?Ser?Val?Thr

370 375 380

Pro?Arg?Lys?Gln?Gln?Val?Ser?Leu?Ser?Thr?Ala?Leu?Met?Gly?Glu

385 390 395

<210>5

<211>135

<212>PRT

＜213〉salt box Pseudomonas (Haloarcula sp.)

<400>5

Met?Val?Glu?Asn?Ile?Phe?Leu?Thr?Asp?Ser?Arg?Arg?Asp?Val?Leu?Asn

1 5 10 15

Gly?Val?Asp?Glu?Leu?Thr?Gly?Gln?Ser?Arg?Tyr?Asn?Ala?Lys?Ser?Arg

20 25 30

Ile?Arg?Gln?Arg?Ala?Arg?Met?Ala?Leu?Gln?Glu?Leu?Ile?Glu?Phe?Ala

35 40 45

Ala?Ser?Pro?Glu?Ile?Asn?Asn?Ala?Asp?Ile?Phe?Glu?Pro?Asn?Glu?Ile

50 55 60

Ala?Arg?Leu?Leu?Asp?Ala?Leu?Met?Phe?Gln?Thr?Glu?Pro?Pro?Ser?Arg

65 70 75 80

Pro?Arg?Trp?Asn?Phe?Glu?Gly?Asp?Pro?Val?Glu?Tyr?Arg?Asp?Thr?Tyr

85 90 95

Arg?Tyr?Gln?Leu?Ala?Leu?Tyr?Gly?Arg?Leu?Asp?His?Thr?Leu?Asp?Gly

100 105 110

Tyr?Gly?Glu?Met?Leu?His?Arg?Asp?Tyr?Ala?Pro?Gly?Glu?Thr?Pro?Asp

115 120 125

Phe?Ser?Ser?Ala?Leu?Asp?Glu

130 135

<210>6

<211>212

<212>PRT

＜213〉salt box Pseudomonas (Haloarcula sp.)

<400>6

Met?Val?His?Met?Ala?Thr?Thr?Glu?Asn?Ser?Gly?Gly?Val?Arg?Ala?Trp

1 5 10 15

Asp?Ser?Ala?Lys?Gln?Phe?Ala?Val?Asp?Arg?Leu?Lys?Glu?Glu?Thr?Glu

20 25 30

Ser?Leu?Ser?Pro?Ser?Ala?Leu?Ala?Glu?Glu?Tyr?Gly?Cys?Ser?Gly?Asp

35 40 45

His?Met?Arg?His?Cys?Leu?Ala?Asp?Leu?Ala?Lys?Glu?Glu?Leu?Val?Glu

50 55 60

Arg?Ile?Gly?His?Gly?Glu?Tyr?Thr?Ala?Gly?Glu?Gln?Ala?Gly?Glu?Gln

65 70 75 80

Val?Leu?Gln?His?Glu?Asp?His?Thr?Asp?Ser?Arg?Asp?Glu?Asp?Ser?Pro

85 90 95

Glu?Asp?Thr?Glu?Asp?Thr?Gly?Asn?Ile?Gly?Pro?Ser?Val?Asp?Gly?Pro

100 105 110

Ala?Arg?Ser?Glu?Asp?Pro?Asp?Thr?Thr?Gly?Gly?Ser?Pro?Val?Glu?Ile

115 120 125

Glu?Glu?Asp?Glu?Arg?Ala?Glu?Val?Glu?Leu?Ser?Glu?Ser?Asp?Glu?Glu

130 135 140

Asp?Gly?Asp?Gly?Glu?Arg?Val?Asp?Val?Asp?Arg?Asp?Gly?Asp?Gly?Gly

145 150 155 160

Arg?Ser?Val?Gly?Val?Tyr?Ile?Ile?Ala?Gly?Thr?Val?Leu?Leu?Val?Leu

165 170 175

Ala?Ala?Leu?Trp?Leu?Ser?Ile?Gln?Asp?Gln?Ser?Asp?Glu?Thr?Pro?Glu

180 185 190

Gln?Pro?Gly?Gln?Asp?Glu?Glu?Glu?Glu?Glu?Ala?Val?Asp?Pro?Asp?Val

195 200 205

Trp?Gly?Ala?Glu

210

Claims (6)

1, a kind of extremely halophilic archaea plasmid, it has the nucleotide sequence of sequence 3 in the sequence table.

2, plasmid according to claim 1 is characterized in that: encoding from 5 ' end 90-1289 bit base in the described sequence 3 has the trans-acting factor of the amino acid residue sequence of sequence 4 in the sequence table; Encoding from 5 ' end 1291-1698 bit base in the sequence 3 has the trans-acting factor of the amino acid residue sequence of sequence 5 in the sequence table; Encoding from 5 ' end 1771-2409 bit base in the sequence 3 has the trans-acting factor of the amino acid residue sequence of sequence 6 in the sequence table; In the sequence 3 from 5 ' end 1699-1770 bit base, the 2410-89 bit base is cis-acting elements.

3, based on the expression vector of the described extremely halophilic archaea plasmid construction of claim 1.

4, expression vector according to claim 3 is characterized in that: described carrier is pSCM204.

5, expression vector according to claim 3 is characterized in that: described carrier is pSCM206.

6, transform the microorganism that obtains by the described plasmid of claim 1-5.

Images