CN114249834B - Chimeric antigen receptor capable of specifically targeting tumor cells, expressed gene thereof, modified NK cells and application thereof - Google Patents

Chimeric antigen receptor capable of specifically targeting tumor cells, expressed gene thereof, modified NK cells and application thereof Download PDF

Info

Publication number
CN114249834B
CN114249834B CN202111587886.0A CN202111587886A CN114249834B CN 114249834 B CN114249834 B CN 114249834B CN 202111587886 A CN202111587886 A CN 202111587886A CN 114249834 B CN114249834 B CN 114249834B
Authority
CN
China
Prior art keywords
cells
chimeric antigen
antigen receptor
tumor cells
car
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202111587886.0A
Other languages
Chinese (zh)
Other versions
CN114249834A (en
Inventor
袁鑫
朱毅敏
刘翠娟
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Suzhou Institute of Nano Tech and Nano Bionics of CAS
Original Assignee
Suzhou Institute of Nano Tech and Nano Bionics of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Suzhou Institute of Nano Tech and Nano Bionics of CAS filed Critical Suzhou Institute of Nano Tech and Nano Bionics of CAS
Priority to CN202111587886.0A priority Critical patent/CN114249834B/en
Publication of CN114249834A publication Critical patent/CN114249834A/en
Application granted granted Critical
Publication of CN114249834B publication Critical patent/CN114249834B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/7051—T-cell receptor (TcR)-CD3 complex
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14—Blood; Artificial blood
    • A61K35/17—Lymphocytes; B-cells; T-cells; Natural killer cells; Interferon-activated or cytokine-activated lymphocytes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0646—Natural killers cells [NK], NKT cells
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/03—Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/33—Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/74—Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Public Health (AREA)
  • Hematology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Virology (AREA)
  • Physics & Mathematics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Epidemiology (AREA)
  • Plant Pathology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a chimeric antigen receptor capable of specifically targeting tumor cells, an expression gene thereof, modified NK cells thereof and application thereof. The chimeric antigen receptor comprises an extracellular antigen binding domain, a transmembrane domain, and a costimulatory signaling domain, which are sequentially connected, wherein the extracellular antigen binding domain comprises a polypeptide capable of specifically targeted binding to a tumor cell or pathogen. The chimeric antigen receptor capable of specifically targeting tumor cells and the NK cells modified by the chimeric antigen receptor can specifically identify the tumor cells, activate the NK cells and generate cytotoxicity. In addition, the polypeptide screening process in the chimeric antigen receptor of the specific targeting tumor cells is simple, the polypeptide with high affinity and specific targeting effect on the tumor cells can be screened under laboratory conditions, and a plurality of polypeptides can be fused to construct multivalent-CAR-NK, so that the specificity and targeting of the CAR-NK on the tumor cells are improved.

Description

Chimeric antigen receptor capable of specifically targeting tumor cells, expressed gene thereof, modified NK cells and application thereof
Technical Field
The invention relates to a chimeric antigen receptor, in particular to a chimeric antigen receptor capable of specifically targeting tumor cells, an expression gene thereof, modified NK cells thereof and application thereof in tumor treatment, and belongs to the technical field of tumor immunotherapy.
Background
Chimeric antigen receptor (Chimeric antigen receptor, CAR) is a receptor protein, which endows immune cells with new capability, and has potential application prospect in tumor immunotherapy. Chimeric antigen receptors include an antigen binding domain, a transmembrane domain, and a costimulatory signaling domain. Its extracellular antigen binding domain is typically a single chain antibody (scFv) that recognizes a specific antigen on the surface of tumor cells. Intracellular activated signal domains, such as CD28, 4-1BB (CD 137) and OX40, generally function to trigger immune cell activation and killing. In recent years, the use of chimeric antigen receptor-modified T cells (CAR-T) in hematological tumor therapy has been successful and has become a clinical hotspot for tumor immunotherapy. Currently, there are 5 CAR-T products available for use in the treatment of hematological cancers that are approved by the FDA in the united states. China also receives the first collection of CAR-T products, month 6 of 2021. However, the use of CAR-T is limited by inherent risks, e.g., CAR-T causes graft versus host disease (GvHD) and cytokine release syndrome, and generation of CAR-T requires autologous T cells of the patient resulting in long treatment administration cycles.
Based on the nature of Natural Killer (NK) cells, CAR-NK has advantages over CAR-T. First, CAR-NK has better security, mainly referring to the following aspects: 1. because NK cells have a very short life, targeting effects such as those caused by the continued presence of T cells are avoided; 2. the infusion tolerance of allogeneic NK cells is good, gvHD is not caused, so that the application of the CAR in allogeneic NK cells and NK92 cell lines is possible, and the NK is a better CAR carrier and is expected to produce a general product; 3. since NK cell activation does not produce pro-inflammatory factors, it hardly causes adverse reactions such as cytokine release syndrome and neurotoxicity. Secondly, NK cells have stronger killing function, besides the effect of killing by activating NK cells through the recognition of the CAR structure, the NK cells can recognize ligands through various receptors on the surface so as to kill tumor cells, and besides the effect of clearing tumor cells through the ADCC effect of CD16 molecules, so that the CAR-NK has stronger killing capability.
The most critical aspect of the application of the CAR-NK is the selection of a target point, the extracellular recognition domain in the existing CAR structure is generally mainly single-chain antibodies (scFv), and the single-chain antibodies have the advantage of high specificity, so that the single-chain antibodies are widely applied to the CAR-NK. However, the time for obtaining the single-chain antibody for effectively targeting the tumor is long, the single-chain antibody is difficult to obtain, and the problems of complex obtaining process of the single-chain antibody sequence, long time consumption, fewer tumor targets corresponding to the existing single-chain antibody and the like exist. In addition, single-chain antibodies have the disadvantage of having a large molecular weight, and therefore it is difficult to construct two or more single-chain antibodies into multivalent extracellular recognition domains, which cannot effectively improve affinity and reduce off-target. In recent years, single-chain antibodies are mainly used as extracellular recognition domains in research on the CAR-NK technology, hsiang-chi Tseng et al construct the CAR-NK targeting liver cancer GPC3, prove that extracellular signals can transduce and activate NK cell activation, and prove the usability of an NK92 cell line. But the broader choice of targets remains a difficulty for CAR-NK technology applications.
Disclosure of Invention
The invention aims to provide a chimeric antigen receptor capable of specifically targeting tumor cells so as to overcome the defects in the prior art.
Another present aspect of the invention is to provide NK cells modified by expressed genes and chimeric antigen receptors, and the use thereof in the preparation of medicaments for the treatment of tumors.
In order to achieve the purpose of the invention, the technical scheme adopted by the invention comprises the following steps:
the embodiment of the invention provides a chimeric antigen receptor capable of specifically targeting tumor cells, which comprises an extracellular antigen binding domain, a transmembrane domain and a costimulatory signal domain which are sequentially connected, wherein the extracellular antigen binding domain comprises a polypeptide capable of specifically targeting tumor cells or pathogens.
In some embodiments, the protein polypeptide sequence of the extracellular antigen-binding domain is selected from a fragment of an A1 protein polypeptide sequence.
In some embodiments, the costimulatory signaling domain comprises a 2B4 intracellular region structure and a cd3ζ intracellular region structure, the protein polypeptide sequence of the 2B4 intracellular region structure being selected from the group consisting of fragments of a 2B4 protein polypeptide sequence, and the protein polypeptide sequence of the cd3ζ intracellular region structure being selected from the group consisting of fragments of a cd3ζ protein polypeptide sequence.
In some embodiments, the chimeric antigen receptor capable of specifically targeting tumor cells has the sequence shown in SEQ ID NO. 5.
The embodiment of the invention also provides an expression gene for expressing the chimeric antigen receptor capable of specifically targeting tumor cells.
The embodiment of the invention also provides an expression vector which contains the expression gene.
The embodiment of the invention also provides an NK cell modified by the chimeric antigen receptor capable of specifically targeting tumor cells, wherein the NK cell can express the chimeric antigen receptor capable of specifically targeting tumor cells, or the NK cell is introduced with the expression gene or transfected with the expression vector.
The embodiment of the invention also provides a pharmaceutical composition, which comprises the chimeric antigen receptor, the expression gene and the expression vector which are used as active ingredients and can specifically target tumor cells, or NK cells modified by the chimeric antigen receptor and capable of specifically targeting tumor cells.
Furthermore, the embodiment of the invention also provides application of the chimeric antigen receptor, the expression gene, the expression vector and the NK cell modified by the chimeric antigen receptor capable of specifically targeting tumor cells or the pharmaceutical composition in preparation of medicines for treating and/or preventing tumor diseases.
Compared with the prior art, the invention has the beneficial effects that:
the chimeric antigen receptor capable of specifically targeting tumor cells and the NK cells modified by the chimeric antigen receptor can specifically identify the tumor cells, activate the NK cells and generate cytotoxicity. In addition, the polypeptide screening process in the chimeric antigen receptor of the specific targeting tumor cells is simple, the polypeptide with high affinity and specific targeting effect on the tumor cells can be screened under laboratory conditions, and a plurality of polypeptides can be fused to construct multivalent-CAR-NK, so that the specificity and targeting of the CAR-NK on the tumor cells are improved.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are required to be used in the embodiments or the description of the prior art will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments described in the present invention, and other drawings may be obtained according to the drawings without inventive effort to those skilled in the art.
FIG. 1 is a schematic diagram of the construction of a CAR plasmid according to an exemplary embodiment of the present invention;
FIGS. 2A-2E are graphs showing lentiviral titer measurements according to an exemplary embodiment of the present invention;
FIGS. 3A-3C are graphs showing the results of detecting the positive rate of APC fluorescence of transfected cells using a flow cytometer in an exemplary embodiment of the invention;
FIGS. 4A-4D are schematic diagrams showing the results of testing A1 polypeptide-CAR-NK killer target cells according to an exemplary embodiment of the present invention;
FIGS. 5A and 5B are graphs showing the detection results of IFN-gamma in a cell culture supernatant according to an exemplary embodiment of the present invention.
Detailed Description
In view of the deficiencies in the prior art, the present inventors have long studied and practiced in great numbers to try to use a polypeptide having targeting property instead of a single chain antibody to construct NK cells modified with chimeric antigen receptors capable of specifically targeting tumor cells (hereinafter may be simply referred to as polypeptide-CAR-NK) having a polypeptide having targeting property as extracellular recognition domain, NKG2D as transmembrane domain, 2B4 and CD3 zeta chain as intracellular activation signal domain. The polypeptide which can specifically target a certain tumor cell is screened out in a short time, is easy to obtain, has small molecular weight and strong targeting function, can retain the function of the intracellular activation domain of the CAR structure to effectively activate the cell, and does not influence the killing activity of NK cells. After the polypeptide-CAR-NK is successfully constructed, the bioactivity of the polypeptide-CAR-NK is further identified through in vitro cytokine release assay and tumor cell killing experiments, so that the killing effect of the polypeptide-CAR-NK mediated tumor cells is proved, a theoretical basis is provided for the application of the polypeptide in the CAR-NK technology, and a foundation is provided for the application of the multivalent polypeptide-CAR-NK in the next stage aiming at more targets.
The terms used in the present invention are explained as follows:
chimeric antigen receptor (Chimeric antigen receptor, CAR) (chimeric antigen receptor, CAR) cell therapy: is a special immunotherapy for effectively recognizing, attacking and eliminating tumor cells by modifying immune cells through a gene editing technology. Chimeric antigen receptors include an antigen binding domain, a transmembrane domain, and a costimulatory signaling region.
Lentiviral Titer (Titer): number of infectious capable viruses per unit volume; units: TU/mL (active titer units).
Multiplicity of infection MOI: the ratio of the number of virus particles used to the number of cells at 80% of the cells infected is generally taken as the MOI of the strain. MOI value = viral titer (TU/mL) ×viral volume (mL)/cell number.
The technical scheme, the implementation process, the principle and the like are further explained as follows.
In one aspect, the chimeric antigen receptor capable of specifically targeting tumor cells provided by the embodiment of the invention comprises an extracellular antigen binding domain, a transmembrane domain and a costimulatory signal domain which are sequentially connected, wherein the extracellular antigen binding domain comprises a polypeptide capable of specifically targeting tumor cells or pathogens.
Compared with single-chain antibodies, the polypeptide with targeting property is easier to screen, the polypeptide with high affinity and specific targeting effect on tumor cells can be successfully screened under laboratory conditions, the molecular weight of the polypeptide is small, and a plurality of polypeptides can be fused to form multivalent polypeptide-CAR-NK, so that the specificity and targeting property of CAR proteins on the tumor cells are improved, and the off-target is reduced.
In some embodiments, the protein polypeptide sequence of the extracellular antigen-binding domain is selected from a fragment of an A1 protein polypeptide sequence. The extracellular antigen binding domain (also referred to as extracellular recognition domain) in the CAR structure of the present invention may be used to construct multivalent polypeptide-CAR-NK using other polypeptides having targeting to tumors or pathogens, or a combination of two or more polypeptides, in addition to the A1 polypeptide.
Further, the A1 protein polypeptide sequence has a nucleotide sequence shown as SEQ ID NO.1, and specifically comprises the following steps: GGCCAGAGCGGCCAGTGGTTCTGCAGCTGGTACGGCGGCGACACCTGCGTGCAGGGCGGCCAGAGCGGCCAG.
Furthermore, the fragments of the A1 protein polypeptide sequence are more than two, and can be fused by a plurality of polypeptides to form multivalent-CAR-NK, so that the specificity and targeting of CAR to tumor cells are improved.
In some embodiments, the protein polypeptide sequence of the transmembrane domain is selected from a fragment of an NKG2D protein polypeptide sequence.
Further, the NKG2D protein polypeptide sequence has a nucleotide sequence shown as SEQ ID NO.2, and specifically comprises the following steps: CCATTTTTTTTCTGCTGCTTCATCGCTGTAGCCATGGGAATCCGTTTCATTATTATGGTAGCA.
In some embodiments, the costimulatory signaling domain comprises a 2B4 intracellular region structure and a cd3ζ intracellular region structure, the protein polypeptide sequence of the 2B4 intracellular region structure being selected from the group consisting of fragments of a 2B4 protein polypeptide sequence, and the protein polypeptide sequence of the cd3ζ intracellular region structure being selected from the group consisting of fragments of a cd3ζ protein polypeptide sequence.
Further, the 2B4 protein polypeptide sequence has a nucleotide sequence shown as SEQ ID NO.3, and specifically comprises the following steps: TGGCGCCGCAAGCGCAAGGAGAAGCAGAGCGAGACCAGCCCCAAGGAGTTCCTGACCATCTACGAGGACGTGAAGGACCTGAAGACCCGCCGCAACCACGAGCAGGAGCAGACCTTCCCCGGCGGCGGCAGCACCATCTACAGCATGATCCAGAGCCAGAGCAGCGCCCCCACCAGCCAGGAGCCCGCCTACACCCTGTACAGCCTGATCCAGCCCAGCCGCAAGAGCGGCAGCCGCAAGCGCAACCACAGCCCCAGCTTCAACAGCACCATCTACGAGGTGATCGGCAAGAGCCAGCCCAAGGCCCAGAACCCCGCCCGCCTGAGCCGCAAGGAGCTGGAGAACTTCGACGTGTACAGC.
Further, the CD3 zeta protein polypeptide sequence has a nucleotide sequence shown as SEQ ID NO.4, and specifically comprises the following steps: CGCGTGAAATTCAGCCGCAGCGCAGATGCTCCAGCCTACCAGCAGGGGCAGAACCAGCTCTACAACGAACTCAATCTTGGTCGGAGAGAGGAGTACGACGTGCTGGACAAGCGGAGAGGACGGGACCCAGAAATGGGCGGGAAGCCGCGCAGAAAGAATCCCCAAGAGGGCCTGTACAACGAGCTCCAAAAGGATAAGATGGCAGAAGCCTATAGCGAGATTGGTATGAAAGGGGAACGCAGAAGAGGCAAAGGCCACGACGGACTGTACCAGGGACTCAGCACCGCCACCAAGGACACCTATGACGCTCTTCACATGCAGGCCCTGCCGCCTCGGTGA.
In some more specific embodiments, the chimeric antigen receptor capable of specifically targeting a tumor cell comprises an extracellular antigen binding domain, a transmembrane domain, a 2B4 intracellular region structure, and a cd3ζ intracellular region structure in tandem in sequence.
Further, the chimeric antigen receptor also includes a tag sequence linked between the extracellular antigen binding domain and the transmembrane domain.
Further, the tag sequence includes a Myc-tag sequence.
In some more specific embodiments, the chimeric antigen receptor capable of specifically targeting tumor cells has the sequence shown in SEQ ID NO.5, and the chimeric antigen receptor gene sequence is: ATGGCCCTCCCTGTCACCGCCCTGCTGCTTCCGCTGGCTCTTCTGCTCCACGCCGCTCGGCCCGGCCAGAGCGGCCAGTGGTTCTGCAGCTGGTACGGCGGCGACACCTGCGTGCAGGGCGGCCAGAGCGGCCAGGAGCAGAAGCTGATCAGCGAGGAGGACCTGACCACTACCCCAGCACCGAGGCCACCCACCCCGGCTCCTACCATCGCCTCCCAGCCTCTGTCCCTGCGTCCGGAGGCATGTAGACCCGCAGCTGGTGGGGCCGTGCATACCCGGGGTCTTGACTTCGCCTGCGATCCATTTTTTTTCTGCTGCTTCATCGCTGTAGCCATGGGAATCCGTTTCATTATTATGGTAGCATGGCGCCGCAAGCGCAAGGAGAAGCAGAGCGAGACCAGCCCCAAGGAGTTCCTGACCATCTACGAGGACGTGAAGGACCTGAAGACCCGCCGCAACCACGAGCAGGAGCAGACCTTCCCCGGCGGCGGCAGCACCATCTACAGCATGATCCAGAGCCAGAGCAGCGCCCCCACCAGCCAGGAGCCCGCCTACACCCTGTACAGCCTGATCCAGCCCAGCCGCAAGAGCGGCAGCCGCAAGCGCAACCACAGCCCCAGCTTCAACAGCACCATCTACGAGGTGATCGGCAAGAGCCAGCCCAAGGCCCAGAACCCCGCCCGCCTGAGCCGCAAGGAGCTGGAGAACTTCGACGTGTACAGCCGCGTGAAATTCAGCCGCAGCGCAGATGCTCCAGCCTACCAGCAGGGGCAGAACCAGCTCTACAACGAACTCAATCTTGGTCGGAGAGAGGAGTACGACGTGCTGGACAAGCGGAGAGGACGGGACCCAGAAATGGGCGGGAAGCCGCGCAGAAAGAATCCCCAAGAGGGCCTGTACAACGAGCTCCAAAAGGATAAGATGGCAGAAGCCTATAGCGAGATTGGTATGAAAGGGGAACGCAGAAGAGGCAAAGGCCACGACGGACTGTACCAGGGACTCAGCACCGCCACCAAGGACACCTATGACGCTCTTCACATGCAGGCCCTGCCGCCTCGGTGA.
Further, the amino acid sequence of the chimeric antigen receptor protein capable of specifically targeting tumor cells is shown as SEQ ID NO.6, and specifically comprises the following steps: MALPVTALLLPLALLLHAARPGQSGQWFCSWYGGDTCVQGGQSGQEQKLISEEDLTTTPAPRPPTPAPTIASQPLSLRPEACRPAAGGAVHTRGLDFACDPFFFCCFIAVAMGIRFIIMVAWRRKRKEKQSETSPKEFLTIYEDVKDLKTRRNHEQEQTFPGGGSTIYSMIQSQSSAPTSQEPAYTLYSLIQPSRKSGSRKRNHSPSFNSTIYEVIGKSQPKAQNPARLSRKELENFDVYSRVKFSRSADAPAYQQGQNQLYNELNLGRREEYDVLDKRRGRDPEMGGKPRRKNPQEGLYNELQKDKMAEAYSEIGMKGERRRGKGHDGLYQGLSTATKDTYDALHMQALPPR.
Further, the tumor cells include, but are not limited to, non-small cell lung cancer a549 cells.
In another aspect of embodiments of the invention, an expression gene is provided for expressing the chimeric antigen receptor capable of specifically targeting tumor cells.
In another aspect, the present invention provides an expression vector comprising the aforementioned expression gene.
In the present specification, the term "expression vector" is a vector capable of expressing a target protein or target RNA in a suitable host cell. The gene sequences of the invention may be present in a vector, wherein the gene sequences are operably linked to regulatory sequences capable of providing for expression of the gene sequences by a suitable host cell. Within the context of an expression vector, the term "operably linked" means that the gene sequence of interest is linked to the regulatory sequence(s) in a manner that allows for expression of the nucleic acid. The term "regulatory sequence (or regulatory sequence)" is intended to include promoters, enhancers, and other expression control elements. Such operative linkage to the expression vector can be achieved by conventional genetic recombination techniques known in the art.
Expression vectors used in the present invention may include, but are not limited to, plasmid vectors, cosmid vectors, phage vectors, viral vectors, and the like.
In another aspect, embodiments of the present invention provide a chimeric antigen receptor-modified NK cell capable of specifically targeting a tumor cell, wherein the NK cell is capable of expressing the chimeric antigen receptor capable of specifically targeting a tumor cell, or wherein the NK cell is introduced with the expression gene or transfected with the expression vector.
In some embodiments, the NK cells include, but are not limited to, NK-92MI cells, NK-92 cells, and the like. That is, the CAR-NK constructed in the present invention can use NK cells isolated from PBMCs or NK92 cell lines in addition to NK-92MI cell lines.
In another aspect, the embodiment of the present invention provides a pharmaceutical composition comprising, as an active ingredient, the aforementioned chimeric antigen receptor, expression gene, expression vector capable of specifically targeting tumor cells, or NK cells modified by the chimeric antigen receptor capable of specifically targeting tumor cells.
Further, the pharmaceutical composition further comprises a pharmaceutically acceptable pharmaceutical carrier and/or excipient.
The term "pharmaceutically acceptable carrier" as used herein has a meaning well known to those skilled in the art and may include any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, pharmaceutical stabilizers, gels, binders, excipients, disintegrants, lubricants, sweeteners, flavoring agents, dyes, the like, and combinations thereof.
The pharmaceutical compositions of the invention may be administered in a variety of forms, for example by injection, preferably the pharmaceutical compositions of the invention may be formulated in aqueous solutions, particularly in physiologically compatible buffers or physiological saline buffers. These injectable formulations may be formulated by conventional methods using one or more dispersing, wetting and suspending agents.
Further, another aspect of the embodiment of the present invention also provides the use of the aforementioned chimeric antigen receptor capable of specifically targeting tumor cells, an expression gene, an expression vector, NK cells modified by the chimeric antigen receptor capable of specifically targeting tumor cells, or a pharmaceutical composition for the preparation of a medicament for treating and/or preventing tumor diseases.
Further, the neoplastic disease is selected from lung cancer, but is not limited thereto.
In some more specific embodiments, another aspect of embodiments of the invention also provides a method of constructing a chimeric antigen receptor-modified NK cell (polypeptide-CAR-NK) capable of specifically targeting a tumor cell, comprising:
the method comprises the steps of constructing a lentivirus CAR objective plasmid comprising a Myc-tag, an A1 polypeptide, an NKG2D transmembrane domain, a 2B4 and a CD3 zeta chain, packaging the plasmid together with lentivirus packaging plasmids Pspax2 and Pmd2.9G to obtain a CAR-lentivirus, and successfully expressing a CAR protein on an NK cell membrane after the CAR-lentivirus infects NK92MI cells, thus indicating that the CAR-NK is successfully constructed.
The detection method adopted by the invention is that NK cells are detected by a flow cytometry to show the expression of Myc-tag labels, the success of CAR-NK construction is verified, the activation of the CAR-NK cells is verified by detecting cytokines, and the cytotoxic effect is detected by a tumor cell killing experiment. As with single chain antibody (scFv) mediated targeting recognition, the polypeptide-CAR-NK constructed by the invention can also specifically recognize tumor cells, activate NK cells and produce cytotoxicity. In addition, single chain antibodies are not easily screened and have a large molecular weight. The polypeptide in the polypeptide-CAR-NK is easy to screen, and a plurality of polypeptides can be fused and constructed, so that the specificity and targeting of the polypeptide-CAR-NK to tumor cells are improved.
Furthermore, the detection and killing technology used in the invention can detect the killing of effector cells to tumor cells by adopting an MTT method and a CCK8 method besides using the D-potassium fluorescein to detect the luciferase expressed in living cells.
For a better description of the objects, technical solutions and advantages of the present invention, the technical solutions of the present invention will be explained in more detail below with reference to the accompanying drawings and exemplary embodiments. The following specific examples are given for the purpose of further illustration and explanation of the present invention and are not intended to be limiting thereof; all modifications suggested or derived from the disclosure of the present invention are to be considered as being within the scope of the present invention.
1. Construction of CAR plasmids
The A1 polypeptide sequence (shown as SEQ ID NO. 1), the transmembrane sequence NKG2D (shown as SEQ ID NO. 2), the synergistic co-stimulatory molecule 2B4 (shown as SEQ ID NO. 3) and the intracellular signaling CD3 zeta (shown as SEQ ID NO. 4) are connected in series by using a gene synthesis method to obtain the A1-NKG2D-2B 4-zeta fragment. Then cloning the A1-NKG2D-2B 4-zeta fragment onto the slow virus vector of Lenti-EF1 a-2 nd CAR. Finally, the required target vector namely Lenti-EF1a-A1-NK_CAR (the plasmid contains Myc-tag label and can be used for subsequent detection) is obtained and transformed into the E.coli Top10 strain for subsequent lentiviral packaging, and the plasmid design is shown in figure 1.
2. Virus packaging and titer detection
Extraction of lentiviral packaging plasmid:
1) The pjncture bacterium Top10 containing the plasmid is inoculated into LB liquid medium for activation, and glycerol is used for seed preservation at-80 ℃. And (3) taking the glycerol bacteria 1 for freezing, preserving and breeding: 100 is inoculated into 4ml LB medium containing 0.1% amp for shaking and activating for 4-6h at 37 ℃, and then transferred to 400ml LB medium containing 0.1% amp for shaking and culturing for 12h at 37 ℃.
2) Extracting plasmid according to the instruction of the large-scale extraction kit of the multiple medical plasmid, detecting the concentration and purity of the plasmid by using an ultraviolet spectrophotometer, and storing at-20 ℃ for subsequent lentivirus packaging.
Lentivirus packaging process:
virus packaging cells 293T were cultured in DMEM complete medium (10% fbs,1% diabody) and digested every other day with 0.05% pancreatin. The virus packaging operation is carried out at the cell density of 70-80%. The centrifuge tube No.1 was added with 450. Mu.L of serum-free DMEM medium, and 12. Mu.g of vector Lenti-EF1a-A1-NK_CAR plasmid, 9. Mu.g of Pspax2 plasmid, and 4.5. Mu.g of Pmd2.9G plasmid were thoroughly mixed. Transfection reagent PEI 75. Mu.L and 400. Mu.L serum-free D in centrifuge tube No.2MEM is mixed uniformly, a centrifuge tube No.2 is placed for 5min, then added into a centrifuge tube No.1, mixed uniformly and kept stand at room temperature for 20min. The culture medium of the cell culture dish is replaced by a serum-free DMEM culture medium in advance, the mixed solution in the centrifuge tube No.1 is evenly dripped into the culture dish, the culture dish is gently shaken and placed at 37 ℃ and 5 percent CO 2 After 3-4 hours, the serum-free DMEM medium is replaced by the DMEM complete medium, and the fresh medium is replaced again for 20-24 hours. 293T cell culture supernatant can be recovered at the beginning of 48 h. Centrifugation is carried out at 4000rpm and 4 ℃ for 10min, the supernatant is filtered by a 0.45 mu m filter membrane, the complete DMEM culture medium is supplemented in 293T, and the culture is continued for 24h, so that viruses can be collected again. The collected virus supernatant was centrifuged at 60000g for 2 hours, the supernatant was discarded, and the pellet was resuspended in serum-free alpha-MEM medium and stored in aliquots. Long-term storage at-80 ℃.
Lentiviral titer detection:
the CAR plasmid designed as described above contains a Myc-tag. Jurkat cells (moi=20) were seeded into 48-well plates, 1×10 per well 5 And each. The concentrated virus liquid is added into a 48-hole plate in a gradient of 0.1 mu l,1 mu l, 10 mu l and 100 mu l, the selected antibody is PE marked anti-human Myc-tag antibody, the positive expression rate of the target label Myc-tag on Jurkat cells is detected by using flow cytometry, and the number of virus particles contained in each microliter of virus liquid is obtained according to the positive rate equal to the infection efficiency of the virus. The final virus titer was 3X 10 7 TU/ml and the detection results are shown in FIGS. 2A-2E.
3. Construction of A1 polypeptide-CAR-NK
Culture of NK92MI cells:
NK92MI cells were cultured in alpha-MEM medium (10% FBS,1% diabody, 0.02mM folic acid, 0.1mM mercaptoethanol, 0.2mM inositol) and inoculated on day 0, half-changed on day one, and full-changed on day two.
Lentivirus transfection NK92MI cells:
taking 1×10 6 Centrifuging NK-92MI cells to remove supernatant, adding concentrated Lenti-EF1a-A1-NK_CAR virus solution (MOI=20), mixing, placing in a 37 deg.C cell incubator, centrifuging after 6 hr, removing virus solution, culturing cells in 6-well plate, culturing for 72 hr, and performing transfectionNK-92MI cells were tested for the relevant proteins of interest and for cytotoxicity assays.
Flow cytometry analysis (FC) expression of the protein of interest:
detecting Myc-tag label on target protein, collecting 1×10 6 NK-92MI cells transfected with A1-CAR virus (hereinafter referred to as A1-CAR-NK92 MI) were used as negative controls, and NK-92 MI-transfected antibodies were used as positive controls. The collected cells were incubated with Myc-tag antibody (APC-labeled) at 4 ℃ for 30min, the supernatant was centrifuged off, washed twice with PBS, then the cells were resuspended with 1ml of PBS, and finally the positive rate of APC fluorescence of the transfected cells was detected by flow cytometry, as shown in fig. 3A-3C, wherein fig. 3A represents a negative control, fig. 3B represents a positive control, fig. 3C represents an experimental group, and the positive rate was 48.32%.
4. A1 polypeptide-CAR-NK killer target cells
Culturing of target cells:
the target cells used were A549-luc cells and H460-luc cells constructed by the present inventors to stably express luciferase (luc), wherein the H460-luc cells served as a control. A549-luc cells and H460-luc cells were cultured in RPMI-1640 complete medium (10% fbs,1% diabody added), digested on alternate days with 0.05% pancreatin. Killing is performed when the cell density is 80% -90%.
A1 polypeptide-CAR-NK killing target cells:
the ratio of effector cells (CAR-NK/NK-92 MI) to target cells (A549-luc/H46-luc) (effective target ratio, E: T) was set to 0.5, respectively: 1. 1: 1. 2: 1. 5:1, three duplicate wells are set up for each group, and the group without effector cells is set up as a control group. Incubating effector cells with target cells at 37℃with 5% CO 2 The cells were incubated in the incubator for 24 hours, potassium D fluorescein was added, incubated at 37℃for 5 minutes, and the bioluminescence intensity of each well was measured by an ELISA reader, the bioluminescence intensity being proportional to the number of living cells, and the results are shown in FIGS. 4A to 4D, respectively.
5. Detection of IFN-gamma in cell culture supernatants
The amount of NK92-MI or A1 polypeptide-CAR-NK released IFN-gamma in the above effective target ratio culture is detected to verify the level of activation of effector cells, and the detection can be performed by ELISA. The ELISA test method was performed with reference to the following steps:
300. Mu.L of elution buffer was added to a 96-well plate pre-coated with IFN-gamma capture antibody, the buffer was poured off after 30s of immersion, and the residual liquid was removed by pipetting onto a nonwoven fabric. 50. Mu.L of assay buffer, 50. Mu.L of sample supernatant, 50. Mu.L of IFN-gamma detection antibody diluted with assay buffer, shaking at 150rpm, and incubating at room temperature for 120min were sequentially added to each well. The liquid was discarded, 200. Mu.L of wash solution was added to each well to wash the plate, and the plate was washed 4 times for 1min each time, and the plate was dried on a nonwoven fabric. The experiment buffer was used to dilute the horseradish peroxidase-labeled streptavidin, 100. Mu.L of each well was added, shaking was performed at 150rpm, incubation was performed at room temperature for 45min, the liquid was discarded, 200. Mu.L of wash solution was added to each well to wash the plate 4 times for 1min each time, and the plate was dried on nonwoven fabric. 100. Mu.L of chromogenic substrate TMB was added to each well, incubated at room temperature in the dark for about 5min, 100. Mu.L of stop solution was added to each well in order, and the absorbance at 450nm was measured with a microplate reader within 30min, and the absorbance at 570nm was measured as a control. The light absorption value is compared with an IFN-gamma standard curve to obtain the IFN-gamma content in the cell culture supernatant. The standard curve was plotted using IFN-gamma standard samples. Taking 500pg/mL IFN-gamma storage solution, diluting a sample by adopting a gradient dilution method, and setting a factor gradient as follows: 500pg/mL, 250pg/mL, 125pg/mL, 62.5pg/mL, 31.25pg/mL, 15.63pg/mL, 7.81pg/mL. The results of the above experiments are shown in fig. 5A and 5B.
In conclusion, the A1 polypeptide-CAR-NK can improve the killing capacity of the CAR-NK on the A549 cells. Furthermore, single chain antibodies have limited options for use because of the relatively difficult availability of single chain antibody sequences. Compared with single-chain antibodies, the A1 polypeptide-CAR-NK constructed by the invention has simple screening process, can screen out polypeptides with high affinity and specific targeting effect on tumor cells under laboratory conditions, and can be fused by a plurality of polypeptides to construct multivalent-CAR-NK, so that the specificity and targeting of CAR on the tumor cells are improved.
The various aspects, embodiments, features and examples of the invention are to be considered in all respects as illustrative and not intended to limit the invention, the scope of which is defined solely by the claims. Other embodiments, modifications, and uses will be apparent to those skilled in the art without departing from the spirit and scope of the claimed invention.
While the invention has been described with reference to an illustrative embodiment, it will be understood by those skilled in the art that various other changes, omissions and/or additions may be made and substantial equivalents may be substituted for elements thereof without departing from the spirit and scope of the invention. In addition, many modifications may be made to adapt a particular situation or material to the teachings of the invention without departing from the scope thereof. Therefore, it is intended that the invention not be limited to the particular embodiment disclosed for carrying out this invention, but that the invention will include all embodiments falling within the scope of the appended claims.
Sequence listing
<110> Suzhou nanotechnology and nanobionic research institute of China academy of sciences
<120> chimeric antigen receptor capable of specifically targeting tumor cells, expressed gene thereof, NK cells modified therewith and use thereof
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 72
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 1
ggccagagcg gccagtggtt ctgcagctgg tacggcggcg acacctgcgt gcagggcggc 60
cagagcggcc ag 72
<210> 2
<211> 63
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 2
ccattttttt tctgctgctt catcgctgta gccatgggaa tccgtttcat tattatggta 60
gca 63
<210> 3
<211> 360
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 3
tggcgccgca agcgcaagga gaagcagagc gagaccagcc ccaaggagtt cctgaccatc 60
tacgaggacg tgaaggacct gaagacccgc cgcaaccacg agcaggagca gaccttcccc 120
ggcggcggca gcaccatcta cagcatgatc cagagccaga gcagcgcccc caccagccag 180
gagcccgcct acaccctgta cagcctgatc cagcccagcc gcaagagcgg cagccgcaag 240
cgcaaccaca gccccagctt caacagcacc atctacgagg tgatcggcaa gagccagccc 300
aaggcccaga accccgcccg cctgagccgc aaggagctgg agaacttcga cgtgtacagc 360
<210> 4
<211> 339
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 4
cgcgtgaaat tcagccgcag cgcagatgct ccagcctacc agcaggggca gaaccagctc 60
tacaacgaac tcaatcttgg tcggagagag gagtacgacg tgctggacaa gcggagagga 120
cgggacccag aaatgggcgg gaagccgcgc agaaagaatc cccaagaggg cctgtacaac 180
gagctccaaa aggataagat ggcagaagcc tatagcgaga ttggtatgaa aggggaacgc 240
agaagaggca aaggccacga cggactgtac cagggactca gcaccgccac caaggacacc 300
tatgacgctc ttcacatgca ggccctgccg cctcggtga 339
<210> 5
<211> 1062
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 5
atggccctcc ctgtcaccgc cctgctgctt ccgctggctc ttctgctcca cgccgctcgg 60
cccggccaga gcggccagtg gttctgcagc tggtacggcg gcgacacctg cgtgcagggc 120
ggccagagcg gccaggagca gaagctgatc agcgaggagg acctgaccac taccccagca 180
ccgaggccac ccaccccggc tcctaccatc gcctcccagc ctctgtccct gcgtccggag 240
gcatgtagac ccgcagctgg tggggccgtg catacccggg gtcttgactt cgcctgcgat 300
ccattttttt tctgctgctt catcgctgta gccatgggaa tccgtttcat tattatggta 360
gcatggcgcc gcaagcgcaa ggagaagcag agcgagacca gccccaagga gttcctgacc 420
atctacgagg acgtgaagga cctgaagacc cgccgcaacc acgagcagga gcagaccttc 480
cccggcggcg gcagcaccat ctacagcatg atccagagcc agagcagcgc ccccaccagc 540
caggagcccg cctacaccct gtacagcctg atccagccca gccgcaagag cggcagccgc 600
aagcgcaacc acagccccag cttcaacagc accatctacg aggtgatcgg caagagccag 660
cccaaggccc agaaccccgc ccgcctgagc cgcaaggagc tggagaactt cgacgtgtac 720
agccgcgtga aattcagccg cagcgcagat gctccagcct accagcaggg gcagaaccag 780
ctctacaacg aactcaatct tggtcggaga gaggagtacg acgtgctgga caagcggaga 840
ggacgggacc cagaaatggg cgggaagccg cgcagaaaga atccccaaga gggcctgtac 900
aacgagctcc aaaaggataa gatggcagaa gcctatagcg agattggtat gaaaggggaa 960
cgcagaagag gcaaaggcca cgacggactg taccagggac tcagcaccgc caccaaggac 1020
acctatgacg ctcttcacat gcaggccctg ccgcctcggt ga 1062
<210> 6
<211> 353
<212> PRT
<213> Artificial sequence (Artificial sequence)
<400> 6
Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu
1 5 10 15
His Ala Ala Arg Pro Gly Gln Ser Gly Gln Trp Phe Cys Ser Trp Tyr
20 25 30
Gly Gly Asp Thr Cys Val Gln Gly Gly Gln Ser Gly Gln Glu Gln Lys
35 40 45
Leu Ile Ser Glu Glu Asp Leu Thr Thr Thr Pro Ala Pro Arg Pro Pro
50 55 60
Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu
65 70 75 80
Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp
85 90 95
Phe Ala Cys Asp Pro Phe Phe Phe Cys Cys Phe Ile Ala Val Ala Met
100 105 110
Gly Ile Arg Phe Ile Ile Met Val Ala Trp Arg Arg Lys Arg Lys Glu
115 120 125
Lys Gln Ser Glu Thr Ser Pro Lys Glu Phe Leu Thr Ile Tyr Glu Asp
130 135 140
Val Lys Asp Leu Lys Thr Arg Arg Asn His Glu Gln Glu Gln Thr Phe
145 150 155 160
Pro Gly Gly Gly Ser Thr Ile Tyr Ser Met Ile Gln Ser Gln Ser Ser
165 170 175
Ala Pro Thr Ser Gln Glu Pro Ala Tyr Thr Leu Tyr Ser Leu Ile Gln
180 185 190
Pro Ser Arg Lys Ser Gly Ser Arg Lys Arg Asn His Ser Pro Ser Phe
195 200 205
Asn Ser Thr Ile Tyr Glu Val Ile Gly Lys Ser Gln Pro Lys Ala Gln
210 215 220
Asn Pro Ala Arg Leu Ser Arg Lys Glu Leu Glu Asn Phe Asp Val Tyr
225 230 235 240
Ser Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln
245 250 255
Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu
260 265 270
Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly
275 280 285
Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln
290 295 300
Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu
305 310 315 320
Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr
325 330 335
Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro
340 345 350
Arg

Claims (8)

1. The chimeric antigen receptor capable of specifically targeting tumor cells is characterized in that the amino acid sequence of the chimeric antigen receptor capable of specifically targeting tumor cells is shown as SEQ ID NO. 6.
2. An expressed gene for expressing the chimeric antigen receptor of claim 1 capable of specifically targeting tumor cells.
3. An expression vector comprising the expression gene of claim 2.
4. A chimeric antigen receptor-modified NK cell capable of specifically targeting a tumor cell, wherein said NK cell is capable of expressing the chimeric antigen receptor capable of specifically targeting a tumor cell according to claim 1, or wherein said NK cell has the expression gene according to claim 2 introduced therein, or wherein said NK cell has the expression vector according to claim 3 transfected therein.
5. The chimeric antigen receptor-modified NK cell capable of specifically targeting tumor cells according to claim 4, wherein: the NK cells are selected from NK-92MI cells or NK-92 cells.
6. A pharmaceutical composition characterized by comprising as an active ingredient the chimeric antigen receptor capable of specifically targeting tumor cells according to claim 1, the expression gene according to claim 2, the expression vector according to claim 3, or the chimeric antigen receptor modified NK cells capable of specifically targeting tumor cells according to any one of claims 4 to 5.
7. The pharmaceutical composition according to claim 6, wherein: the pharmaceutical composition further comprises a pharmaceutically acceptable carrier and/or excipient.
8. Use of a chimeric antigen receptor capable of specifically targeting a tumor cell according to claim 1, an expression gene according to claim 2, an expression vector according to claim 3, a chimeric antigen receptor modified NK cell capable of specifically targeting a tumor cell according to any one of claims 4-5 or a pharmaceutical composition according to any one of claims 6-7 for the preparation of a medicament for the treatment of a tumor disease; wherein the neoplastic disease is selected from lung cancer.
CN202111587886.0A 2021-12-23 2021-12-23 Chimeric antigen receptor capable of specifically targeting tumor cells, expressed gene thereof, modified NK cells and application thereof Active CN114249834B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111587886.0A CN114249834B (en) 2021-12-23 2021-12-23 Chimeric antigen receptor capable of specifically targeting tumor cells, expressed gene thereof, modified NK cells and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111587886.0A CN114249834B (en) 2021-12-23 2021-12-23 Chimeric antigen receptor capable of specifically targeting tumor cells, expressed gene thereof, modified NK cells and application thereof

Publications (2)

Publication Number Publication Date
CN114249834A CN114249834A (en) 2022-03-29
CN114249834B true CN114249834B (en) 2023-06-23

Family

ID=80797078

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111587886.0A Active CN114249834B (en) 2021-12-23 2021-12-23 Chimeric antigen receptor capable of specifically targeting tumor cells, expressed gene thereof, modified NK cells and application thereof

Country Status (1)

Country Link
CN (1) CN114249834B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115029318B (en) * 2022-05-12 2022-12-20 成都赋智健康科技有限公司 Mesenchymal stem cell carrying multi-specific antibody gene and pharmaceutical application thereof

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102382175A (en) * 2011-11-02 2012-03-21 中国科学院苏州纳米技术与纳米仿生研究所 Polypeptide for specifically targeting lung cancer cell, and preparation method and application thereof
WO2014026136A2 (en) * 2012-08-10 2014-02-13 Cytomx Therapeutics, Inc. Protease-resistant systems for polypeptide display and methods of making and using thereof
CN103923902A (en) * 2013-01-11 2014-07-16 中国科学院苏州纳米技术与纳米仿生研究所 Lung cancer diagnosis biological reagent, preparation method and application thereof
CN106755107A (en) * 2016-11-22 2017-05-31 上海健信生物医药科技有限公司 A kind of CAR recruits and its application in oncotherapy
CN107337737A (en) * 2017-07-18 2017-11-10 深圳市免疫基因治疗研究院 A kind of Chimeric antigen receptor and its application
CN108690832A (en) * 2017-04-12 2018-10-23 中国科学院苏州纳米技术与纳米仿生研究所 The capture of circulating tumor cell and method for releasing
CN110627909A (en) * 2019-08-28 2019-12-31 中国人民解放军第二军医大学 Chimeric antigen receptor for specifically activating NK cells and application thereof
CN113402590A (en) * 2021-07-14 2021-09-17 呈诺再生医学科技(珠海横琴新区)有限公司 KHL polypeptide and application thereof in preparation of TABP-EIC cells

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102382175A (en) * 2011-11-02 2012-03-21 中国科学院苏州纳米技术与纳米仿生研究所 Polypeptide for specifically targeting lung cancer cell, and preparation method and application thereof
WO2014026136A2 (en) * 2012-08-10 2014-02-13 Cytomx Therapeutics, Inc. Protease-resistant systems for polypeptide display and methods of making and using thereof
CN103923902A (en) * 2013-01-11 2014-07-16 中国科学院苏州纳米技术与纳米仿生研究所 Lung cancer diagnosis biological reagent, preparation method and application thereof
CN106755107A (en) * 2016-11-22 2017-05-31 上海健信生物医药科技有限公司 A kind of CAR recruits and its application in oncotherapy
CN108690832A (en) * 2017-04-12 2018-10-23 中国科学院苏州纳米技术与纳米仿生研究所 The capture of circulating tumor cell and method for releasing
CN107337737A (en) * 2017-07-18 2017-11-10 深圳市免疫基因治疗研究院 A kind of Chimeric antigen receptor and its application
CN110627909A (en) * 2019-08-28 2019-12-31 中国人民解放军第二军医大学 Chimeric antigen receptor for specifically activating NK cells and application thereof
CN113402590A (en) * 2021-07-14 2021-09-17 呈诺再生医学科技(珠海横琴新区)有限公司 KHL polypeptide and application thereof in preparation of TABP-EIC cells

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Lung Cancer-Targeting Peptides with Multi-subtype Indication for Combinational Drug Delivery and Molecular Imaging;Yi-Hsuan Chi;《Theranostics》;第7卷(第6期);第1612-1632页 *
Reforming the Chimeric Antigen Receptor by Peptide Towards Optimized CAR T Cells With Enhanced Anti-Cancer Potency and Safety;Cuijuan Liu;《Frontiers in Bioengineering and Biotechnology》;第10卷;第1-12页 *
抗肺癌相关多肽的研究进展;刘大路;《 临床肿瘤学杂志》;第15卷(第12期);第1139-1141页 *

Also Published As

Publication number Publication date
CN114249834A (en) 2022-03-29

Similar Documents

Publication Publication Date Title
CN110272493A (en) Target specific chimeric antigen receptor T cell of CD19 and preparation method thereof and clinical application
CN109836496A (en) It is a kind of to target the single-chain antibody of CD317, Chimeric antigen receptor T cell and its preparation method and application
WO2021155670A1 (en) Bispecific chimeric antigen receptor for treating hematological tumor complicated with hiv infection
CN110734498A (en) fusion protein for relieving immunosuppression and application thereof
CN105368859A (en) Chimeric antigen receptor hCD87-CAR, lentivirus carrying hCD87-CAR gene structure, plasmid and application of chimeric antigen receptor hCD87-CAR
CN114249834B (en) Chimeric antigen receptor capable of specifically targeting tumor cells, expressed gene thereof, modified NK cells and application thereof
CN111139222B (en) Recombinant mesenchymal stem cell and preparation method and application thereof
CN109836493A (en) It is a kind of to target the single-chain antibody of CD19, Chimeric antigen receptor T cell and its preparation method and application
CN105384826A (en) Cord blood nucleated cell for expressing chimeric antigen receptor and application of cord blood nucleated cell
CN105132371B (en) External method and the application thereof of offering, activate DC cell
CN110079502B (en) PD-L1CAR-NK cell and preparation and application thereof
CN111704674B (en) Chimeric antigen receptor targeting c-Met and autocrine PD-L1 scFv and application thereof
CN111560075B (en) Carrier containing double-target chimeric antigen receptor gene, CAR-T cell and application thereof
CN110526976A (en) It is a kind of to target the single-chain antibody of PSMA, Chimeric antigen receptor T cell and its preparation method and application
CN110157675A (en) A kind of targeting T lymphocyte and its preparation method and application
CN109957546A (en) A kind of Chimeric antigen receptor T cell and its preparation method and application targeting CD317
CN109837303A (en) A kind of Chimeric antigen receptor T cell and its preparation method and application for the targeting CD317 knocking out PD1
CN108753729B (en) Target cell for testing killing effect of TCR-T cell and preparation method and application thereof
CN114106199B (en) Chimeric antigen receptor targeting ADGRE2 and application thereof
CN109836500A (en) It is a kind of to target the single-chain antibody of DR5, Chimeric antigen receptor T cell and its preparation method and application
CN111139223B (en) RVG-CD70 CAR-T cell and preparation method and application thereof
WO2021036247A1 (en) Chimeric antigen receptor t cell targeting her2 and interfering with il-6 expression, preparation method therefor and use thereof
CN110144325A (en) A kind of targeting T lymphocyte and its preparation method and application
WO2021036245A1 (en) Chimeric antigen receptor t cell carrying safety switch and targeting egfrvⅲ, and preparation method therefor and use thereof
CN111286512A (en) Chimeric antigen receptor targeting humanized tyrosine kinase orphan receptor 1 and uses thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant