CN103290041A

CN103290041A - Construction of factor C from tachypleus tridentatus pronucleus and insect baculovirus recombinant expression vector

Info

Publication number: CN103290041A
Application number: CN2012100461009A
Authority: CN
Inventors: 牟宗春; 高雪超; 郭恒昌; 庄家麟; 周康
Original assignee: SHANGHAI BAISHENG BIOTECHNOLOGY Co Ltd
Current assignee: SHANGHAI BAISHENG BIOTECHNOLOGY Co Ltd
Priority date: 2012-02-27
Filing date: 2012-02-27
Publication date: 2013-09-11

Abstract

The invention relates to the field of biotechnology, in particular to construction of a gene prokaryotic cell and insect cell expression plasmid of a factor C from tachypleus tridentatus. The gene sequence of the factor C from tachypleus tridentatus is shown by SEQ ID No.1 and consists of 3057bp; and the two ends of a primer for cloning respectively contain an NcoI enzyme digestion site and an NotI enzyme digestion site. The gene of the factor C from tachypleus tridentatus is cloned into a prokaryotic expression vector pET28a and a baculovirus expression vector pFASTBacHTA, and the DNA (deoxyribonucleic acid) sequencing proves that the sequence cloning is correct. The method successfully constructs a prokaryotic recombinant expression plasmid pET28a-FC and a baculovirus recombinant expression plasmid pFASTBacHTA-FC of the factor C from tachypleus tridentatus. The invention provides a new method for the heterogeneous expression of the factor C from tachypleus tridentatus, and also lays a foundation for the follow-up research and application of a large amount of expression of the factor C from tachypleus tridentatus in prokaryotic cells and insect cells.

Description

The structure of Tachypleus tridentatus C factor protokaryon and insect baculovirus recombinant expression vector

Technical field:

The present invention relates to the genetically engineered field, Tachypleus tridentatus C factor gene is at the plasmid construction of prokaryotic cell prokaryocyte and insect cell expression carrier specifically.

Background technology:

The clinical transfusion reaction is maximum with pyrogen reaction harm, and incidence is the highest.Intracellular toxin (is the lipopolysaccharide molecule of gram-negative bacteria cell wall, lipopolysaccharide, LPS) be that studying the most thorough also is modal biological pyrogen, the difficult problem that must face of each big pharmaceutical factory especially simultaneously, even because when injection other trace of pg level LPS, also can cause the pyrogen reaction of serious patient.Therefore, sensitive intracellular toxin diagnostic techniques reliably is very necessary.

The amebocyte (amoebocytes) of sea king crab has superpower susceptibility to LPS, and when gram negative bacterium was invaded, it can pass through series of enzymatic reactions, and external invading bacteria is produced the cascade agglutination reaction, makes the microorganism inefficacy (1,2) of invasion.This process comprises the C factor (Factor C) identification of proenzyme state and is activated in conjunction with intracellular toxin, after becoming the state of organized enzyme, B factor activator with the downstream, the B factor of activation is converted into Thrombin coagulase with proclotting enzyme, Thrombin coagulase is converted into solidifying egg white with coagulagen, solidifying egg white is cross-linked with each other dehydration and forms gel (3,4).

Whether the tachypleus amebocyte lysate of utilizing extra large limulus blood amebocyte solute to make can be accurately and rapidly contains bacterial endotoxin in the qualitative or detection by quantitative sample.From the mid-1970s in last century, this intracellular toxin testing method begins for field of medicaments, and is extensively adopted by countries in the world very soon, and Chinese Pharmacopoeia and American-European pharmacopeia are decided to be legal bacterial endotoxins test with it.Through development and the improvement of decades, the tachypleus amebocyte lysate test method for endotoxin has been applied to each big field (5) such as pharmacy, medicine equipment, non-oral preparations, pharmaceutical products, biotechnological formulation, water quality, food inspection and scientific research.

Four kinds of extra large king crabs are only arranged at present in the world, i.e. U.S. king crab (Limulus polyphemus), Tachypleus tridentatus (Tachypleus tridentatus), tachypleus gigas (Tachypleus gigas) and rounded tail king crab (Carcinoscorpius rotundicauda).And can be used in that tachypleus amebocyte lysate produces two kinds of U.S. king crab and Tachypleus tridentatus are only arranged, corresponding tachypleus amebocyte lysate is referred to as LAL (Limulus amoebocyte lysate) and TAL (Tachypleus Amebocyte Lysate) respectively, the two reaction principle and effect are identical, but the difference that also has physicochemical property, as with (6) such as optimum pHs of intracellular toxin reaction.

Though tachypleus amebocyte lysate detection method (LAL/TAL) has highly sensitive (can detect fly gram level an intracellular toxin), advantage such as quick, because the cell lysate of employing complicated component as reaction raw materials, has the defective that can't overcome equally.Such as, non-specific interference problem: tachypleus amebocyte lysate also can be reacted (1) with (1-3)-callose except reacting with intracellular toxin.(1-3)-callose is a kind of polysaccharide that extensively exists in fungi, yeast, mushroom, higher plant, is the structure macromole that constitutes cell walls.Therefore be easy to run into the non-specific interference of (1-3)-callose in the tachypleus amebocyte lysate testing process, cause false positive results, this is for the medicine of complicated component, and especially Chinese medicine is a very big detection challenge (7).For another example, batch stability problem: tachypleus amebocyte lysate adopts extra large limulus blood as raw materials for production, because differences such as season, region make batch difference of tachypleus amebocyte lysate become common phenomenon.And the population quantity sharply minimizing in recent years owing to reasons such as environmental pollution, overfishing sea king crab approaches extinction (8), makes the starting material of production tachypleus amebocyte lysate face deficient day by day danger.

The main component of tachypleus amebocyte lysate is a series of serine stretch protein proenzyme (9,10), wherein the C factor is key molecule in the intracellular toxin detection method, in the king crab hemagglutination reaction system of endotaxin mediate, its specific recognition intracellular toxin, and first is activated by intracellular toxin, thereby starts the coagulation cascade reaction (11,12) in the whole limulus blood cell.Therefore, with the key molecule C factor of tachypleus amebocyte lysate as the basis, utilize its identification and in conjunction with behind the intracellular toxin, be activated as the organized enzyme form by pepsinogen, thereby characteristics that can the hydrolysis luminous substrate in conjunction with chemistry/fluorescence radiation quantitative technique, can develop with the C factor and detect quantitative technique (13) as the intracellular toxin of single component, compare with traditional LAL determination techniques, the recombinant C factor has lower background, higher sensitivity (14) to intracellular toxin under identical analysis condition.

Intracellular toxin detection technique composition based on the C factor is single, can use biotechnology to produce and strict quality, thereby has avoided batch unstable that caused by starting material, has protected these ancient " living fossil " species of extra large king crab simultaneously.Particularly importantly, this new technology has been eliminated traditional tachypleus amebocyte lysate to the nonspecific reaction of (1-3)-callose, can strengthen the specificity that intracellular toxin detects greatly, reduces " false positive " result's probability of occurrence.In addition, by with endotoxic specific combination, the recombinant C factor can also further be applied to endotoxin removals such as pharmaceutical prod, biological products.

To sum up, utilize the bionic method heterogenous expression king crab C factor, to be applied to the product development of intracellular toxin detection reagent, have important clinical meaning and huge commercial value.

Reference:

1.Iwanaga，S.(1993)Curr Opin Immunol 5，74-82

2.Muta，T.，and Iwanaga，S.(1996)Curr Opin Immunol 8，41-47

3.Ding，J.L.，and Ho，B.(2001)Trends Biotechnol 19，277-281

4.Iwanaga，S.，and Lee，B.L.(2005)J Biochem Mol Biol 38，128-150

5.Novitsky，T.J.(1994)J.Endotoxin Res 1，253-263

6. high international politics, Yan Jin. (1998) Chinese Pharmaceutical Journal 33 (3), 162

7. Huo Qi record, Shao Hongxia. (2003) CHINA JOURNAL OF CHINESE MATERIA MEDICA 28 (03), 199-201

8.Widener，J.W.，and Barlow，R.B.(1999)Biol Bull 197，300-302

9.Muta，T.，and Iwanaga，S.(1996)Curr Opin Immunol 8，41-47

10.Iwanaga，S.(1993)Curr Opin Immunol 5，74-82

11.Nakamura，T.，Morita，T.，and Iwanaga，S.(1986)Eur J Biochem 154，511-521

12.Iwanaga，S.，Miyata，T.，Tokunaga，F.，and Muta，T.(1992)Thromb Res 68，1-32

13.Ding，J.L.，and Ho，B.(2010)Subcell Biochem 53，187-208

14.Ding，J.L.，and Ho，B.(2001)Trends Biotechnol 19，277-281

Summary of the invention:

The structure that provides two kinds to be respectively applied to the expression plasmid of protokaryon and the expressed in insect cells Tachypleus tridentatus C factor is provided the object of the invention.

For achieving the above object, the technical solution used in the present invention is:

Preparation Tachypleus tridentatus C factor gene inserts fragment: (1) gene order is 3057bp, has the base sequence among the sequence table SEQ ID NO.1, and there are NcoI and NotI restriction enzyme site in two ends, do not contain terminator codon.(2) gene order is 3057bp, has the base sequence among the sequence table SEQ ID No.1, and there are NcoI and NotI restriction enzyme site in two ends, and the C end contains terminator codon TCA.

The PCR legal system is equipped with the method that Tachypleus tridentatus C factor gene inserts fragment:

A) adopt primers F 1 and R1 respectively, primers F 1 and R2 with the total cDNA of Tachypleus tridentatus hemocyte, obtain product about 3000bp by polymerase chain reaction (PCR) amplification;

B) above-mentioned PCR product is carried out 1% agarose gel electrophoresis, and the single band about 3000bp is reclaimed in rubber tapping;

Wherein the primer is as follows, and underscore is corresponding restriction enzyme site, and square frame is corresponding terminator codon, the corresponding Tachypleus tridentatus C of big write sequence factor gene end sequence.

F1：5’-cat g cc ATG GTC TTA GCG TCG-3’；

R1：5’-aag gaa aaa a gc ggc cgc AAT GAA CTG CCT AAT C-3’；

R2：5’-aag gaa aaa a gc ggc cgc

AAT GAA CTG CCT AAT C-3’。

PCR system in the described step a) is: F1:100pmol, and R1/R2:100pmol, dNTPs: each 50pmol, 5 * Prime star archaeal dna polymerase buffer:10 μ l, Prime star archaeal dna polymerase: 5U, sterilized water complement to 50 μ l;

The PCR reaction conditions: with above-mentioned PCR reaction system mixing, fs 95 ℃ of pre-sex change 3min; 95 ℃ of subordinate phase, 1min; 54 ℃, 1min; 72 ℃, 3min20s; , carry out 30 circulations altogether; Phase III 72 ℃ of extensions 10min.The plasmid construction of the prokaryotic expression carrier of the Tachypleus tridentatus C factor:

A) PCR recovery product or the rhabdovirus expression vector pFASTBacHTA that gets the described Tachypleus tridentatus C of the 1 μ g factor carries out double digestion respectively in the reaction system that contains restriction endonuclease NcoI and NotI, and 37 ℃ of enzymes were cut 1 hour; At 65 ℃ of deactivation 15min, it is standby to reclaim homologous segment then behind the PCR product double digestion, carries out 1% agarose gel electrophoresis behind pET28a carrier NcoI and the NotI double digestion, and rubber tapping is reclaimed standby then.

B) get double digestion at 1: 3 by the ratio of molecule mole number and reclaim the pET28a of back gained and the DNA of the C factor, add isopyknic rapid DNA ligase enzyme, after the mixing it is connected 0.5 hour at 22 ℃; Wherein, ligation system is 20 μ l.

C) connect product and transform 200 μ l intestinal bacteria Top10 competent cells, the product after will transforming then is uniformly coated on the LB solid medium of the kanamycin that contains 50 μ g/ml, cultivates 12 hours at 37 ℃.

D) choose c) mono-clonal bacterium colony on the middle plateform, be inoculated in the 5ml LB substratum of the kanamycin that contains 50 μ g/ml, 37 ℃ of cultivations are got 2 μ l bacterium liquid as template after 4 hours, and PCR identifies positive colony.

E) with after the positive colony cultivation, the extracting plasmid, the exactness of sequence is identified in order-checking.

PCR system in the described step d) is: F1:50pmol, and R1:50pmol, dNTPs: each 30pmol, Tag archaeal dna polymerase buffer:3 μ l, Tag archaeal dna polymerase: 1U, sterilized water complement to 30 μ l.

The PCR reaction conditions: with above-mentioned PCR reaction system mixing, fs 95 ℃ of pre-sex change 3min; 95 ℃ of subordinate phase, 1min; 54 ℃, 1min; 72 ℃, 3min20s; , carry out 30 circulations altogether; Phase III 72 ℃ of extensions 10min.The plasmid construction of Tachypleus tridentatus C factor insect cell rhabdovirus expression vector:

A) PCR that gets the described Tachypleus tridentatus C of the 1 μ g factor reclaims product or rhabdovirus expression vector pFASTBacHTA, carries out double digestion respectively in the reaction system that contains restriction endonuclease NcoI and NotI, and 37 ℃ of enzymes were cut 1 hour; At 65 ℃ of deactivation 15min, it is standby to reclaim homologous segment then behind the PCR product double digestion, carries out 1% agarose gel electrophoresis behind pFASTBacHTA carrier NcoI and the NotI double digestion, and rubber tapping is reclaimed standby then.

B) get double digestion at 1: 3 by the ratio of molecule mole number and reclaim the pFASTBacHTA of back gained and the DNA of the C factor, add isopyknic rapid DNA ligase enzyme, after the mixing it is connected 0.5 hour at 22 ℃; Wherein, ligation system is 20 μ l.

C) connect product and transform 200 μ l intestinal bacteria Top10 competent cells, the product after will transforming then is evenly coated on the LB solid medium of the ampimycin that contains 50 μ g/ml, cultivates 12 hours at 37 ℃.

D) choose c) mono-clonal bacterium colony on the middle plateform, be inoculated in the 5ml LB substratum of the ampimycin that contains 50 μ g/ml, 37 ℃ of cultivations are got 2 μ l bacterium liquid as template after 4 hours, and PCR identifies positive colony.

PCR system in the described step d) is: F1:50pmol, and R2:50pmol, dNTPs: each 30pmol, Tag archaeal dna polymerase buffer:3 μ l, Tag archaeal dna polymerase: 1U, sterilized water complement to 30 μ l.

The PCR reaction conditions: with above-mentioned PCR reaction system mixing, fs 95 ℃ of pre-sex change 3min; 95 ℃ of subordinate phase, 1min; 54 ℃, 1min; 72 ℃, 3min20s; , carry out 30 circulations altogether; Phase III 72 ℃ of extensions 10min.

The present invention has the following advantages:

1. the present invention is cloned into Tachypleus tridentatus C factor gene sequence in the prokaryotic expression carrier, is its recombinant expressed laying a good foundation in prokaryotic cell prokaryocyte.

2. the present invention is cloned into Tachypleus tridentatus C factor gene sequence in the rhabdovirus expression vector first, is its great expression in insect cell, obtains the activated recombinant C factor and lays a good foundation.

Description of drawings:

Below in conjunction with drawings and Examples this patent is further specified.

Fig. 1 is the plasmid construction figure of Tachypleus tridentatus C factor prokaryotic expression carrier and rhabdovirus expression vector.The restriction enzyme site that connects is NcoI and NotI.

Fig. 2 is to be template with the total cDNA of Tachypleus tridentatus hemocyte, is the agarose gel electrophoresis figure of the Tachypleus tridentatus C factor D NA that obtains of primer PCR amplification with F1 and R1,1,2 and 3 for after 5 times of total cDNA dilutions as the band that obtains behind the template amplification; M is the nucleic acid molecular weight label, is respectively 5kb from top to bottom, 3kb, 2kb, 1.5kb, 1kb, 750bp, 500bp, 250bp, 100bp.

Fig. 3 is that to be connected the single bacterium colony that grows at the resistance substratum behind the product transformed into escherichia coli cell with the C factor with pET28a be template, be the agarose gel electrophoresis figure of the limulus blood cell C factor D NA that obtains of primer PCR amplification with F1 and R1,1～6 is respectively the band that 6 single bacterium colonies obtain behind pcr amplification, wherein 2 and 6 be positive colony.M is the nucleic acid molecular weight label, is respectively 5kb from top to bottom, 3kb, 2kb, 1.5kb, 1kb, 750bp, 500bp, 250bp, 100bp.

Fig. 4 is to be template with the total cDNA of Tachypleus tridentatus hemocyte or pET28a-FC plasmid, be the agarose gel electrophoresis figure of the Tachypleus tridentatus C factor D NA that obtains of primer PCR amplification with F1 and R2,1 for after 5 times of the total cDNA dilutions as the band that obtains behind the template amplification, 2 bands that obtain as template amplification after diluting 10 times for the pET28a-FC plasmid.M is the nucleic acid molecular weight label, and molecular weight is respectively 5kb from top to bottom, 3kb, 2kb, 1.5kb, 1kb, 750bp, 500bp, 250bp, 100bp.

Fig. 5 is that to be connected the single bacterium colony that grows at the resistance substratum behind the product transformed into escherichia coli cell with the C factor with pFASTBACHTA be template, be the agarose gel electrophoresis figure of the limulus blood cell C factor D NA that obtains of primer PCR amplification with F1 and R2,1～6 is respectively the band that 6 single bacterium colonies obtain behind pcr amplification, wherein 2 and 6 be positive colony.M is the nucleic acid molecular weight label, and molecular weight is respectively 5kb from top to bottom, 3kb, 2kb, 1.5kb, 1kb, 750bp, 500bp, 250bp, 100bp.

Embodiment:

Embodiment 1

1. be structured in the base sequence that the Tachypleus tridentatus C factor (FC) gene on prokaryotic expression carrier and the rhabdovirus expression vector has sequence table SEQ IDNo.1:

ATGGTCTTAGCGTCGTTTTTGGTGTCTGGTTTAGTTCTAGGGCTACTAGCCCAACAAATG 60

CGTCCAGTTCAGTCCAGAGGAGTAGATCTGGGCTTGTGTGATGAAACGAGGTTCGAGTGT 120

AAGTGTGGAGATCCAGGCTATGTGTTCAACGTCCCTATGAAACAATGCACGTACTTCTAT 180

CGATGGAGGCCTTATTGTAAACCATGTGATGACCTGGAGGCTAAGGACATTTGTCCAAAG 240

TACAAACGATGTCAAGAGTGTAAGGCTGGTCTTGATAGTTGTGTTACTTGTCCACCTAAC 300

AAATATGGTACTTGGTGTAGCGGTGAATGTCAATGTAAGAATGGAGGTATCTGTGACCAG 360

AGGACAGGAGCTTGTGCGTGTCGTGACAGATATGAAGGAGCGCACTGTGAAATTCTCAAA 420

GGTTGTCCTCTTCTTCCATCGGATTCTCAAGTTCAGGAAGTCAGAAACCCACCAGATAAT 480

CCCCAAACTATTGACTACAGCTGTTCACCAGGGTTCAAGCTTAAAGGCGTGGCACGAATT 540

AGCTGTCTCCCAAATGGACAGTGGAGTAGCTTTCCACCCAAATGTATTCGAGAATGTGCC 600

AAGGTTTCATCTCCAGAACACGGGAAAGTGAATGCTCCTAGTGGCAATATGATAGAAGGG 660

GCTACTTTACGGTTCTCATGTGATAGTCCCTACTACTTGATTGGTCAAGAAACATTAACC 720

TGCCAGGGTAATGGTCAGTGGAGTGGACAAATACCACAATGTAAGAAGTTGGTCTTCTGT 780

CCTGACCTTGATCCTGTAAACCATGCTGAACACCAGGTTAAAATTGGTGTGGAACAAAAA 840

TATGGTCAGTTTCCTCAAGGCACTGAAGTGACCTATACGTGTTCGGGTAACTACTTCTTG 900

ATGGGTTTTAACACCTTAAAATGTAACCTTGATGGGTCCTGGTCAGGATCACAGCCATCC 960

TGTGTTAAAGTGGCAGACAGAGAGGTCGACTGTGACAGTAAAGCTGTAGACTTCTTGGAT 1020

GATGTTGGTGAACCTGTCAGGATCCACTGTCCTGCTGGCTGTTCTTTGACAGCTGGTACT 1080

GTGTGGGGTACAGCCATATACCACGAACTTTCCTCAGTGTGTCGTGCAGCCATCCATGCT 1140

GGCAAGCTTCCAAACTCAGGAGGAGCGGTGCATGTAGTGAACAATGGCCCCTACTCGGAC 1200

TTTCTGGGTAGTGACCTGAATGGGATAAAATCGGAAGAGTTGAAGTATTGTGCCAGCAGC 1260

GTTTTATTTGGATATGTCAGTTCATCCACAGCAGGTAGATCAGGATGTCCTGATGGATGG 1320

TTTGAGGTAGAAGAGAACTGTGTGTACGTTACATCAAAACAGAGAGCCTGGGAAAGAGCT 1380

CAAGGTGTGTGTACCAATATGGCTGCTCGTCTCGCTGTGCTAGACAAAGATGTAATTCCG 1440

AGTTCCTTGACTGAGACTCTACGAGGGAAAGGGTTAACAACCACATGGATAGGATTGCAC 1500

AGACTAGATGCTGAGAAGCCCTTTGTTTGGGAGCTAATGGATCGTAGTAATGTGGTTCTG 1560

AATGATAACCTAACATTCTGGGCCTCTGGCGAACCTGGAAATGAAACTAACTGTGTATAT 1620

CTGGACATCCGAGATCAGCTGCAGCCTGTGTGGAAAACCAAGTCATGTTTTCAGCCCTCA 1680

AGCTTTGCTTGCATGATGGATTTGTCAGACAGAAATAAAGCCAAATGCGATGACCCTGGA 1740

TCACTGGAAAATGGACACGCCACACTTCATGGACAAAGTATTGATGGGTTCTATGCTGGT 1800

TCTTCTATAAGGTACAGCTGTGAGGTTCTCCACTACCTCAGTGGAACTGAGACCGTAACT 1860

TGTACAACAAATGGCACATGGAGTGCTCCTAAACCTCGATGTATCAAAGTCATCACCTGC 1920

CAAAACCCTCCTGTACCATCATATGGTTCTGTGGAAATCAAACCCCCAAGTCGGACAAAC 1980

TCGATCAGTCGTGTTGGGTCACCTTTCTTGAGGTTGCCACGGTTACCCCTCCCATTAGCC 2040

AGAGCAGCCAAACCTCCTCCAAAACCTAGATCCTCACAACCCTCTACTGTGGACTTGGCT 2100

TCTAAAGTTAAACTACCTGAAGGTCATTACCGGGTAGGGTCTCGAGCCATTTACACGTGC 2160

GAGTCGAGATACTACGAACTACTTGGATCTCAAGGCAGAAGATGTGACTCTAATGGAAAC 2220

TGGAGTGGTCGGCCCGCTAGCTGTATTCCAGTTTGTGGACGGTCAGACTCTCCTCGTTCT 2280

CCTTTCATCTGGAATGGGAATTCTACAGAAATAGGTCAGTGGCCGTGGCAGGCAGGAATC 2340

TCTCGATGGCTTGCAGACCACAATATGTGGTTTCTCCAGTGTGGAGGATCCCTATTGAAT 2400

GAGAAATGGATCGTCACTGCTGCCCACTGTGTCACCTACTCTGCTACTGCTGAGATAATT 2460

GATCCCAGTCAGTTTAAAATCTATCTGGGCAAGTACTACCGTGATGACAGTAGAGACGAT 2520

GACTACGTACAAGTAAGAGAGGCTCTCGAGATCCACGTAAATCCTAACTACGACCCCGGC 2580

AATCTCAACTTTGACATAGCCCTAATTCAACTGAAAACTCCTGTTACTTTGACAACACGA 2640

GTCCAACCAATCTGTCTGCCTACTGACATCACAACAAGAGAACACTTGAAGGAGGGAACA 2700

TTAGCAGTGGTGACAGGTTGGGGTTTGAATGAAAACAACACATATTCAGAGATGATTCAA 2760

CAAGCTGTGCTACCTGTTGTTGCAGCAAGCACCTGTGAAGAGGGGTACAAGGAAGCAGAC 2820

TTACCACTGACAGTAACAGAGAACATGTTCTGTGCAGGTTACAAGAAGGGACGTTATGAT 2880

GCCTGCAGTGGGGACAGTGGAGGACCATTAGTGTTTGCTGATGATTCCCGTACCGAAAGG 2940

CGGTGGGTCTTGGAAGGGATTGTCAGCTGGGGCAGTCCCAGTGGATGTGGCAAGGCTAAC 3000

CAGTATGGGGGCTTCACTAAAGTTAACGTTTTTCTATCATGGATTAGGCAGTTCATT 3057

(1) information of SEQ ID NO.1:

A) sequence signature:

* length: 3057 base pairs

* type: nucleic acid

* chain: two strands

* topological framework: linearity

B) molecule type: cDNA

C) suppose: not

D) initial source: the total cDNA of Tachypleus tridentatus hemocyte

2. Tachypleus tridentatus C factor gene inserts the preparation method of fragment:

A) adopt primers F 1 and R1 respectively, primers F 1 and R2 are template with the total cDNA of Tachypleus tridentatus hemocyte, obtain product about 3000bp by polymerase chain reaction (PCR) amplification.

Wherein, the PCR system is: F1:100pmol, and R1/R2:100pmol, dNTPs: each 50pmol, 5 * Primestar archaeal dna polymerase buffer:10 μ l, Prime star archaeal dna polymerase: 5U, sterilized water complement to 50 μ l.

Primer is:

F1：5’-cat g cc ATG GTC TTA GCG TCG-3’

R1：5’-aag gaa aaa a gc ggc cgc AAT GAA CTG CCT AAT C-3’

R2：5’-aag gaa aaa a gc ggc cgc

AAT GAA CTG CCT AAT C-3’

B) above-mentioned PCR product is carried out 1% agarose gel electrophoresis, deposition condition is: 120V electrophoresis 30 minutes, 80V electrophoresis to tetrabromophenol sulfonphthalein bar brings to the gel edge again, stops electrophoresis.Gel imaging, the band that obtains less than 5kb, are single band greater than 3kb.Band is cut off, reclaimed (reclaiming the test kit specification sheets referring to giving birth to worker company glue) with test kit.

The plasmid construction of the prokaryotic expression carrier of the embodiment 2 Tachypleus tridentatus C factors:

A) double digestion and the recovery of Tachypleus tridentatus C factor D NA and pET28a vector plasmid: the PCR that respectively gets the Tachypleus tridentatus C factor described in 1 μ g pET28a plasmid and the example 1 reclaims product and carry out double digestion in the reaction system that contains restriction endonuclease NcoI and NotI, and 37 ℃ of enzymes were cut 1 hour;

Wherein reaction system is 30 μ l, 10 * buffer, 3 μ l, and NcoI and NotI are respectively 10U, all the other volumes sterilized water polishing, restriction endonuclease is from Fermentas company; At 65 ℃ of deactivation 15min, reclaim test kit with the PCR fragment then and reclaim standby (reclaiming the test kit specification sheets referring to giving birth to the worker PCR of company) behind the PCR product double digestion; Carry out 1% agarose gel electrophoresis behind the pET28a carrier double digestion, standby (reclaiming the test kit specification sheets referring to giving birth to worker company glue) reclaimed in rubber tapping then.

B) get NcoI and the pET28a of NotI double digestion recovery back gained and the DNA of the Tachypleus tridentatus C factor at 1: 3 by the ratio of molecule mole number, add isopyknic rapid DNA ligase enzyme, after the mixing it is connected 0.5 hour at 22 ℃; Wherein, ligation system is 20 μ l.

Wherein, the PCR system is: F1:50pmol, and R1:50pmol, dNTPs: each 30pmol, Tag archaeal dna polymerase buffer:3 μ l, Tag archaeal dna polymerase: 1U, sterilized water complement to 30 μ l.

Primer is:

F1：5’-cat g cc ATG GTC TTA GCG TCG-3’

R1：5’-aag gaa aaa a gc ggc cgc AAT GAA CTG CCT AAT C-3’

E) with after the positive colony cultivation, the extracting plasmid, the exactness of sequence is identified in order-checking, sequencing result is identical with SEQ ID No.1.

The plasmid construction of embodiment 3 Tachypleus tridentatus C factor rhabdovirus expression vectors:

A) double digestion and the recovery of Tachypleus tridentatus C factor D NA and pFASTBacHTA vector plasmid: the PCR that respectively gets the Tachypleus tridentatus C factor described in 1 μ g pFASTBacHTA plasmid and the example 1 reclaims product, carry out double digestion respectively in the reaction system that contains restriction endonuclease NcoI and NotI, 37 ℃ of enzymes were cut 1 hour.

Wherein reaction system is 30 μ l, and NcoI and NotI are respectively 10U, 10 * buffer, 3 μ l, and all the other volumes sterilized water polishing, restriction endonuclease is from Fermentas company; At 65 ℃ of deactivation 15min, reclaim test kit with the PCR fragment then and reclaim standby (reclaiming the test kit specification sheets referring to giving birth to the worker PCR of company) behind the PCR product double digestion; Carry out 1% agarose gel electrophoresis behind the pET28a carrier double digestion, standby (reclaiming the test kit specification sheets referring to giving birth to worker company glue) reclaimed in rubber tapping then.

Wherein, the PCR system is: F1:50pmol, and R2:50pmol, dNTPs: each 30pmol, Tag archaeal dna polymerase buffer:3 μ l, Tag archaeal dna polymerase: 1U, sterilized water complement to 30 μ l.

Primer is:

F1：5’-cat g cc ATG GTC TTA GCG TCG-3’

R2：5’-aag gaa aaa agc ggc cgc AAT GAA CTG CCT AAT C-3’

After the positive colony cultivation, the extracting plasmid, the exactness of sequence is identified in order-checking, sequencing result is identical with SEQ ID No.1.

Claims

1. Tachypleus tridentatus C factor gene is characterized in that wherein gene order is made up of 3057bp by shown in the SEQ ID No.1 sequence; The primer two ends that are used for the clone are contained NcoI and NotI restriction enzyme site respectively; The C end does not contain terminator codon.

2. Tachypleus tridentatus C factor gene is characterized in that wherein gene order is made up of 3057bp by shown in the SEQ ID No.1 sequence; The primer two ends that are used for the clone are contained NcoI and NotI restriction enzyme site respectively; The C end contains terminator codon.

3. it is characterized in that in prokaryotic expression carrier by the described Tachypleus tridentatus C of claim 1 factor (TtFC) gene clone: adopt primer as follows, underscore is corresponding restriction enzyme site, the corresponding Tachypleus tridentatus C of big write sequence factor gene end sequence,

F1：5’-cat g CC ATG GTCTTA GCG TCG-3’

R1：5’-aag gaa aaa a gc ggc cgc AAT GAA CTG CCT AAT C-3’

Be template with the total cDNA of Tachypleus tridentatus hemocyte or Tachypleus tridentatus C factor D NA, obtain having base sequence among the sequence SEQ ID No.1 by polymerase chain reaction (PCR) amplification.

4. by the preparation method of the Tachypleus tridentatus C factor gene described in the claim 1, it is characterized in that the PCR system of polymerase chain reaction:

F1:100pmol, R1:100pmol, dNTPs: each 50pmol, 5 * Prime star archaeal dna polymerase buffer:10 μ l, Prime star archaeal dna polymerase: 5U, sterilized water complement to 50 μ l;

The PCR reaction conditions: with above-mentioned PCR reaction system mixing, fs 95 ℃ of pre-sex change 3min; 95 ℃ of subordinate phase, 1min; 54 ℃, 1min; 72 ℃, 3min20s; Carry out 30 circulations altogether; Phase III 72 ℃ of extensions 10min.

5. be cloned in the prokaryotic expression carrier by the described Tachypleus tridentatus C of claim 1 factor gene, it is characterized in that:

The employing primer is as follows, and underscore is corresponding restriction enzyme site, and square frame is corresponding terminator codon, the corresponding Tachypleus tridentatus C of big write sequence factor gene end sequence,

F1：5’-cat g cc ATG GTCTTA GCG TCG-3’

R2：5’-aag gaa aaa a gc ggc cgc

AAT GAA CTG CCT AAT C-3’

Be template with the total cDNA of Tachypleus tridentatus hemocyte or Tachypleus tridentatus C factor D NA, obtain having base sequence among the sequence table SEQ ID No.1 by polymerase chain reaction (PCR) amplification.

6. by the plasmid construction of the described Tachypleus tridentatus C of claim 1 factor gene at the rhabdovirus expression vector of insect cell expression, it is characterized in that:

A) PCR recovery product and the rhabdovirus expression vector pFASTBacHTA that gets the described Tachypleus tridentatus C of the 1 μ g factor carries out double digestion respectively in the reaction system that contains restriction endonuclease NcoI and NotI, and 37 ℃ of enzymes were cut 1 hour; At 65 ℃ of deactivation 15min, reclaim standbyly then behind the PCR product double digestion, carry out 1% agarose gel electrophoresis behind the pFASTBacHTA carrier double digestion, rubber tapping is reclaimed standby then;

B) get double digestion at 1: 3 by the ratio of molecule mole number and reclaim the pFASTBacHTA of back gained and the DNA of the C factor, add isopyknic rapid DNA ligase enzyme, after the mixing it is connected 0.5 hour at 22 ℃; Wherein, ligation system is 20 μ l;

C) connect product and transform 200 μ l intestinal bacteria Top10 competent cells, the product after will transforming then is evenly coated on the LB solid medium of the Ampicillin that contains 50 μ g/ml, cultivates 12 hours at 37 ℃;

D) choose mono-clonal bacterium colony on the flat board as template, PCR identifies positive colony;

After the positive colony cultivation, the extracting plasmid, the exactness of insertion sequence is identified in order-checking.