CN102220350B - Method for expressing resveratrol stilbene synthase and preparing resveratrol by utilizing insect system - Google Patents
Method for expressing resveratrol stilbene synthase and preparing resveratrol by utilizing insect system Download PDFInfo
- Publication number
- CN102220350B CN102220350B CN2010101480760A CN201010148076A CN102220350B CN 102220350 B CN102220350 B CN 102220350B CN 2010101480760 A CN2010101480760 A CN 2010101480760A CN 201010148076 A CN201010148076 A CN 201010148076A CN 102220350 B CN102220350 B CN 102220350B
- Authority
- CN
- China
- Prior art keywords
- resveratrol
- trans
- stilbene synthase
- obtains
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/52—Improvements relating to the production of bulk chemicals using catalysts, e.g. selective catalysts
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention relates to a method for obtaining resveratrol stilbene synthase in an insect expression system. The method comprises the following steps of: adopting the Bac-to-Bac rhabdovirus expression system as well as the mode of replacing thirty basic groups at the end of resveratrol stilbene synthase gene5'with thirty basic groups at the end of rhabdovirus polyhedrosis gene 5'of a silkworm so as to enhance the high expression of resveratrol stilbene synthase genes in the insect system. The expression products of the resveratrol stilbene synthase are applied to the biotransformation of the resveratrol after purification. The technical scheme of the invention not only overcomes the problems of the chemical synthesis technology as well as the problem of low activity of obtained products of a prokaryotic expression system, achieves simple operation process and thorough utilization of pericarp wastes, conforms to the low carbon economic concept, and realizes industrialized production to meet market demand, thus having broader market prospect.
Description
Technical field
The present invention relates to bioengineering field; Relate in particular to a kind of trans-resveratrol stilbene synthase of expressing and prepare the method for trans-resveratrol from insect expression system; Promptly utilizing the trans-resveratrol synthetic key enzyme (stilbene synthase) of insect system expression, is the method for substrate at external synthesizing resveratrol with the extracting solution of Watermelon rind or Hami melon skin or Pericarpium Vitis viniferae etc.
Background technology
The research of trans-resveratrol pharmaceutical use more and more receives the favor of Chinese scholars; Jang etc. have carried out series report to trans-resveratrol in the restraining effect that the starting of cancer, promotion and developmental stage show on the Science magazine, thereby make trans-resveratrol become a research focus in cancer chemoprophylaxis and chemotherapy field.
In vitro tests confirms that trans-resveratrol can suppress the expression of platelet function and endotheliocyte TF, thereby reduces thrombosis.In vitro tests also confirms trans-resveratrol owing to suppressed the synthetic and thrombocyte calcium channel of eicosanoid, thereby has suppressed by thromboxane, ADP and collagen-induced platelet aggregation.In bringing out the endothelium source property medium of cardiovascular disease, 21 amino acid whose ET-1s 21 (ET21) are important molecules in advance.Trans-resveratrol has come to light and can be used as the antagonist of ET21, can antagonism ET21 to the lethal effect of rat, and can suppress by the elevation of blood pressure due to the ET21.In the rabbit model of hypercholesterolemia, trans-resveratrol can reduce blood plasma ET21 level, and remarkable elevation of NO level.These results of study show that trans-resveratrols can improve inner skin cell function, also are one of mechanism of the trans-resveratrol cardiovascular protection effect of bringing into play non-alcohol dependence.
Investigation back such as Orgogozo finds, the probability that the elderly who often drinks red wine suffers from senile dementia significantly descends, and infers that red wine has neuroprotective.Afterwards; A large amount of experiment confirm trans-resveratrols are essential substance of performance neuroprotective in the red wine; Discover that trans-resveratrol can identify kinases and neurocyte, take in trans-resveratrol through wine; For the elderly's Degenerative disease, prevention and therapeutic action are preferably all arranged like parkinsonism, dementia, rheumatism.
Poly-hydroxy stilbene class material mostly has anti-oxidant, anti-radical action.Research proof, that trans-resveratrol has is anti-oxidant, Green Tea Extract and influence the pharmacological action of arachidonic acid metabolism.This also is one of its important mechanisms with multi-biological effect.There are some researches show that trans-resveratrol can significantly suppress the generation of DNA in hepatomicrosome, brain mitochondria and the synaptosome oxidative damage process, and diseases such as viral hepatitis, Parkinson's disease, alzheimer's disease are had good preventive and therapeutic effect.
Trans-resveratrol and polydatin have very strong restraining effect to lipid peroxidation, can reduce the lipid of serum and liver, reduce MDA accumulation in vivo, and the protection liver is without prejudice.In addition, trans-resveratrol can also make stellate cell be still in the G1 phase, thereby help suppressing the formation of hepatic fibrosis through the expression of selectivity downward modulation cyclin cyclinD1.
In sum, trans-resveratrol has the bio-pharmacology activity that many-side is beneficial to man healthy, makes it be widely used in fields such as medicine, healthcare products, makeup and foodstuff additive.Its treatment and prophylactic effect at aspects such as tumour, cardiovascular and cerebrovascular diseases, dementia, viral hepatitis, inflammatory diseases also more and more is familiar with by people, and its potential applicability in clinical practice is wide, is expected to become a kind of newtype drug of preventing and treating multiple disease.Yet the trans-resveratrol market price is very expensive, and is not preferably most of people and utilizes.
The acquisition of trans-resveratrol can obtain through chemical synthesis; Yet existing chemical synthesis process; The cis-trans isomerism selectivity that all exists product like Wittig method and Wittig-Horner method, Perkin reaction method, Heck reaction method etc. is not high; Defectives such as yield is low, and the by-product of generation is difficult to remove, and the synthetic route step is various; The target protein biological activity that general prokaryotic expression carrier produces in biosynthesizing is extremely low or lifeless matter is active, and plant expression system generally yields poorly, and the cycle is long, is difficult to large scale investment production, more is difficult to satisfy market demand; And yeast and animal expression system production medicine cost are high, and output is extremely low, also has identical problem.
The Bac-to-Bac baculovirus expression system be a kind of in recent years development rapidly efficiently, novel eukaryotic expression system easily.Can easily foreign gene be inserted on the baculovirus shuttle vectors through site-specific swivel base; Extract the reorganization Bacmid contain foreign gene then, it is transfected into the recombinant virus that insect cell can obtain to contain foreign gene is used to express target protein.The Bac-to-Bac baculovirus expression system finds broad application in each field, receives extensive concern.
The Bac-to-Bac baculovirus expression system is through years of development; Differentiated towards autographa california bar state virus (Autographa californica multiple nuclear polyhedrosis virus; AcMNPV), silkworm baculovirus (Bombyxmori nuclear polyhedrosis virus; BmNPV) and bollworm baculovirus (Helicoverpa armigera nuclearpolyhedrosis virus, 3 sub-systems HaNPV).The Bac-to-Bac system development of AcMNPV the earliest, study also the most deep, very big to the influence on development of other two systems.In recent years, the Application of B ac-to-Bac of Invitrogen company strategy has been developed the expression system towards AcMNPV.In this system, Bacmid includes the target site (mini-attTn7) of mini2F replicon, kalamycin resistance selection markers and bacterial transposon Tn7 and the part dna fragmentation of coding beta-galactosidase α peptide.
Bacmid can the picture element grain is the same duplicates in E.coli; Again can be as the virus infected insect cell; Donor plasmid pFastBac contain qingfengmeisu qiong resistant gene (Gen+) and Tn7 about two arm sequences; Be the promotor of polyhedrin between the two arm sequences, downstream are the PolyA site of MCS, SV40 successively.The donor plasmid that will contain foreign gene transforms DH10Bac competent cell (this cell contains baculovirus shuttle vectors, Kanr and replicon and LacZ peptide section encoding sox); Foreign gene in the donor plasmid is under the transposase effect of helper plasmid coding; Be inserted in the baculovirus genome through swivel base, destroyed the expression of LacZ.Through containing the culture plate screening of kantlex, qingfengmeisu qiong, tsiklomitsin and X-gal, the Bacmid of reorganization (being recombinant virus genomes) transformant bacterium colony is white in color, and is blue but not reorganization Bacmid transforms bacterium colony.Extract Bacmid DNA from the white colony culture, can obtain recombinant virus with lipid mediated method transfection insect cell.
The Bac-to-Bac baculovirus expression system has many-sided advantage, and the recombinant protein that it produced has folding and glycosylation, and its BA, antigenicity and immunogenicity are all very similar with native protein; Has higher expression of recombinant proteins level; Can hold big foreign DNA inserts; Can express a plurality of foreign genes simultaneously; Can express some prokaryotic systems large molecular weight protein beyond expression of words in solubility ground; Be prone to cultivate and growth safety etc.These are had laid a good foundation for further studying BA.
At present, the exploitation baculovirus during as expression vector, using maximum is with the polyhedron gene deletion, is substituted by the external source goal gene, utilizes polyhedron strong promoter drive expression of exogenous gene.Consequent recombinant virus can not form polyhedron, and recombinant virus must be inoculated silkworm through the mode of percutaneous injection, could realize the effective infection of virus and the expression of external source goal gene.Silkworm inoculated with subcutaneous injections not only technical requirements is high, need prevention of bacterial to infect, and the inoculation working strength is big, and inefficiency even the personnel of skilled operation also are difficult to accomplish large-scale inoculation at short notice, tends to miss the best moment of virus inoculation.
Bac-to-Bac system and traditional rhabdovirus expression vector system (baculovirus expression vector system BEVS) compares, and has following three advantages at least:
● shorten recombinant virus greatly and made up the required time.The Bac-to-Bac baculovirus expression system only need make up and the purification of Recombinant baculovirus less than the time in 2 weeks, even and if the personnel that utilize traditional method to be skilled in technique also need 4-6 week even longer time could obtain recombinant baculovirus.
● do not need the loaded down with trivial details plaque analysis of tradition to come purification of Recombinant virus, the swivel base rate is high, and the purifying rate reaches 100%.Reason is that recombinant virus dna produces in bacterium, can not have the problem of wild-type and non-recombinant type virus crossed contamination according to bacterial plaque dithering (blue hickie screening).
● can fast and separate a plurality of recombinant baculovirus simultaneously, and be suitable for structure or functional study that protein variants is expressed.
In insect baculovirus expression system, have more meliority with baculovirus expression vector system.Utilize silkworm expression external source recombinant protein not only to have cheapness, convenience, advantage efficiently, and the translation post-treatment is also similar with native protein.3 couples of silkworm BmN of selection microcarrier Cytodex such as Deng Xiaozhao cell carries out high-density culture, and its egfp expression amount is 3 times with the static cultivation of square vase, detects through the ELISA method and finds that the HBeAg titre reaches 1: 32000 in the cell culture fluid; Li Hui etc. utilize Bac-to-Bac in insect cell expression system, to give expression to people FGF29 recombinant protein; Duan Yu etc. utilize baculovirus vector in silkworm larva, to express the solubility secretor type recombinant human insulin-like growth factor 21 (rhIGF21) of BA.Other also just like recombination human acidic and Prostatropin (aFGF, bFGF), people's interior cutaneous vessel growth factor, human growth hormone etc. all successfully obtain expressing in silkworm, and all have very high biological activity.Motohashi etc. have successfully made up BmNPV shuttle vectors and intestinal bacteria DH10Bac transformant, thereby make BmNPV shuttle vectors system become feasible first.Miu Yungen etc. use this principle, have successfully made up the recombinant baculovirus rBacmid/BmNPV/Flag that contains spider silk gene, and spider silk fibroin all obtains expressing in silkworm BmN cell and silkworm larva.This novel Bac-to-Bac/BmNPV baculovirus expression system of application such as Yue Wanfu makes Mn-SOD in silkworm larva, efficiently express, and for producing superoxide-dismutase (SOD) on producing good basis is provided.
Summary of the invention
In order to overcome a difficult problem that is run in existing chemosynthesis and the above-mentioned biosynthesizing of mentioning; An object of the present invention is to use the insect expression vector and carry out the production of trans-resveratrol stilbene synthase; Utilize the extracting solution of melon and fruit peel; Carry out the zymetology reaction external, and then preparation is from the veratryl alcohol raw product.Can obtain highly active purpose product, can reduce cost again, be produced on a large scale, with meeting the market requirement.The present invention utilizes the Bac-to-Bac baculovirus expression system to efficiently express trans-resveratrol synthetic key enzyme, and separation and purification, makes it under vitro conditions, with substrate catalyzed reaction take place fully, to obtain the purpose product.
For solving its technical problem; The present invention utilizes insect expression system; 30 bases with trans-resveratrol stilbene synthase gene 5 ' end replace with 30 bases of silkworm baculovirus polyhedrosis gene 5 ' end simultaneously, and adopt following technical scheme to make trans-resveratrol stilbene synthase:
1) obtains trans-resveratrol stilbene synthase (STS) gene (SEQ ID No 1) through RT-PCR from the grape tissue; And adding BamH I restriction enzyme site at its 5 ' end, 3 ' end adds Sal I restriction enzyme site, obtains recombination; Wherein, employed upstream primer: 5 '-GGAAGGATCCATGCCGAATTATTCATACACCCCCACCATCCAACGTGCCAAGGGTC CGGC and downstream primer: 5 '-GGGCGTCGACTTAATTTGTAACCATAGC;
2) behind BamH I and Sal I double digestion, be connected recombination and obtain reorganization pFastBac HTA-llcjy plasmid, Bacmid DNA with pFastBac HTA plasmid vector;
3) transform DH 10Bac competent escherichia coli cell;
4) (contain kantlex kanamycin, Kan through blue hickie screening; Qingfengmeisu qiong gentamicin, Gen; Tsiklomitsin tetracycline, the solid medium of Tet), picking contains the white colony of the Bacmid that recombinates, extracts reorganization Bacmid DNA;
5) extract reorganization Bacmid DNA, use the liposome mediated-method transfection insect cell, obtain recombinant virus (China Committee for Culture Collection of Microorganisms common micro-organisms center, CGMCC, deposit number CGMCC3673);
6) evaluation of recombinant virus and a large amount of amplification;
7) recombinant virus inoculation silkworm pupa, 28 ℃ ± 2 ℃ were reacted 5 to 7 days, promptly obtained the engineering silkworm chrysalis of great expression trans-resveratrol stilbene synthase;
8) purifying obtains reorganization trans-resveratrol stilbene synthase after the homogenate, and silkworm chrysalis is with the mixed back homogenate by weight 1: 1 of 0.85wt% saline water, and repeatedly centrifugal then back is with obtaining reorganization trans-resveratrol stilbene synthase (SEQ ID No2) after G150 molecular sieve purification and the desalination.
The trans-resveratrol stilbene synthase that makes is used for the preparation of trans-resveratrol, and is specific as follows:
1) under 30 ℃,, obtains reaction mixture with the extracting solution of Watermelon rind or Hami melon skin or Pericarpium Vitis viniferae and Semen Vitis viniferae reaction 6～8 hours.
2) reaction mixture is used macroporous resin purification, uses semipolar particle diameter to carry out enrichment at the macroporous resin DM-130 of 0.30～1.25mm, under normal temperature condition; Using massfraction is that 60% ethanol is made strippant, with the flow velocity of 2.0mL/min the trans-resveratrol that has adsorbed sample is carried out wash-out, collects elutriant; The elutriant that obtains concentrates through rotary evaporation in vacuo; Remove organic solvent, and lyophilize, the trans-resveratrol raw product obtained.
The beneficial effect that technical scheme of the present invention realizes:
The present invention is utilized in and obtains trans-resveratrol stilbene synthase in the insect expression system, and this stilbene synthase that utilizes purifying to obtain then obtains trans-resveratrol through transforming.Technical scheme one of the present invention is to have overcome existing problem on the chemical synthesising technology, as: synthesis step is numerous and diverse, and by product is difficult to remove, and the product recovery is not high, has cis-trans-isomer and can not directly be problems such as the mankind are utilized; The 2nd, overcome the active low problem of prokaryotic expression system products therefrom, engineering cost problem height that yeast expression system is produced and plant expression system are produced the problems such as long, low transfection efficiency of cycle of medicine.Its operating process is simple relatively, makes full use of the pericarp waste, meets the low-carbon economy theory, can combine industrialization production to satisfy the needs in market, and comparatively vast market prospect is arranged.
Description of drawings
Fig. 1 is the PCR product electrophorogram of RT-PCR acquisition trans-resveratrol stilbene synthase gene, and 1 is the 250bp dna marker, and 2 is PCR molecular weight of product 1.2kb.
Embodiment
Technical scheme of the present invention combines following accompanying drawing to describe in detail as follows.
The reagent that the present invention is used is not if clearly indicate, then all available from Sigma-aldrich (Sigma-Aldrich).
Experimental example 1: the acquisition of trans-resveratrol stilbene synthase gene.
With the grape tender shoots is material, extracts total RNA with the Trizol method, and Oligo (dT18) obtains cDNA for the primer rt, and carries out RT-PCR amplification trans-resveratrol stilbene synthase gene, and primer is following:
Upstream primer: 5 '-GGAAGGATCCATGCCGAATTATTCATACACCCCCACCATCCAACGTGCCAAGGGTC C GGC;
Downstream primer: 5 '-GGGCGTCGACTTAATTTGTAACCATAGC.
The PCR reaction system is:
ddH
2O 20μL
10 * PCR damping fluid
2.5μL
(25mmol/L?MgCl
2)
2.5mmol/L?dNTP 0.5μL
Primer?1 0.5μL
Primer?2 0.5μL
Taq polysaccharase 0.5 μ L
CDNA template 0.5 μ L
Total 25μL
The response procedures of PCR is:
94 ℃ of preparatory sex change 5min
72℃ 10min
Be stored in 4 ℃ at last.
Purified pcr product promptly obtains the trans-resveratrol stilbene synthase gene, and the about 1.2kb of purpose clip size sees Fig. 1.
The preparation of the shaft-like shape virus of embodiment 2 recombinant silkworms
1.pFast the double digestion of HTA and purified pcr product
In aseptic Eppendorf pipe, add successively:
10 * damping fluid, 5 μ L
pFastBac?HTA 42.5μL
BamH?I 1.5μL
Sal?I 1μL
Total 50μL
10 * damping fluid, 5 μ L
PCR product 42.5 μ L behind the purifying
BamH?I 1.5μL
Sal?I 1μL
Total 50μL
Subsequent use behind 37 ℃ of incubation 4h.
2. enzyme is cut the product processing
Reaction system behind the double digestion, 70 ℃ of water-bath 10min deactivation restriction enzymes.1% gel electrophoresis, rubber tapping is reclaimed the PCR enzyme and is cut back small segment and the big fragment of pFastBac HTA carrier respectively.Utilize glue to reclaim test kit purifying and recovering respectively.
3. ligation
The PCR product of purifying is connected with pET-28a, and reaction conditions is following:
2 * ligase enzyme damping fluid, 5 μ L
The PCR product 3 μ L that reclaim
pFastBac?HTA 1μL
Total 10μL
4 ℃ of connections are spent the night.
4. connect the conversion of product
1) get 5 μ L recombinant plasmid pFastBac HTA-llcjy, be added in the 200 μ L BmDH10Bac competent cell suspensions, mixing is placed 30min on ice gently;
2) 42 ℃ of water-bath heat shock 45sec take out rapidly and put cooled on ice 3-5min;
3) add the LB liquid nutrient medium (not containing microbiotic) of 37 ℃ of preheatings of 1mL, 37 ℃ of water-bath 4h behind the mixing make the bacterium state that restore normal growth;
4) will transform the good centrifugal 10min of bacterium liquid 4000rpm, abandon the 1mL supernatant, and precipitate and get about 200 μ L nutrient solutions after resuspended.
5) get 100 times of 20 μ L bacterium liquid dilutions; Add 5 μ L X-gal and 5 μ L IPTG mixings then; Get bacterium liquid 100-200 μ L and coat on the LB flat board (containing Tet, Gen and Kan), 37 ℃ of lucifuges that face up are placed 30min, treat that bacterium liquid is absorbed the back by substratum fully and is inverted lucifuge cultivation 48h.
5. a small amount of preparation of reorganization Bacmid
1) get the 1.5mL nutrient solution respectively and pour in the 1.5mL Eppendorf pipe, 4 ℃, 14, the centrifugal 1min of 000rpm;
2) abandon most supernatant, bacterial sediment is resuspended in the 300 μ L solution I of precooling, with the piping and druming gently repeatedly of imbibition rifle;
3) add freshly prepared solution II 300 μ L, piping and druming makes its mixing gently;
4) slowly adding 300 μ L pH values is 5.5 liquor kalii acetici, and the limit edged is mixing gently, ice bath 5-10min;
5) under 4 ℃, 14, the centrifugal 10min of 000rpm;
6) supernatant is transferred in the new Eppendorf pipe gently, added 800 μ L Virahols, and be inverted repeatedly gently, make the abundant mixing of liquid, then ice bath 5-10min.Room temperature, 14, the centrifugal 15min of 000rpm;
7) carefully remove supernatant, add the ethanol of 500 μ L 70%, the Eppendorf pipe is inverted several times repeatedly gently, make the abundant mixing of liquid;
8) at room temperature 14, the centrifugal 5min of 000rpm makes reorganization Bacmid DNA thorough washing and deposition.Repeat the 10-11 step if necessary.
9) supernatant is fully removed and the careful in case dissolving once again of reorganization Bacmid DNA is at room temperature placed 5-10min with the DNA that is settled out and dried.Must guard against overdrying.
10) will recombinate that to be dissolved in 40 μ L pH values once more be among 1 * TE Buffer of 8.0, to avoid acutely shaking in case dna break to Bacmid DNA.Allow to jiggle the DNA that is positioned at Eppendorf pipe bottom is fully dissolved.
11) will recombinate Bacmid DNA through liposome transfection in silkworm Bm5 cell.
12) etc. after the cell morbidity, the cultivation recombinant virus that goes down to posterity, and collect subsequent use.
The inoculation of experimental example 3 recombinant viruses and the purifying of recombinase
1. inoculation
As object of inoculation, silkworm chrysalis epidermis (70% alcohol, edible ethanol) sterilization is by every about 100pfu recombinant virus percutaneous puncture-inoculation with 3 age in days pupas.Under peace and quiet condition, to place 5-7 days for 28 ℃, after the quick-frozen of results silkworm chrysalis ,-20 ℃ store for future use.
2. purification of Recombinant enzyme
1) silkworm chrysalis homogenate
A) the raw material silkworm chrysalis thaws at 4 ℃ (about 30min), and is mixed by weight 1: 1 with 0.85% saline water; Homogenate, the time, to be that 9min is even evenly got final product to slurries are careful;
2) low-speed centrifugal (using the R10A3 rotary head) is followed successively by:
B) homogenate is added in the 500ml centrifuge tube, trim is put into whizzer with the R10A3 rotary head, and the centrifugal 30min of 3000rpm gets supernatant, carefully discards grease;
C) the 3000rpm centrifuged supernatant is poured in the new 500ml centrifuge tube, trim, the centrifugal 30min of 6000rpm gets supernatant, abandons grease;
D) take out the R10A3 rotary head, tip upside down on the towel after the wiping;
The extraction of experimental example 4 pericarp juices
After the pericarp chopping, break into pasty state with medicinal herb grinder, with 4 layers of filtered through gauze, supernatant is juice extraction liquid behind the centrifugal 10min of filtrating 12000rpm.
Experimental example 5 utilizes recombinase to produce trans-resveratrol
First enzyme liquid in the instance 3 and instance 4 mesocarp extracting solutions (content of 4-coumaric acyl coenzyme A is greater than 6 μ g/mL in the extracting solution) by 1: 6 volume ratio, reacted 6～8 hours down in 30 ℃, collected reaction mixture.
The purifying of trans-resveratrol in experimental example 6 reaction mixtures
Semipolar particle diameter carries out enrichment at the macroporous resin DM-130 of 0.30～1.25mm, and under normal temperature condition, using massfraction is that 60% ethanol is made strippant; Flow velocity with 2.0mL/min carries out wash-out to the trans-resveratrol that has adsorbed sample, collects elutriant, and the elutriant of acquisition concentrates through rotary evaporation in vacuo; Remove organic solvent, and lyophilize, the trans-resveratrol product obtained; With its content of high effective liquid chromatography for measuring, the trans-resveratrol amount is not less than 70% in the product.
Sequence table
< 110>Shanghai Ke Ai Bioisystech Co., Ltd
< 120>utilize insect system expression trans-resveratrol stilbene synthase and the method for preparing trans-resveratrol
<130>?MKA.HF.9001
<160>?2
<170>?PatentIn?version?3.3
<210>?SEQ?ID?No?1
<211>?1179
<212>?DNA
< 213>trans-resveratrol stilbene synthase gene
<400>?1
atgccgaatt?attcatacac?ccccaccatc?caacgtgcca?agggtccggc?cactatccta60
gccattggca?cagctactcc?tgaccactgt?gtctaccagt?ctgattatgc?tgattactat120
ttcagggtca?ctaagagcga?gcacatgact?gagttgaaga?agaagttcaa?tcgcatatgt180
gacaaatcaa?tgatcaagaa?gcgttacatt?cacttgaccg?aagaaatgct?tgaggagcac240
ccaaacattg?gtgcttatat?ggctccatct?cttaacatac?gccaagagat?tatcactgct300
gaggtaccta?gacttggtag?ggatgcagca?ttgaaggctc?ttaaagagtg?gggccaacca360
aagtccaaga?tcacccatct?tgtattttgt?acaacctccg?gtgtagaaat?gcccggtgcg420
gattacaaac?tcgctaatct?cttaggtctt?gaaacatcgg?ttagaagggt?gatgttgtac480
catcaagggt?gctatgcagg?tggaactgtc?cttcgaactg?ctaaggatct?tgcagaaaat540
aatgcaggag?cacgagttct?tgtggtgtgc?tctgagatca?ctgttgttac?attccgtggc600
ccttccgaag?atgctttgga?ctctttagtt?ggccaagccc?tttttggtga?tgggtcttca660
gctgtgattg?ttggatcaga?tccagatgtc?tcgattgaac?gaccactctt?ccaacttgtt720
tcagcagccc?aaacatttat?tcctaattca?gcaggagcca?ttgccggaaa?cttacgtgag780
gtggggctca?cctttcattt?gtggcccaat?gtgcctactt?tgatttctga?gaacatagag840
aaatgcttga?cccaggcttt?tgacccactt?ggtattagcg?attggaactc?gttattttgg900
attgctcacc?caggtggccc?tgcaattctc?gatgcagttg?aagcaaaact?caatttagag960
aaaaagaaac?tcgaagcaac?taggcatgtg?ttaagtgagt?acggtaacat?gtcaagtgca1020
tgtgtgttgt?ttattctgga?tgagatgaga?aagaaatcct?tgaaggggga?aaaggctacc1080
acaggtgaag?gattggattg?gggagtatta?tttggttttg?ggccgggctt?gaccatcgaa1140
actgttgtgc?tgcatagcgt?tcctacagtt?acaaattaa1179
<210>?SEQ?ID?No?2
<211>?276
<212>?PRT
< 213>trans-resveratrol stilbene synthase
<400>?2
Met?Pro?Asn?Tyr?Ser?Tyr?Thr?Pro?Thr?Ile?Gln?Arg?Ala?Lys?Gly?Pro?Ala?Thr?Ile?Leu
15101520
Ala?Ile?Gly?Thr?Ala?Thr?Pro?Asp?His?Cys?Val?Tyr?Gln?Ser?Asp?Tyr?Ala?Asp?Tyr?Tyr
25303540
Phe?Arg?Val?Thr?Lys?Ser?Glu?His?Met?Thr?Glu?Leu?Lys?Lys?Lys?Phe?Asn?Arg?Ile?Cys
45505560
Asp?Lys?Ser?Met?Ile?Lys?Lys?Arg?Tyr?Ile?His?Leu?Thr?Glu?Glu?Met?Leu?Glu?Glu?His
65707580
Pro?Asn?Ile?Gly?Ala?Tyr?Met?Ala?Pro?Ser?Leu?Asn?Ile?Arg?Gln?Glu?Ile?Ile?Thr?Ala
859095100
Glu?Val?Pro?Arg?Leu?Gly?Arg?Asp?Ala?Ala?Leu?Lys?Ala?Leu?Lys?Glu?Trp?Gly?Gln?Pro
105110115120
Lys?Ser?Lys?Ile?Thr?His?Leu?Val?Phe?Cys?Thr?Thr?Ser?Gly?Val?Glu?Met?Pro?Gly?Ala
125130135140
Asp?Tyr?Lys?Leu?Ala?Asn?Leu?Leu?Gly?Leu?Glu?Thr?Ser?Val?Arg?Arg?Val?Met?Leu?Tyr
145150155160
His?Gln?Gly?Cys?Tyr?Ala?Gly?Gly?Thr?Val?Leu?Arg?Thr?Ala?Lys?Asp?Leu?Ala?Glu?Asn
165170175180
Asn?Ala?Gly?Ala?Arg?Val?Leu?Val?Val?Cys?Ser?Glu?Ile?Thr?Val?Val?Thr?Phe?Arg?Gly
185190195200
Pro?Ser?Glu?Asp?Ala?Leu?Asp?Ser?Leu?Val?Gly?Gln?Ala?Leu?Phe?Gly?Asp?Gly?Ser?Ser
205210215220
Ala?Val?Ile?Val?Gly?Ser?Asp?Pro?Asp?Val?Ser?Ile?Glu?Arg?Pro?Leu?Phe?Gln?Leu?Val
225230235240
Ser?Ala?Ala?Gln?Thr?Phe?Ile?Pro?Asn?Ser?Ala?Gly?Ala?Ile?Ala?Gly?Asn?Leu?Arg?Glu
245250255260
Val?Gly?Leu?Thr?Phe?His?Leu?Trp?Pro?Asn?Val?Pro?Thr?Leu?Ile?Ser
265270275
Claims (4)
1. method of utilizing insect system expression trans-resveratrol stilbene synthase comprises:
1) from the grape tissue, utilize two primer amplifications of upstream and downstream to obtain the trans-resveratrol stilbene synthase gene like the said sequence of SEQ ID NO.1 through RT-PCR, and add BamH I restriction enzyme site at its 5 ' end, 3 ' end adds Sal I restriction enzyme site, obtains recombination;
2) recombination that obtains step 1) is connected and the pFastBac HTA-llcjy plasmid that obtains to recombinate with pFastBac HTA plasmid vector behind BamH I and Sal I double digestion;
3) step 2) the recombinant plasmid transformed DH 10Bac competent escherichia coli cell that obtains;
4) through blue hickie screening, picking contains the white colony of the Bacmid that recombinates, extracts reorganization Bacmid DNA;
5) use the liposome mediated-method transfection insect cell, obtain recombinant virus;
6) evaluation of recombinant virus and a large amount of amplification;
7) recombinant virus inoculation silkworm pupa, 28 ℃ ± 2 ℃ were reacted 5 to 7 days, promptly obtained the engineering silkworm chrysalis of great expression trans-resveratrol stilbene synthase;
8) silkworm chrysalis is with the mixed back homogenate by weight 1: 1 of 0.85wt% saline water, and repeatedly centrifugal then back is with obtaining reorganization trans-resveratrol stilbene synthase after G150 molecular sieve purification and the desalination.
2. the method for utilizing insect system expression trans-resveratrol stilbene synthase as claimed in claim 1; The upstream primer that it is characterized in that said RT-PCR is 5 '-GGAAGGATCCATGCCGAATTATTCATACACCCCCACCATCCAACGTGCCAAGGGTC CGGC, downstream primer is 5 '-GGGCGTCGACTTAATTTGTAACCATAGC.
3. the method for utilizing insect system expression trans-resveratrol stilbene synthase as claimed in claim 1 is characterized in that said blue hickie screening selection contains the solid medium of kantlex, qingfengmeisu qiong and tsiklomitsin.
4. preparing resveratrol comprises:
1) under 30 ℃,, obtains reaction mixture the extracting solution reaction of the trans-resveratrol stilbene synthase that makes by the said method of utilizing insect system expression trans-resveratrol stilbene synthase to prepare of claim 1 and Watermelon rind or Hami melon skin or Pericarpium Vitis viniferae and Semen Vitis viniferae 6～8 hours;
2) reaction mixture is used macroporous resin purification, and the method for wherein said purifying is carried out enrichment for using semipolar particle diameter at the macroporous resin DM-130 of 0.30～1.25mm, under normal temperature condition; Using massfraction is that 60% ethanol is made strippant, with the flow velocity of 2.0mL/min the trans-resveratrol that has adsorbed sample is carried out wash-out, collects elutriant; The elutriant that obtains concentrates through rotary evaporation in vacuo; Remove organic solvent, and lyophilize, the trans-resveratrol raw product obtained.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010101480760A CN102220350B (en) | 2010-04-15 | 2010-04-15 | Method for expressing resveratrol stilbene synthase and preparing resveratrol by utilizing insect system |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010101480760A CN102220350B (en) | 2010-04-15 | 2010-04-15 | Method for expressing resveratrol stilbene synthase and preparing resveratrol by utilizing insect system |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102220350A CN102220350A (en) | 2011-10-19 |
| CN102220350B true CN102220350B (en) | 2012-09-19 |
Family
ID=44777054
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010101480760A Expired - Fee Related CN102220350B (en) | 2010-04-15 | 2010-04-15 | Method for expressing resveratrol stilbene synthase and preparing resveratrol by utilizing insect system |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102220350B (en) |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1239141A (en) * | 1998-06-17 | 1999-12-22 | 中国科学院微生物研究所 | Resveratrol synthase gene and its preparing process |
| WO2002042465A1 (en) * | 2000-11-21 | 2002-05-30 | Nanyang Technological University | Production of stilbenes in transgenic plants and the method of producing thereof |
| CN1807604A (en) * | 2005-01-27 | 2006-07-26 | 西北农林科技大学 | Chinese grape wild species east China grape stilbene synthetase gene sequence and its use |
| CN101160393A (en) * | 2005-02-22 | 2008-04-09 | 弗卢克索姆科学公司 | Metabolically engineered cells for the production of resveratrol or an oligomeric or glycosidically-bound derivative thereof |
| CN101381726A (en) * | 2008-10-14 | 2009-03-11 | 浙江大学 | Method for expressing growth factor of human blood vessel in bombyx mori by Bac-to-Bac system |
| WO2009124966A2 (en) * | 2008-04-11 | 2009-10-15 | Fluxome Sciences A/S | Conversion of stilbenoids |
| CN101629187A (en) * | 2009-08-17 | 2010-01-20 | 浙江大学 | Method for improving expression level of foreign protein of silkworm baculovirus expression system |
-
2010
- 2010-04-15 CN CN2010101480760A patent/CN102220350B/en not_active Expired - Fee Related
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1239141A (en) * | 1998-06-17 | 1999-12-22 | 中国科学院微生物研究所 | Resveratrol synthase gene and its preparing process |
| WO2002042465A1 (en) * | 2000-11-21 | 2002-05-30 | Nanyang Technological University | Production of stilbenes in transgenic plants and the method of producing thereof |
| CN1807604A (en) * | 2005-01-27 | 2006-07-26 | 西北农林科技大学 | Chinese grape wild species east China grape stilbene synthetase gene sequence and its use |
| CN101160393A (en) * | 2005-02-22 | 2008-04-09 | 弗卢克索姆科学公司 | Metabolically engineered cells for the production of resveratrol or an oligomeric or glycosidically-bound derivative thereof |
| WO2009124966A2 (en) * | 2008-04-11 | 2009-10-15 | Fluxome Sciences A/S | Conversion of stilbenoids |
| CN101381726A (en) * | 2008-10-14 | 2009-03-11 | 浙江大学 | Method for expressing growth factor of human blood vessel in bombyx mori by Bac-to-Bac system |
| CN101629187A (en) * | 2009-08-17 | 2010-01-20 | 浙江大学 | Method for improving expression level of foreign protein of silkworm baculovirus expression system |
Non-Patent Citations (4)
| Title |
|---|
| B. G. Ma et al.Expression of stilbene synthase gene in transgenic tomato using salicylic acid-inducible Cre/loxP recombination system with self-excision of selectable marker.《Biotechnol Lett》.2009,第163-169页. * |
| 吕正兵 等.家蚕表达人表皮生长因子gp67信号肽融合蛋白及生物活性的研究.《生物工程学报》.2008,第111-116页. * |
| 吴小锋 等.利用细菌转座子构建适于家蚕的Bac2to2Bac快速基因表达系统.《蚕业科学》.2006,第183-188页. * |
| 韩晶晶 等.白藜芦醇的研究进展.《生物工程学报》.2008,第1851-1859页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102220350A (en) | 2011-10-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101307317B (en) | Method for preparing rabies virus antigen | |
| CN101824404B (en) | Resveratrol synthase and coding gene and application thereof | |
| CN107099516A (en) | 7 β hydroxy sterols dehydrogenase mutants and its application in ursodesoxycholic acid synthesis | |
| CN103352034A (en) | Agilawood sesquiterpenoid synthase protein ASS4 and encoding gene and application thereof | |
| CN113234740B (en) | Aquilaria sinensis terpene synthase | |
| CN116042751A (en) | Method for biosynthesis of high value-added compounds using lignocellulose derivatives | |
| CN104059927B (en) | Preparation method of newcastle disease glycoprotein viral antigen and products thereof | |
| CN102443543B (en) | Anti-white-spot-syndrome-virus transgenic algae strain as well as preparation method and application thereof | |
| CN102220350B (en) | Method for expressing resveratrol stilbene synthase and preparing resveratrol by utilizing insect system | |
| CN101629186B (en) | Method for producing recombinant scorpion toxin protein by using silkworm as host | |
| US20200317822A1 (en) | Method for Preparing Arabinogalacturonan from Tangerine Peel | |
| CN101245342B (en) | Technique for producing gene rHu(Cu/Zn-SOD) with one-step method | |
| CN102633707A (en) | Method for preparing natural 5-hydroxy tryptamine hydrochloride by utilizing banana peel | |
| WO2018095224A1 (en) | Comprehensive utilization method for canna indica l. plants | |
| Jiang et al. | Current situation, trend, and prospects of research on functional components from by-products of baijiu production: A review | |
| CN109134662A (en) | A kind of visualization antibacterial peptide fusion protein and preparation method thereof and its application | |
| CN114249834B (en) | Chimeric antigen receptor capable of specifically targeting tumor cells, expressed gene thereof, modified NK cells and application thereof | |
| CN102311957A (en) | Hydatidovis soluble antigen preparation method and product thereof | |
| CN112626047B (en) | Spermidine derivative glycosyltransferase and coding gene and application thereof | |
| CN102199608B (en) | Efficient expression of pinellia ternate agglutinin (PTA) in bombyx mori reactor | |
| JP6241672B2 (en) | Ellagic acid derivative exhibiting antiviral action and method for producing the same | |
| CN100497612C (en) | Thermostable lactase preparation method | |
| US11655482B2 (en) | Recombinant transition vector for increasing foreign protein expression | |
| CN112939912A (en) | Preparation method and application of lactucin extracted from cichorium intybus | |
| ES2346124B2 (en) | PROCESS FOR PURIFICATION OF XYLOOLIGOSACARIDS BASED ON THE USE OF DIAFILTRATION. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120919 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |