CN102199608B - Efficient expression of pinellia ternate agglutinin (PTA) in bombyx mori reactor - Google Patents

Abstract

The present invention belongs to the technical field of genetic engineering for producing protein drugs in the biotechnology pharmaceutical engineering. Pinellia ternate agglutinin (PTA) is efficiently expressed by using bombyx mori baculovirus. The recombined virus is inoculated into the larvae and the pupa of the domestic silkworm for expressing PTA through constructing recombined baculovirus containing PTA gene, separated, purified, froze and dried to preserve. A substantial effect for inhibiting liver cancer can be demonstrated by tests on animals, and the method becomes a novel method for preparing cancer treatment medicine. The invention has advantages of easy raw material obtaining, low production cost, easy large-scale mass production and good drug effect, which has quite wide application prospects in market development.

Description

The high efficient expression three leaf pinellia agglutinins of silkworm reactor

The present invention relates to and utilize the silkworm reactor to express preparation and the anticarcinogen activity research thereof of three leaf pinellia agglutinins (Pinellia ternata agglutinin, PTA).

Three leaf pinellia agglutinins (Pinellia ternata agglutinin, PTA) be a kind of three leaf pinellins with blood coagulation activity of separating from the three leaf tuber of pinellia, there is the character with seminose and the single-minded combination of polymkeric substance thereof, Recent study finds that three leaf pinellia agglutinins energy and eugonic liver cancer cell are in conjunction with making its aggegation and inducing its apoptosis, can suppress the mankind and animal retrovirus (comprising HIV), and also played the important pharmaceutical uses such as remarkable effect in reproduction and contraception, become the focus of Recent study.Baculovirus expression vector system is high eukaryotic expression system; since nineteen eighty-three creates; existing over one hundred kind of foreign gene is at this system expression; due to the protection of a large amount of albumen that silkworm lymph principal body is arranged and the effect of some unknown mechanisms; make the albumen that utilizes this system expression there is high activity; utilize the high efficient expression pharmaceutical protein of silkworm reactor, can there is equal medical active with natural pharmaceutical protein, there is great research application prospect.

Therefore this research adopt baculovirus expression vector system respectively in silkworm larva and silkworm chrysalis high efficient expression there are three leaf pinellia agglutinins of high pharmaceutical use, show that through animal experiment people's liver cancer is had to significant restraining effect, become a kind of novel method for preparing the disease medicaments such as treatment cancer.

The invention provides the escherichia coli plasmid pEasy T1-pta that contains three leaf Lectin Gene from Pinellia Ternatas, the total RNA extracted from the three leaf tuber of pinellia of take is template, by the RT-PCR technology, the clone obtains three leaf half hap genes, introduce restriction enzyme site Nco I and Xho I, TA is connected in T carrier pEasy T1, build cloning vector plasmids pEasy T1-pta, errorless through sequence verification.

The present invention also provides the silkworm baculovirus metastasis transplanting physique grain that contains three leaf Lectin Gene from Pinellia Ternatas pFastBac ^tMhTA-pta.The cloning vector plasmids pEasy T1-pta that will contain three leaf Lectin Gene from Pinellia Ternata fragments after Nco I and Xho I double digestion with transfer vector pFastBac through Nco I and Xho I double digestion ^tMhTA connects, the recombinant transfer vector plasmid pFastBac of acquisition ^tMhTA-pta.

The present invention also provides and has contained three leaf Lectin Gene from Pinellia Ternata recombinant Bombyx mori baculovirus Bm-Bac-pta.By recombinant transfer vector pFastBac ^tMhTA-pta is transformed into containing in the intestinal bacteria DH10Bac of viral DNA, by the fixed point swivel base, obtaining restructuring Bacmid DNA, by liposome-mediated transfection silkworm cultured cell, after obvious virus infection symptom occurring, gets supernatant results recombinant virus Bm-Bac-pta.

The present invention also provides the expression product of three leaf Lectin Gene from Pinellia Ternatas in silkworm larva and silkworm chrysalis.By recombinant Bombyx mori baculovirus Bm-Bac-pta transfection silkworm egg parent cell amplicon virus and improve its titre, then by the amplification after recombinant Bombyx mori baculovirus Bm-Bac-pta be seeded to five age silkworm larva and the silkworm chrysalis body in, reclaim silkworm lymph blood and pupal cell, separation and purification freeze-drying are preserved (with reference to " Silkworm, Bombyx mori larvae expressed the spider silk protein through a novel Bac-to-Bac/BmNPV baculovirus " Journal of Applied Entomology 2006; 130:297-301).

The present invention has also carried out bioactive evaluation to the expression product of three leaf Lectin Gene from Pinellia Ternatas.The biologic activity of expression product is similar to natural three leaf pinellia agglutinins, and rabbit blood is had to agglutination.

The present invention has carried out the Anticancer experiment to utilizing the silkworm reactor to express three leaf Lectin Gene from Pinellia Ternatas.Utilize three leaf pinellia agglutinins that baculovirus expression vector system expresses in silkworm larva and silkworm chrysalis to there is significant restraining effect to the people's of vitro culture liver cancer cell Bel-7402.

The invention provides following:

1. a leaf pinellia agglutinin (Pinellia ternata agglutinin, PTA) gene, PTA gene order (AY451854.1) comparison that itself and NCBI report shows the 24th, 25, 47, 56, 59, 67, 69, 72, 85, 90, 104, 108, 115, 127, 129, 133, 148, 149, 151, 177, 298, 241, 255, 264, 267, 273, 280, 281, 287, 288, 308, 311, 316, 325, 326, 327, 331, 348, 381, 412, 415, 416, 427, 433, 437, 441, 463, 470, 474, 475, 483, 485, 490, 504, 508, 511, 547, 550, 552, 562, 586, 598, 606, 634, 638, 648, 703, 706, 714, 741, 742, 744, 750, 766, 771, 772, 773, corresponding base such as 774 78 of grades has significant difference.

2.1 gene, its nucleotide sequence is the sequence shown in SEQ ID NO:1:

CTACGCAGCAATGGAGCGCTTCGAGTTGGTCTCAAAGATGGCAGGGCCGTAGATGACGCCGAAGCCGTTCTCTTGGAGGATGAAGACGTAGTCACCCTGCTTGGAGCTGGACTGGCTGCTCCAGATTGTCTTGAAGTTGTCGTCCTTGATGATGAGCTCGCCCTTGTGGCTCAGCCTGAGGAAGCAGTGGTCGCCGTTGCCGTGGGTGTTGGATTGCCAGCCGAATTTGCCGCCGTACAGGACCAGGTTGCAGTCGCCCTGCATCACGAGCTTGTGGTTCCTCGCCGTGAGCCTGCCGTCTTCGTGGAGGACTTGGCCGGAGAAGAGCATGTTGTCGGTGACAGGGATGTTGCCGAGCTGCCGCAGGCTGTTGAGGCCGGGGACCCAAGGGTTAATCTTGAAGACGGATGGGCCGTAGATGACCAGCTTCCCCTCCGGATGGACGACCAAGGCGTAGTCGCCCCTCTCGGACTGGGAGCCGCTCCTAAAGACGATGGATCCG TCGCCATTCTTGATGATGAGCTCGCCGCGGTTGGTGAGGGTGAGCTTGCAGTCCCGTCCTTTGTTGGCCGTGTTGGACTGCCAGTTGCCGTTGTAAAGGACGGCGTTGCAGTCTTCCTGCATTACCAAGTCGAAGTCGCCGTTCCTGAGATGGCCGTTCGTGTCCAGGATCTCGCCGGACAGCAGGTGGTTGGTGCCCACTGCCGCGGCTGCCCGGGGAATGACGAGGCCGAGGATGGCCGGGAGGAATAAGAGGAGGAGCTTGGAGGCCAT(SEQ ID NO：1)。

3. a protein, it is by 1 or 2 described gene orders codings.

4. a recombinant vectors, it comprises 1 or 2 described gene nucleic acid sequences.

5.4 described recombinant vectors, it is based on pEasy T1, pFastBac ^tMhTA, pFastBac ^tMhTB, pFastBac ^tMhTC or pFastBac ^tM1 structure.

6. a silkworm host cell, it can express 1 or 2 described gene nucleic acid sequences under applicable expression condition.

7.6 described silkworm host cell, it is the ovocyte BmN that takes from silkworm (Jingsong×Haoyue strain).

8. a recombinant Bombyx mori baculovirus, it is to be transformed into containing in the competent cell of viral DNA, by the fixed point swivel base, obtaining restructuring Bacmid DNA by the recombinant vectors by 4 or 5, by liposome-mediated transfection silkworm egg parent cell, after obvious virus infection symptom occurring, get that supernatant reclaims and obtain.

9.8 described recombinant Bombyx mori baculovirus, the described competent cell containing viral DNA is intestinal bacteria DH10 Bac.

10.8 described recombinant Bombyx mori baculovirus, described silkworm egg parent cell is the BmN cell.

11.8 described recombinant Bombyx mori baculovirus, it is in the center preservation of China Committee for Culture Collection of Microorganisms's common micro-organisms, and preserving number is CGMCC No:3677.

12.1 or 2 described gene orders, 3 described protein, 4 or 5 described recombinant vectorss, 6 or 7 described silkworm host cells, the described recombinant Bombyx mori baculovirus of 8-11 is for the preparation of the application of antitumor drug.

13.12 application, wherein said tumour is liver cancer.

14.13 application, wherein said liver cancer cell is Bel-7402.

15. the shaft-like virus expression systems of silkworm reactor, wherein by the recombinant Bombyx mori baculovirus transfection silkworm egg parent cell amplicon virus of 8-11 and improve its titre, then the recombinant Bombyx mori baculovirus after amplification is seeded to the expression of carrying out three leaf pinellia agglutinins in silkworm larva and silkworm chrysalis body, reclaim silkworm lymph blood and pupal cell, separation and purification freeze-drying are preserved.

16., according to the shaft-like virus expression systems of 15 described silkworm reactor, wherein said silkworm egg parent cell is Bombyx noriN cell.

17., according to the shaft-like virus expression systems of 15 described silkworm reactor, the wherein said recombinant Bombyx mori baculovirus that contains three leaf Lectin Gene from Pinellia Ternatas is Bm-Bac-pta, its structure is by by recombinant transfer vector pFastBac ^tMhTA-pta is transformed into containing in the intestinal bacteria DH10Bac of viral DNA, by the fixed point swivel base, obtaining restructuring Bacmid DNA, by liposome-mediated transfection silkworm egg parent cell, after obvious virus infection symptom occurring, get supernatant and reclaim to obtain that recombinant Bombyx mori baculovirus carries out.

18. one kind is utilized the shaft-like virus expression systems of silkworm reactor of any one in 15-17 to express three leaf Lectin Gene from Pinellia Ternatas and the method for the preparation of antineoplastic protein medicaments by described expression product.

19.18 method, wherein said tumour is liver cancer.

To sum up, three leaf pinellia agglutinins of the expression in silkworm larva and silkworm chrysalis have high pharmaceutical use; Silkworm is can the low-cost extensive economic insects of raising; multiple natural protein protective material is arranged in the silkworm body; expression product is had to provide protection; make gene expression product very stable; be easy to extensive High-efficient Production; and the pharmaceutical protein structure function at this system expression is close with natural pharmaceutical protein, and have very high medical active, research and market development application prospect are very wide.

It should be noted that the silkworm host cell that comprised in the present invention, refer to the somatocyte of silkworm.

The accompanying drawing explanation:

Fig. 1 pFastBac ^tMthe HTA-pta enzyme is cut and is identified and PCR evaluation figure; It is 0.8% agarose electrophoresis figure.

Fig. 2 Bacmid-pta take M13 as primer, PAHL be primer PCR evaluation figure.

Fig. 3 recombinate Bacmid/BmNPV/pta take M13 as primer, PAHL be primer PCR evaluation figure.

Fig. 4 Bacmid-pta DNA transfection bombyx mori cell comparison diagram of recombinating; Wherein A figure is negative control figure (10 * 10); B figure is the cell picture (10 * 10) of transfection after five days, and C figure is negative control figure (20 * 10); D figure is the cell picture (20 * 10) of transfection after five days.

Figure is identified in the 12%Tris-glycine SDS-PAGE gel electrophoresis of Fig. 5 PTA fusion rotein.

The microphotograph figure of the purified rear aggegation rabbit erythrocyte of Fig. 6 PTA.A is normal rabbit erythrocyte (negative control); B is the rabbit erythrocyte microgram added after PTA solution.

The inhibition figure of the PTA that Fig. 7 utilizes mtt assay to detect to express in silkworm to liver cancer cell.

Fig. 8 pta gene order provided by the invention and the pta gene order BLAST comparison result figure reported.

Fig. 9 is containing pta gene recombination cloning vector plasmids pEasy T1-pta.

Figure 10 is containing the recombinant Bombyx mori baculovirus metastasis transplanting physique grain pFastBac of pta gene ^tMhTA-pta.

The present invention constructed containing the recombinant Bombyx mori baculovirus PTA silkworm-P4 of three leaf Lectin Gene from Pinellia Ternatas on April 2nd, 2010 at China Committee for Culture Collection of Microorganisms's common micro-organisms center (No. 3, No. 1, Chaoyang District Beijing North Star West Road institute, Institute of Microorganism, Academia Sinica, 100101) carried out preservation, deposit number is CGMCC No:3677.

specific embodiments

Below embodiments of the invention are elaborated: as prerequisite under implemented take by technical solution of the present invention for the present embodiment, provided detailed embodiment and concrete operating process.

Embodiment 1

recombinant transfer vector plasmid pFastBac ^tM the structure of HTA-pta, screening and evaluation

1. utilize RT-PCR to clone from three leaf tuber of pinellia stem tubers and obtain three leaf Lectin Gene from Pinellia Ternatas (SEQ ID NO:1), build recombinant cloning vector plasmid pEasy T1-pta, and be converted in E.coli DH5 α and increase, extract containing the cloning vector plasmids pEasy T1-pta (TransGen) of goal gene (SEQ ID NO:1) and the metastasis transplanting physique grain pFastBac of baculovirus expression system ^tMhTA (Invitrogen).

2. by above-mentioned plasmid double digestion, system is as follows:

3. by the pta fragment of purifying (SEQ ID NO:1) and pFastBac ^tMthe HTA fragment connects, and reaction conditions is as follows:

2×ligase Buffer 5μL

Pta fragment 3 μ L

T4 DNA Ligase 1μL

pFastBac HTA 1μL

4 ℃ of connections are spent the night.

4. get above-mentioned connection product 5 μ L, be added in 200 μ L E.coli DH5 α competent cell suspensions, mix gently, place 30min on ice; 42 ℃ of water-bath heat shock 90sec, take out and put cooled on ice 3-5min rapidly; Add the LB liquid nutrient medium (containing microbiotic) of 37 ℃ of preheatings of 1mL, mix rear 37 ℃ of water-bath 1h, make the bacterium state that restore normal growth; The centrifugal 10min of 4000rpm, abandon the 1mL supernatant, precipitates after resuspended to get approximately 200 μ L and evenly coat on the LB flat board containing Amp and Gen, and 37 ℃ face up and place 30min, are inverted after bacterium liquid is absorbed by substratum fully and cultivate 10-16h.

5. with the single bacterium colony of the aseptic toothpick white that 3 growth conditions of picking are good from transforming flat board, be inoculated in respectively in the 5mL LB liquid nutrient medium containing Amp and Gen 50 μ g/mL, 37 ℃, 220rpm shaking culture 8-10h;

6. get respectively the 1.5mL nutrient solution and pour in 1.5mL Eppendorf pipe, 4 ℃, the centrifugal 30sec of 12000rpm;

7. abandon most supernatant, bacterial sediment is resuspended in 100 μ L solution I (25mMTris-HCl, 10mM EDTA, 50mM Glucose) of precooling, and the vortex vibration mixes; Ice bath 10min;

8. add freshly prepared solution II (200mM NaOH, 1% (w/v) SDS) 200 μ L, leniently put upside down the Eppendorf pipe 5 times, ice bath 5min, make solution become clarification;

9. the solution III (3M KOA, the 5M CH that add 150 μ L precoolings ₃cOOH), and be inverted centrifuge tube, vibration 30sec, ice bath 5min, 4 ℃, the centrifugal 10min of 12000rpm;

10. careful sucking-off supernatant liquor proceeds in clean Eppendorf pipe, adds isopyknic phenol: chloroform: primary isoamyl alcohol (25: 24: 1), and put upside down and mix, 4 ℃, the centrifugal 5min of 12000rpm;

11. supernatant liquor is moved in clean Eppendorf pipe, add the dehydrated alcohol of 2 times of volumes and the 3mol/L NaAc (pH5.2) of 1/10 volume, put upside down and mix rear room temperature placement 5min;

12.4 ℃, the centrifugal 10min of 12000rpm;

13. abandon supernatant, add 70% ethanol of 1mL precooling to wash precipitation once, vacuum-drying 5min or drying at room temperature; The plasmid precipitation obtained is dissolved in to the aseptic ddH of 50 μ L ₂o, add RNaseA (20 μ g/mL), and 37 ℃ of water-bath 30-60min, take a morsel respectively by the purity of 0.8% agarose gel electrophoresis Detection and Extraction plasmid, and other is in-20 ℃ of preservations.Recombinant plasmid is according to different carrier called afters: pFastBac ^tMhTA-pta.

14. using the plasmid that extracts as template, carry out the PCR evaluation.

PAHL primer 1：

5’-GGACCATGGATGGCCTCCAAGCTCCTCC-3’

PAHL primer 2：

5’-GGACTCGAGCTACGCAGCAATGGAGCGC-3’

The PCR reaction system is:

The response procedures of PCR is:

94℃5min；94℃45sec，65℃45sec，72℃45sec，30cycles；72℃10min

15.PCR be accredited as positive plasmid, further identify by the method for double digestion.

In aseptic Eppendorf pipe, add successively:

After 37 ℃ of incubation 4h, detect enzyme with 0.8% agarose gel electrophoresis and cut result.

16.pFastBac ^tMthe HTA-pta enzyme cut and the PCR qualification result as shown in Figure 1, agarose gel electrophoresis figure result is from left to right Marker successively, pFastBac ^tMthe HTA-pta enzyme is cut result, pFastBac ^tMhTA-pta PCR qualification result band.Enzyme is cut with PCR and is identified that corresponding band conforms to theoretical value.

Embodiment 2

the restructuring Bacmid-pta structure and obtain

1. get the recombinant plasmid pFastBac of the above-mentioned structure of 5 μ L ^tMhTA-pta, be added in 200 μ LDH10Bac competent cell suspensions, mixes gently, places 30min on ice;

2.42 ℃ water-bath heat shock 45sec, take out and put cooled on ice 3-5min rapidly;

3. add the LB liquid nutrient medium (containing microbiotic) of 37 ℃ of preheatings of 1mL, mix rear 37 ℃ of water-bath 4h, make the bacterium state that restore normal growth;

4. by the centrifugal 10min of bacterium liquid 4000rpm transformed, abandon the 1mL supernatant, precipitate after resuspended and get approximately 200 μ L nutrient solutions.

5. get 100 times of 20 μ L bacterium liquid dilutions, then add 5 μ L X-gal and 5 μ L IPTG to mix, get bacterium liquid 100-200 μ L and coat LB flat board (containing Tet, Gen, Kan) above, 37 ℃ of lucifuges that face up are placed 30min, be inverted lucifuge and cultivate 48h after bacterium liquid is absorbed by substratum fully.As the restructuring donor plasmid pFastBac that contains foreign gene ^tMhTA-pta transforms DH10Bac competent cell (Invitrogen) (this cell contains baculovirus shuttle vectors Bacmid, Kanr and replicon and LacZ peptide section encoding gene), foreign gene in donor plasmid is under the transposase effect of helper plasmid coding, be inserted in the Baculovirus Gene group by swivel base, destroyed the expression of LacZ.By the culture plate screening that contains kantlex, gentamicin, tsiklomitsin and X-gal, the Bacmid of restructuring (being recombinant virus genomes) transformant bacterium colony is white in color, but not restructuring Bacmid transforms bacterium colony, is blue.

6. the single bacterium colony of DH10Bac transformant white that 4 growth conditions of picking are good from blue hickie screening is dull and stereotyped with aseptic toothpick, be inoculated in respectively in the 5mL LB liquid nutrient medium containing 50 μ g/mLl Kan, 7 μ g/mL Gen and 10 μ g/mL Tet, 37 ℃, 220rpm shaking culture 8-10h.To be put into 4 ℃ of refrigerators after stable standby Deng bacterial classification; 7. get respectively the 1.5mL nutrient solution and pour in 1.5mL Eppendorf pipe, 4 ℃, the centrifugal 1min of 14000rpm;

8. abandon most supernatant, bacterial sediment is resuspended in 300 μ L solution I (25MmTris-HCl, 10mM EDTA, 50mM Glucose) of precooling, with the piping and druming gently repeatedly of imbibition rifle;

9. add freshly prepared solution II (200mM NaOH, 1% (w/v) SDS) 300 μ L, piping and druming, mix it gently;

10. slowly add the liquor kalii acetici that 300 μ L pH values are 5.5, the limit edged mixes gently, ice bath 5-10min;

11. under 4 ℃, the centrifugal 10min of 14000rpm;

12. supernatant liquor is transferred in new Eppendorf pipe gently, add 800 μ L Virahols, and repeatedly be inverted gently, liquid is fully mixed, then ice bath 5-10min.Room temperature, the centrifugal 15min of 14000rpm;

13. carefully remove supernatant liquor, add the ethanol of 500 μ L 70%, the Eppendorf pipe is inverted several times repeatedly gently, liquid is fully mixed;

14. the centrifugal 5min of 14000rpm at room temperature.Repeat the 7-8 step;

15. supernatant liquor is fully removed and, carefully in case the dissolving once again of restructuring Bacmid DNA is at room temperature placed 5-10min by the DNA be settled out and dried, must guard against overdrying;

16. will recombinate, Bacmid DNA is dissolved in 1 * TEBuffer that 40 μ L pH values are 8.0 again, avoids acutely shaking in case DNA break.Allow to jiggle the DNA that is positioned at Eppendorf pipe bottom is fully dissolved;

17. restructuring Bacmid DNA is stored under 4 ℃ of environment, for analysis or for being transfected into bombyx mori cell, by described restructuring Bacmid DNA called after Bacmid-pta.

18. using the Bacmid-pta that extracts as template, by M13 upstream primer and the M13 downstream primer purpose fragment that increases, carry out the PCR evaluation.

The M13 upstream primer: 5 '-GTTTTCCCAGTCACGAC-3 '

The M13 downstream primer: 5 '-CAGGAAACAGCTATGAC-3 '

The PCR reaction system is:

The response procedures of PCR is:

93℃3min；94℃45sec，58℃45sec，72℃5min，30cycles；72℃7min

19. the PCR qualification result of restructuring Bacmid-pta as shown in Figure 2, respectively to the M13 universal primer, the Auele Specific Primer pcr amplification is identified.Shown in figure, be from left to right Marker successively, take M13 as the primer qualification result, the qualification result that the PAHL of take is Auele Specific Primer, its qualification result all conforms to theoretical value.

Embodiment 3

the acquisition of recombinant Bombyx mori baculovirus (recombinant Bacmid/BmNPV/pta)

1. silkworm egg parent cell BmN (purchased from Shanghai cell research institute of the Chinese Academy of Sciences) cultivates at the Grace ' s substratum (Invitrogen) that contains foetal calf serum in the CO of 27 ℃ ₂cultivate in cell culture incubator, cover incubation time 24h-36h to 35mm Tissue Culture Dish (Invitrogen) more than 80%;

2. abandon substratum, add 1mL not contain the Grace ' s substratum of foetal calf serum, 27 ℃ of standing 30min are again adherent to cell;

3. get 10 μ L Cellfectin liposomes (Invitrogen) and mix with the Grace ' s substratum that 250 μ L do not contain foetal calf serum, standing 5min under room temperature;

4. be taken at the Grace ' s substratum that the Bacmid-pta DNA (3 μ g) that builds in above-described embodiment and 250 μ L do not contain foetal calf serum, flick to put upside down and mix, standing 5min;

5. the Cellfectin liposome (Invitrogen) after dilution is joined in the restructuring Bacmid DNA of above-mentioned dilution, put upside down and mix gently, standing 20min;

6. take out 35mm Tissue Culture Dish (Invitrogen), discard insect cell substratum (Invitrogen), drip immediately the mixed solution in step 5, gently shake culture dish, it is uniformly distributed, cultivate 4h for 27 ℃;

7. take out above-mentioned culture dish, add the Grace ' s substratum 2mL that contains foetal calf serum, 27 ℃ are continued to cultivate, and after 72h, cell starts to suspend, and after 120h, this phenomenon is more obvious.Illustrate that bombyx mori cell falls ill, the success of Bacmid-pta transfection silkworm egg parent cell, produce the P1 virus strain;

8. get the cell 5ml of above-mentioned morbidity, it is mixed gently, and transfer in aseptic Eppendorf pipe.The centrifugal 5min of 500rpm, carefully get supernatant liquor (being the P1 virus strain).

9. the titre of P1 virus strain is preset as to 5 * 10 ⁶pfu/mL is that 0.1pfu/cell infects 4 * 10 by MOI ⁶healthy Bombyx noriN cell, calculate the volume of required P1 virus strain:

$V_{\left(p1\right)}=\frac{0.1\×4\×{10}^6}{5\×{10}^6}\mathrm{ml}=0.08\mathrm{ml}$

Get 80 μ LP1 and infect healthy bombyx mori cell, results P2 virus strain after 72h.The P4 virus strain obtained has thus sent China Committee for Culture Collection of Microorganisms's common micro-organisms center to carry out preservation, and preserving number is CGMCC No:3677.

10. in the silkworm egg parent cell BmN that the Bacmid DNA of restructuring or recombinant virus is seeded in to adherent culture, after the morbidity of cell infection virus, cell will suspend, and as shown in Figure 4, it is large that the cell rounding of virus infection becomes, and suspend.Restructuring Bacmid/BmNPV/pta be take M13 as primer, PAHL identify as primer PCR, as shown in Figure 3, is from left to right Marker successively, the evaluation band that the M13 of take is primer, and the evaluation band that the PAHL of take is primer, stripe size all conforms to theoretical value.

Embodiment 4

obtain target protein

I、

1. dip the cell conditioned medium (about 5 * 10 behind the restructuring Bacmid/BmNPV/pta virus 5 sky that infects above-mentioned acquisition with inoculating needle ⁴pFU recombinant virus particle), subcutaneous from (Jingsong×Haoyue strain) silkworm chrysalis (purchased from Zhongqi Biological Pharmaceutical Co., Ltd., Zhejiang) belly the 5th and the 6th internode puncture access with inoculating needle.Cultivate in 27 ℃ of thermostat containers, treat virus amount reproduction in the silkworm chrysalis body.After about 168h, silkworm chrysalis internode obvious tumefaction, the pupal cell deliquescing, illustrate that silkworm chrysalis falls ill, collects the silkworm chrysalis of recombinant virus infection, lyophilize;

2. by cryodesiccated silkworm chrysalis grind into powder, the PBS damping fluid suspends, ultrasonication, and 4 ℃, the centrifugal 10min of 10000r/min, get supernatant-20 ℃ and save backup and get a little SDS-PAGE detected through gel electrophoresis;

3. Sefinose-6B (purchased from Shanghai traditional Chinese medicines company) the dress post (1.6 * 50cm) of learning from else's experience and processing, use the physiological saline balance.By the affinity chromatography sample physiological saline equilibrium dialysis obtained in step 2, concentrated rear upper prop, with identical physiological saline wash-out, flow velocity is 1mL/min, carries out the half-peak collection, and the sample of collection is all got to a little SDS-PAGE detected through gel electrophoresis;

4. in adding 4mL step 3 in the purification column of the purification column matrix of the nickel NTA sepharose matrix that contains 1mL 50%, gained, containing the protein solution at the corresponding peak of target protein, mixes in 4 ℃ in conjunction with 2h;

5. nickel NTA sepharose affinity column is fixing on the certain altitude upholder, and upper cover is opened bottom and is prepared to be collected with the EP pipe;

6. the pillar bottom is opened, the EP pipe is collected effluent liquid;

7. add the resuspended matrix of 5mL Binding Buffer (20mM Tris-HCl, 500mM NaCl), room temperature is placed 2min, discards effluent liquid;

8. add the resuspended matrix of 5mL Wash Buffer (20mM Tris-HCl, 500mM NaCl, 50mM Imidazde), room temperature is placed 2min, discards elutriant;

9. add the resuspended matrix of 2mL Elution Buffer (20mM Tris-HCl, 500mM NaCl, 500mM Imidazde), room temperature is placed 2min, collects elutriant, concentrated and SDS-PAGE gel electrophoresis check.

II、

Dip the cell conditioned medium (about 5 * 10 infected behind the restructuring Bacmid/BmNPV/pta virus 5 sky obtained in embodiment 3 with inoculating needle ⁴pFU recombinant virus particle), subcutaneous from (Jingsong×Haoyue strain) silkworm larva in five ages (purchased from Zhongqi Biological Pharmaceutical Co., Ltd., Zhejiang) belly the 5th and the 6th internode puncture access with inoculating needle.Cultivate in 27 ℃ of thermostat containers, treat virus amount reproduction in the silkworm larva body.After about 168h, silkworm larva internode obvious tumefaction, illustrate that silkworm larva falls ill, collects lymph blood, is dissolved in dilution buffer liquid (10mM NaH ₂pO ₄, 300mMNaCl, 8M urea; PH 8.0), the centrifugal 30min of 12,000 * g, supernatant liquor be stored in-80 ℃ standby.Purge process is with I joint 3 to 9 steps.

As shown in Figure 5, size is about 29KDa to above-mentioned assay, with theoretical value, conforms to, obtain should be the restructuring three leaf pinellia agglutinin proteins.

Embodiment 5

the blood coagulation activity of the three leaf pinellia agglutinin proteins that the present invention obtains is identified.

It is 40 μ gml that the restructuring of purifying in embodiment 4 three leaf pinellia agglutinin proteins are diluted to concentration ^-1, upper with 2 times of gradient dilutions of 0.85% physiological saline work at 96 orifice plates (Thermo).Add 10 μ l samples on slide glass, equal-volume mixes 2% rabbit erythrocyte (purchased from Hangzhou Pedagogic University's Experimental Animal Center), and room temperature is placed the 5-10min left and right, the lower blood clotting effect that detects of high power lens (40 *).Make blank with physiological saline.As shown in Figure 6, the rabbit erythrocyte state of A figure negative control group is normal for qualification result; B figure adds the rabbit erythrocyte after restructuring three leaf pinellia agglutinin protein solution agglutination to occur.

Embodiment 6

utilize mtt assay (with reference to " utilize mtt assay with Spiro Enol Ether Analogues to insect cell Virulence Selection and mensuration " Agricultural University Of South China's journal 2000; 21:29-32) antineoplastic activity of the three leaf pinellia agglutinins of recombinating detected.

The liver cancer cell Bel-7402 (purchased from Shanghai cell research institute of the Chinese Academy of Sciences) cultivated is inoculated in sub 96 well culture plates (Thermo), and concentration is 2 * 10 ⁴/ ml.180 μ l are inoculated in every hole, add the restructuring three leaf pinellia agglutinins (sample dissolves with PBS) of above-mentioned preparation after continuation cultivation 24h.The application of sample final concentration is divided into 0.025mg/ml, 0.050mg/ml, 0.100mg/ml (volume is 20 μ l).The every hole of control group adds 20 μ l PBS.Continue to cultivate after 24h every hole and add MTT (take tetrazolium bromide 0.5 gram, be dissolved in the phosphoric acid buffer (PBS) of 100ml or without in phenol red substratum) solution 20 μ l, 37 ℃, hatch 4h.After carefully sucking the nutrient solution in 96 orifice plates.Every hole adds 200 μ l DMSO.The 5min that vibrates on constant temperature oscillator measures each hole OD value in microplate reader (Multiskan MK3 microplate reader).Measuring wavelength is that 492nm. calculates the growth inhibition ratio of each extract to tumour cell.Growth inhibition ratio (%)=(the average OD value of the average OD value/control group of the average OD value-experimental group of control group) * 100%.Utilize mtt assay to the antineoplastic active result detected of the three leaf pinellia agglutinins of recombinating as shown in Figure 7, the restructuring pinellia agglutinin that the present invention obtains is inhibited to liver cancer cell Bel-7402, and inhibition is strengthened along with the increase of the protein concentration added.

Claims (13)

1. a leaf pinellia agglutinin (Pinellia ternata agglutinin, PTA) gene, its nucleotide sequence is the sequence shown in SEQ ID NO:1:

2. a protein, it is encoded by gene order claimed in claim 1.

3. a recombinant vectors, it comprises gene nucleic acid sequence claimed in claim 1.

4. recombinant vectors claimed in claim 3, it is based on pEasy T1, pFastBac ^tMhTA, pFastBac ^tMhTB, pFastBac ^tMhTC or pFastBac ^tM1 structure.

5. a recombinant Bombyx mori baculovirus, it is to be transformed in intestinal bacteria DH10Bac competent cell and to obtain restructuring Bacmid DNA by the fixed point swivel base by the recombinant vectors by claim 3 or 4, by liposome-mediated transfection silkworm egg parent cell, after obvious virus infection symptom occurring, get that supernatant reclaims and obtain.

6. recombinant Bombyx mori baculovirus claimed in claim 5, wherein said silkworm egg parent cell is the BmN cell.

7. recombinant Bombyx mori baculovirus claimed in claim 5, it is in the center preservation of China Committee for Culture Collection of Microorganisms's common micro-organisms, and preserving number is CGMCC No:3677.

8. gene order claimed in claim 1, protein claimed in claim 2, the described recombinant vectors of claim 3 or 4, the described recombinant Bombyx mori baculovirus of claim 5-7 is for the preparation of the application of medicines resistant to liver cancer.

9. the application of claim 8, wherein said medicines resistant to liver cancer for liver cancer cell be Bel-7402.

10. a method of expressing three leaf pinellia agglutinins, described method comprises the recombinant Bombyx mori baculovirus transfection silkworm egg parent cell amplicon virus of claim 5-7 and improves its titre, then the recombinant Bombyx mori baculovirus after amplification is seeded to the expression of carrying out three leaf pinellia agglutinins in silkworm larva and silkworm chrysalis body, reclaim silkworm lymph blood and pupal cell, separation and purification freeze-drying are preserved.

11. method according to claim 10, wherein said silkworm egg parent cell is Bombyx noriN cell.

12. method according to claim 10, the wherein said recombinant Bombyx mori baculovirus that contains three leaf Lectin Gene from Pinellia Ternatas is Bm-Bac-pta, and its structure is by by recombinant transfer vector pFastBac ^tMhTA-pta is transformed into containing in the intestinal bacteria DH10Bac of viral DNA, by the fixed point swivel base, obtaining restructuring Bacmid DNA, by liposome-mediated transfection silkworm egg parent cell, after obvious virus infection symptom occurring, get supernatant and reclaim to obtain that recombinant Bombyx mori baculovirus carries out.

13. one kind is utilized the method for any one in claim 10-12 to express three leaf Lectin Gene from Pinellia Ternatas and the method for the preparation of the protein medicaments of anti-liver cancer by described expression product.

Images