CN102191259B - Lotus phytochelatin synthase NnPCS1 and plant expression vector and construction method thereof - Google Patents
Lotus phytochelatin synthase NnPCS1 and plant expression vector and construction method thereof Download PDFInfo
- Publication number
- CN102191259B CN102191259B CN201110090228A CN201110090228A CN102191259B CN 102191259 B CN102191259 B CN 102191259B CN 201110090228 A CN201110090228 A CN 201110090228A CN 201110090228 A CN201110090228 A CN 201110090228A CN 102191259 B CN102191259 B CN 102191259B
- Authority
- CN
- China
- Prior art keywords
- nnpcs1
- lotus
- expression vector
- plant expression
- phytochelatin synthase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention belongs to the field of molecular biology and discloses a lotus phytochelatin synthase gene NnPCS1 and a plant expression vector and a construction method thereof. The sequence of the lotus phytochelatin synthase gene NnPCS1 is represented by SEQ ID No.1. The NnPCS1 is a new heavy metal resistance associated gene and can improve the heavy metal resistance in plants. The plant expression vector of the lotus phytochelatin synthase gene NnPCS1 consists of the lotus phytochelatin synthase gene NnPCS1 and the plant expression vector. The plant expression vector of the NnPCS1 is reported for the first time, can be directly used in Agrobacterium tumefaciens-mediated genetic transformation to develop a new heavy metal resistant variety and improve the heavy metal resistance in the plants and can be used for plant variety improvement.
Description
Technical field
The invention belongs to biology field, relate to lotus phytochelatin synthase gene NnPCS1 and plant expression vector and construction process.
Background technology
Heavy metal contamination is the main aspect of environmental pollution.According to statistics, China receives nearly 2,000 ten thousand hm2 of cultivated area of heavy metal contaminations such as Cd, As, Cr, Pb, accounts for 1/5 of total cultivated area; Wherein 1,000 ten thousand hm2 that plough are polluted in industry " three wastes ", and the farmland area of sewage irrigation has reached more than 330 ten thousand hm
2 [1]Therefore distribution, migration, the conversion of heavy metal in environment is one of research focus of environmental science always
[2]Utilize the proposition of the soil and the water body of phytoremediation heavy metal contamination in recent years, make the application of green plants surmount in the past just use range as metal mineral reserves plant indicator or heavy metal super-enriched plant.For traditional physical chemistry technology and microbiological treatment technology, phytoremediation technology is with low cost with it, do not destroy soil and river ecological environment, do not cause unique advantage such as secondary pollution, enjoys the close attention of domestic and international academia and industrial community.Lotus (Nelumbo nucifera) is claimed Chinese lotus again, belongs to the large-scale perennial emergent of Nymphaeceae Nelumbo; Be one of Chinese ten great tradition famous flowers, have high ornamental value and economic worth, be distributed in the freshwater lake area more; Water-fastly flood, strong resistance, liked by the people of various countries.
The plant complexing plain (phytochelatin, PC) be one type by the part of broad research.PC is one type of chelating polypeptide that is rich in sulfydryl; Extensively exist in vegitabilia, can become stable sulphur peptide complex with metal ion-chelant, these mixtures can be transported to outside the born of the same parents through translocator; Or it is stored in the vacuole; Reduction makes plant can absorb and accumulate more pollutent to the murder by poisoning of plant, improves remediation efficiency
[3]Plant complexing plain gene (PCS) be one type by heavy metal ion inductive gene, removing the murder by poisoning of heavy metal ion, keeping the stable state of metals ion in the tissue and regulate metals ion and play an important role to the aspects such as transportation of particular organization
[4]
The PCS1 gene clones in two plants, and promptly Arabidopis thaliana and wheat clone out from Indian mustard and the tired sky blue penny cress of plant of Ni ultraproduct then successively
[5,6], the function of Arabidopis thaliana AtPCS1 gene and anti-heavy metal mechanism have been carried out comparatively deep research
[7,8]
In the genetic transformation approach of plant, agrobacterium-mediated transformation is to use one of method the most widely, and wherein effectively plant expression vector is most important.With the gene constructed plant expression vector of phytochelatin synthase, be used for agriculture bacillus mediated plant genetic and transform, can obtain to have the new germ plasm of anti-heavy metal.For the cultivation of good crop new variety and widespread use aborning, significant.
Summary of the invention
The object of the present invention is to provide a new phytochelatin synthase gene NnPCS1, solve and improve the large-scale flowering marsh plants lotus attribute of anti-a huge sum of money of viewing and admiring, repair the problem of water pollution,
The present invention also provides plant expression vector and the construction process thereof of this phytochelatin synthase gene NnPCS1.Constructed plant expression vector can directly be used for agriculture bacillus mediated crop genetic and transform, and formulates the new germ plasm of anti-the heavy metal, can be used for plant species improvement.
The object of the invention can be realized through following technical scheme:
Lotus phytochelatin synthase gene NnPCS1, the sequence of this gene is SEQ ID NO.1.
The plant expression vector of lotus phytochelatin synthase gene NnPCS1 is made up of described lotus phytochelatin synthase gene NnPCS1 and plant expression vector.
The plant expression vector of described lotus phytochelatin synthase gene NnPCS1 will be inserted into preferably that plant expression vector pCAMBIA1301-220 obtains through the lotus phytochelatin synthase gene NnPCS1 of BamH I and Sac I double digestion.
The construction process of described lotus phytochelatin synthase gene NnPCS1 plant expression vector comprises the steps:
(1) design primer NnPCS1-ZF and NnPCS1-ZR; With winter lotus cDNA is template; Carry out the PCR reaction with the high-fidelity enzyme; The amplification upstream and downstream is introduced the NnPCS1 gene of BamH I and SacI restriction enzyme site respectively, and wherein upstream primer NnPCS1-ZF sequence is SEQ ID NO.2, and downstream primer NnPCS1-ZR sequence is SEQ ID NO.3;
(2) the PCR product with step (1) is connected to pMD19-T Simple carrier, transforms the TOP10 competent cell, extracts positive plasmid pMD19-T Simple-NnPCS1;
(3) utilize BamH I and Sac I that pMD19-T Simple-NnPCS1 and plant expression vector pCAMBIA1301-220 are carried out double digestion respectively; The big fragment that NnPCS1 fragment that connection BamH I and Sac I double digestion pMD19-T Simple-NnPCS1 obtain and BamH I and Sac I double digestion pCAMBIA1301-220 obtain; Transform the TOP10 competent cell, positive plasmid is lotus phytochelatin synthase gene NnPCS1 plant expression vector pCAMBIA1301-220-NnPCS1.
The application of described lotus phytochelatin synthase gene NnPCS1 in the attribute of anti-a huge sum of money that improves plant.
The application of the plant expression vector of described lotus phytochelatin synthase gene NnPCS1 in the attribute of anti-a huge sum of money that improves plant.
Wherein, the plant expression vector of described lotus phytochelatin synthase gene NnPCS1 will be inserted into preferably that plant expression vector pCAMBIA1301-220 obtains through the lotus phytochelatin synthase gene NnPCS1 of BamH I and Sac I double digestion.
Beneficial effect of the present invention:
1. lotus phytochelatin synthase gene NnPCS1 provided by the invention is a new gene of anti-the heavy metal, and this gene can improve the plant attribute of anti-a huge sum of money.
2. the lotus phytochelatin synthase gene NnPCS1 plant expression vector of the present invention's structure is a reported first; Can directly be used for agriculture bacillus mediated genetic transformation; Create the new germ plasm of anti-the heavy metal, improve the attribute of anti-a huge sum of money of plant, can be used for carrying out plant species improvement.
Description of drawings
Fig. 1 NnPCS1 agarose gel electrophoresis is analyzed
M:DNA Marker; 1:NnPCS1; 2:pMD 19-T Simple-NnPCS1 plasmid BamH I and Sac I double digestion;
3:pCAMBIA1301-220-NnPCS1 expression vector plasmid BamHI and Sac I double digestion electrophoresis detection figure.
Fig. 2 plant expression vector pCAMBIA1301-220-NnPCS1 constructing plan figure
Fig. 3 wild-type and transgenic arabidopsis PCR qualification result, WT represents the wild-type Arabidopis thaliana, and pcs1 ~ pcs8 represents eight transgenic arabidopsis strain systems.
Fig. 4 wild-type and transgenic arabidopsis qRT-PCR qualification result, WT represents the wild-type Arabidopis thaliana, and pcs1 ~ pcs8 represents eight transgenic arabidopsis strain systems.
Fig. 5 wild-type and transgenic arabidopsis heavy metal cadmium content are measured.
Embodiment
Employed in the present invention term only if other explanation is arranged, generally has the implication of those of ordinary skills' common sense.
Below in conjunction with concrete preparation embodiment and application implementation example, and comparable data is described the present invention in further detail.Should be understood that these embodiment just in order to demonstrate the invention, but not limit scope of the present invention by any way.
In following embodiment, various processes and the method do not described in detail are ordinary methods as known in the art.Used primer is all indicated when occurring first, and used thereafter same primers as is all identical with the content of indicating first.
The clone of embodiment 1NnPCS1
Select for use lotus kind ' winter lotus ' (Nelumbo nucifera Gaertn. ' Donghe ') as material, with 400 μ MCdCl
2Processing grows to 6 to 8 blade phases ' winter lotus '; Get its tender leaf after 3 hours; Extract test kit (TaKaRa) specification sheets method with reference to Trizol RNA, extract the total RNA of blade, get the total RNA reverse transcription of 1 μ g according to M-MLV reverse transcription test kit (TaKaRa) and become cDNA.
Leaf cDNA to extract is a template, and design primer NnPCS1-F and NnPCS1-R carry out the PCR reaction:
Upstream primer NnPCS1-F:ATGGCGATGGCAGGTCTATACAGGC (SEQ ID NO.4)
Downstream primer NnPCS1-R:AGAGACTGAAGGTGTGCTGAGGCCA (SEQ ID NO.5)
50 μ L reaction systems: 10 * RCR Buffer, 5.0 μ L, NnPCS1-F, each 1.0 μ L (20 μ molL of NnPCS1-R primer
-1), dNTP mix 4.0 μ L (2.5mmolL
-1), Taq DNA Polymerase 0.2 μ L, cDNA template 1 μ L, ddH
2O 37.8 μ L; Response procedures: 95 ℃ of preparatory sex change 4min, 94 ℃ of 30sec that unwind then, 55 ℃ of annealing 30sec, 72 ℃ are extended 2min, reacts 32 circulations, 72 ℃ of extension 7min; PCR carries out agarose electrophoresis (Fig. 1) after finishing, and product reclaims test kit (TAKARA) with gel and reclaims purifying, uses T
4Dna ligase (TaKaRa) is connected to pMD19-T Simple carrier (TaKaRa), transforms the TOP10 competent cell, and sequencing is SEQ ID NO.1.
The structure of embodiment 2. plant expression vector pCAMBIA1301-220-NnPCS1
Design primer NnPCS1-ZF, NnPCS1-ZR carry out the PCR reaction; Introduce restriction enzyme site BamH I and Sac I respectively at the upstream and downstream of goal gene NnPCS1, the PCR product is connected to pMD19-T Simple carrier, transforms the TOP10 competent cell; Extract positive plasmid; The NnPCS1 fragment of BamH I and Sac I double digestion is connected with the pCAMBIA1301-220 of BamH I with Sac I double digestion, transforms the positive matter of extraction; Electrophoresis detection and sequence verification are SEQ ID NO.1, and concrete steps are following:
Upstream primer NnPCS 1-ZF:CGCGGATCCATGGCGATGGCAGGTCTATACAGGC (SEQ IDNO.2)
Downstream primer NnPCS 1-ZR:CGAGCTCAGAGACTGAAGGTGTGCTGAGGCCA (SEQ IDNO.3)
1. with the lotus leaf cDNA as template, with high-fidelity enzyme (PrimeSTAR
TMHS DNAPolymerase TaKaRa) carries out the PCR reaction, 50 μ L reaction systems: 10 * HS RCR Buffer, 5.0 μ L, NnPCS1-ZF, each 1.0 μ L (20 μ molL of NnPCS1-ZR primer
-1), dNTP mix 4.0 μ L (2.5mmolL
-1), PrimeSTAR
TMHS DNA Polymerase 0.4 μ L, cDNA template 1 μ L, ddH
2O 37.6 μ L; Response procedures: 95 ℃ of preparatory sex change 4min, 94 ℃ of 30sec that unwind then, 55 ℃ of annealing 30sec, 72 ℃ are extended 2min, reacts 32 circulations, 72 ℃ of extension 7min; The PCR product reclaims test kit (TAKARA) with gel and reclaims, and is connected to pMD19-T Simple carrier, transforms the TOP10 competent cell, and PCR identifies and extract positive plasmid pMD19-T Simple-NnPCS1;
2. get expression vector pCAMBIA1301-220 and pMD19-T Simple-NnPCS1 and use BamH I and Sac I double digestion respectively; Double digestion system (50 μ L): 10 * K Buffer, 2.5 μ L; Plasmid pCAMBIA1301-220 or pMD19-TSimple-NnPCS1 10 μ L; BamHI 2 μ L, Sac I 2 μ L, ddH
2O 33.5 μ L; 37 ℃ of reaction 3h; The double digestion product carries out agarose gel electrophoresis analysis (Fig. 1), reclaims test kit (TAKARA) with gel and reclaims big fragment of plasmid pCAMBIA1301-220 and pMD19-T Simple-NnPCS1 small segment.Use T
4Dna ligase (TaKaRa) connects the product of two recovery, ligation system (10 μ L): 10 * T
4Ligase Buffer 1 μ L, the big fragment 2 μ L of pCAMBIA1301-220, pMD19-T Simple-NnPCS1 small segment 6 μ L, T
4Dna ligase 1 μ L; 16 ℃ of ligations of spending the night are got 5 μ L and are connected product conversion TOP10 competent cell.37 ℃ of incubated overnight, picking positive monoclonal enlarged culturing is extracted plasmid pCAMBIA1301-220-NnPCS1, and electrophoresis (Fig. 1) and sequence verification are SEQ ID NO.1.The structure success of plant expression vector pCAMBIA1301-220-NnPCS1, plasmid spectrogram and constructing plan figure see Fig. 2.
1. preparation of agrobacterium strains EHA105 competence and freeze-thaw method transform
The single bacterium colony of picking EHA105 is inoculated in 50mL and contains in the YEB liquid nutrient medium of 50ug/mL Rifampin 200rpm from YEB (50ug/mL Rifampin) flat board; 28 ℃ are cultured to OD value 0.5; Ice bath bacterium liquid 30min then, centrifugal collection thalline is suspended in the 100mM CaCl of 2mL precooling
2In (20% glycerine) solution, 200uL/ manages packing, and is for use.
Get 10uL pCAMBIA1301-220-NnPCS1 vector plasmid, add 200uL EHA105 competent cell, ice bath 30min; Liquid nitrogen freezing 5min, 37 ℃ of 5min add the 800uLYEB liquid nutrient medium; 28 ℃ of 200rpm cultivate 4h in advance, and bacterium liquid coated plate was secretly cultivated 2 days for 28 ℃ on YEB (50ug/mL Rifampin+50ug/mL kantlex) solid medium; Picking mono-clonal PCR detects, and chooses positive colony and shakes bacterium, is used for the Arabidopis thaliana inflorescence and transforms.
2. the Arabidopis thaliana inflorescence is contaminated and the seed screening
Positive monoclonal is received in YEB (50ug/mL Rifampin+50ug/mL kantlex) liquid nutrient medium of 50mL; Cultivated 24 hours; Centrifugal 20 minutes of 5000rpm, (1/2MS adds the sucrose of 50 grams per liters to use conversion fluid then; Transferring pH is 5.8, and the Silwet L-77 that adds 200uL/L then mixes) acutely suspend to be precipitated to fully and hang.The Arabidopis thaliana over-ground part directly was soaked in the above-mentioned suspension-s 1 minute, wraps up plant fully to preserve moisture with preservative film then, put back to culturing room and cultivated 12 hours, open preservative film, gather when treating seed maturity.
Seed disinfection and sowing: the centrifuge tube of seed being put into 1.5mL; Add 1mL 75% alcohol; The TritonX-100 of interpolation 0.1% rocked 15 minutes, and the alcohol with 95% washes twice in super clean bench then, then directly is poured on seed on the filter paper of sterilizing together with alcohol; To dry up seed (placing 30 minutes); Knock gently filter paper with the dry seeds uniform broadcasting to screening culture medium (MS+20mg/L Totomycin+25mg/L penbritin) screening and culturing 10 days, then with the resistance transplantation of seedlings in soil, with transparent lid covering 1 week of seedling to preserve moisture.
3. PCR identifies and the evaluation of preventing from heavy metal property
Treat 7～8 leaves of resistance seedling, extract Arabidopsis leaf DNA, PCR (primer NnPCS1-F and NnPCS1-R) identifies that the result sees Fig. 3.。T through the PCR evaluation
1For the transgenic seedling continued growth, T gathers
2For seed.To wild-type and T
2Carry out qRT-PCR for the resistant transgenic Arabidopis thaliana and identify that the result sees Fig. 4.
Choose through qRT-PCR and identify that three the highest strain Arabidopis thalianas of goal gene relative expression quantity carry out heavy metal and handle: Arabidopis thaliana is sowed on the MS substratum, transplants seedlings after the week, and three all backs are with 50 μ MCdCl
2, 100 μ MCdCl
2Handle wild-type Arabidopis thaliana and transgenic line, developing medium is that a large amount of nutritive mediums of 1/2Hoagland add Arnon micronutrient liquid, and the results overground part is surveyed Cd after 1 week
2+Ion content finds that transgenic arabidopsis accumulates more cadmium ion (Fig. 5) than wild-type.
In sum, the present invention has made up the plant expression vector pCAMBIA1301-220-NnPCS1 that contains lotus phytochelatin synthase gene, wherein NnPCS1 reported first.Constructed carrier can import in the plant, improves the ability of the absorption heavy metal Cd of plant.
Reference:
[1] Zhao Qiguo, Gao Junfeng. the ecological functions of Chinese wetland resource and subregion thereof [J]. Chinese Ecological Agriculture journal, 2007,15:1-4.
[2] Hao Libo, bang ocean, Lu Jilong etc. the Songhua Lake settling
137Cs with
210Pb distributes and sedimentation rate [J]. Jilin University's journal: geoscience version .2009:470-473.
[3] Zhang Bin, Fan Zhongxue, catkin etc., the genetic engineering research [J] of phytoremediation heavy-metal contaminated soil. Molecular Plant Breeding .4:37-43.
[4]van?Hoof，N,et?al.A.Enhanced?copper?tolerance?in?Silene?vulgaris(Moench)Garcke?populations?from?copper?mines?is?associated?with?increased?transcript?levels?of?a?2b-type?metallothionein?gene[J].Plant?Physiology.2001,126:1519-1526.
[5]Ha,S.,et?al.Phytochelatin?synthase?genes?from?Arabidopsis?and?the?yeast?Schizo?Saccharomyces?pombe[J].The?Plant?Cell.1999,11:1153-1164.
[6]Vatamaniuk,O.,et?al.,a?phytochelatin?synthase?from?Arabidopsis:isolation?and?in?vitro?reconstitution.[J]Proceedings?of?the?National?Academy?of?Sciences?of?the?United?States?of?America.1999,96:7110-7115.
[7]Lee,S.and?Kang,B.S.Expression?of?Arabidopsis?phytochelatin?synthase?2is?too?low?to?complement?an?AtPCS1-defective?Cad1-3?mutant[J].Mol?Cells.2005,19:81-87.
[8]Lee,S.and?Korban,S.Transcriptional?regulation?of?Arabidopsis?thaliana?phytochelatin?synthase?(AtPCS1)by?cadmium?during?early?stages?of?plant?development[J].Planta.2002,215:689-693.
Claims (7)
1. lotus phytochelatin synthase gene
NnPCS1, the sequence that it is characterized in that this gene is shown in SEQ ID NO. 1.
2. lotus phytochelatin synthase gene
NnPCS1Plant expression vector, it is characterized in that by the described lotus phytochelatin synthase of claim 1 gene
NnPCS1Constitute with plant expression vector.
3. lotus phytochelatin synthase gene according to claim 2
NnPCS1Plant expression vector, it is characterized in that described lotus phytochelatin synthase gene
NnPCS1Plant expression vector be with warp
BamH 
With
Sac 
The lotus phytochelatin synthase gene of double digestion
NnPCS1Be inserted into that plant expression vector pCAMBIA1301-220 obtains.
4. claim 2 or 3 described lotus phytochelatin synthase genes
NnPCS1The construction process of plant expression vector, it is characterized in that comprising the steps:
(1) design primer NnPCS1-ZF and NnPCS1-ZR, with the winter lotus (
Nelumbo nuciferaGaertn) cDNA is a template, carries out the PCR reaction with the high-fidelity enzyme, and the amplification upstream and downstream is introduced respectively
BamH 
With
Sac 
The lotus phytochelatin synthase gene of restriction enzyme site
NnPCS1, wherein upstream primer NnPCS1-ZF sequence is SEQ ID NO. 2, downstream primer NnPCS1-ZR sequence is SEQ ID NO. 3;
(2) the PCR product with step (1) is connected to pMD19-T Simple carrier, transforms the TOP10 competent cell, extracts positive plasmid pMD19-T Simple-
NnPCS1
(3) utilize
BamH 
With
Sac 
PMD19-T Simple-NnPCS1 and plant expression vector pCAMBIA1301-220 are carried out double digestion respectively, connect
BamH 
With
Sac 
Double digestion pMD19-T Simple-
NnPCS1Obtain
NnPCS1Fragment with
BamH 
With
Sac 
The big fragment that double digestion pCAMBIA1301-220 obtains transforms the TOP10 competent cell, and positive plasmid is lotus phytochelatin synthase gene
NnPCS1Plant expression vector pCAMBIA1301-220-
NnPCS1
5. the described lotus phytochelatin synthase of claim 1 gene
NnPCS1Application in raising winter lotus or the anti-heavy metal Cd of Arabidopis thaliana.
6. the described lotus phytochelatin synthase of claim 2 gene
NnPCS1Plant expression vector improve the winter lotus or the anti-heavy metal Cd of Arabidopis thaliana in application.
7. application according to claim 6 is characterized in that described lotus phytochelatin synthase gene
NnPCS1Plant expression vector be with warp
BamH 
With
SacThe lotus phytochelatin synthase gene of I double digestion
NnPCS1Be inserted into that plant expression vector pCAMBIA1301-220 obtains.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110090228A CN102191259B (en) | 2011-04-12 | 2011-04-12 | Lotus phytochelatin synthase NnPCS1 and plant expression vector and construction method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110090228A CN102191259B (en) | 2011-04-12 | 2011-04-12 | Lotus phytochelatin synthase NnPCS1 and plant expression vector and construction method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102191259A CN102191259A (en) | 2011-09-21 |
| CN102191259B true CN102191259B (en) | 2012-10-17 |
Family
ID=44600129
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110090228A Expired - Fee Related CN102191259B (en) | 2011-04-12 | 2011-04-12 | Lotus phytochelatin synthase NnPCS1 and plant expression vector and construction method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102191259B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105385701A (en) * | 2015-12-24 | 2016-03-09 | 中国烟草总公司郑州烟草研究院 | Tobacco phytochelatin synthetase gene and application thereof |
| CN109872777B (en) * | 2019-03-14 | 2020-09-29 | 江苏省中国科学院植物研究所 | Method for screening real-time fluorescence quantitative PCR (polymerase chain reaction) reference gene of hibiscus hamabo |
| CN112143746B (en) * | 2020-09-30 | 2022-04-29 | 南京农业大学 | Gene GmAP5 for improving disease resistance of plants and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6489537B1 (en) * | 1998-08-07 | 2002-12-03 | The Trustees Of The University Of Pennsylvania | Phytochelatin synthases and uses therefor |
-
2011
- 2011-04-12 CN CN201110090228A patent/CN102191259B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN102191259A (en) | 2011-09-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101280006B (en) | Protein related to tolerance to Fe deficiency of plant, coding genes and application thereof | |
| CN107383179A (en) | A kind of and plant stress tolerance correlative protein GsSLAH3 and its encoding gene and application | |
| CN1876813B (en) | Method for improving cold resistance of zoysia | |
| CN102191259B (en) | Lotus phytochelatin synthase NnPCS1 and plant expression vector and construction method thereof | |
| CN101698854A (en) | Application of transcription thellungiella halophila CBF1 gene in improving drought resistance and salt tolerance of corn and wheat | |
| CN102094005B (en) | Antifreeze transcription factor derived from common wheat AP2/ERF family and preparation method and application thereof | |
| CN107365773A (en) | Chinese small iris cysteine rich GFP IlCDT1 and its plant expression vector and construction method | |
| CN104328127A (en) | Tumorous stem mustard stress resistance gene BjEFh1 as well as plant expression vector and application thereof | |
| CN106892973A (en) | Plant adversity resistance related protein GhMYB4 and encoding gene and application | |
| CN116836992A (en) | Application of drought-resistant nanlin895 poplar PdMYB2R089 gene | |
| CN102154316A (en) | Floral organ development gene NsAGL6 as well as plant expression vector and construction method thereof | |
| CN102154320B (en) | Chrysanthemum anti-retroelement DgZFP1, plant expression vector thereof, construction method thereof and application thereof | |
| CN101864430B (en) | Wheat introgression family gene Tamyb31 for resisting abiotic stress and application thereof | |
| CN102206662B (en) | miR399 fusion gene, construction method thereof and application thereof in plant breeding | |
| CN102660557B (en) | Chrysanthemum aquaporins coding gene CmAQP, plant expressing vector thereof and construction method | |
| CN114381462B (en) | Application of tsaoko AtDRM1 gene in improving heat resistance of plants | |
| CN103642833B (en) | Construction of plant expression vector containing apple brassinosteroid signal transduction pathway negative regulation gene BKI1 | |
| CN105408350B (en) | A kind of Avicennia marina monooxygenase CMO and its encoding gene and application | |
| CN104341492B (en) | Drought tolerant associated protein for plant OsERF71 and its encoding gene and application | |
| CN102161995B (en) | Dendranthema dichrum cold-resistant gene DdICE1 as well as plant expression vector and constructing method thereof | |
| CN102559716A (en) | Inositol methyl transferase gene derived from ice-leaf-midnight flower arista as well as preparation method and application of inositol methyl transferase gene | |
| CN118085048A (en) | BnaHIPP27 protein and application of coding gene thereof in cadmium tolerance and cadmium enrichment of plants | |
| CN104178503A (en) | Energy crop silvergrass salt-tolerant gene MsVP2 as well as plant expression vector and construction method thereof | |
| CN116855507A (en) | Application of GpbHLH101 gene in cadmium stress response and terpenoid accumulation | |
| CN102766200B (en) | Malus xiaojinensis MxVHA-c protein and coding gene thereof, and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CP02 | Change in the address of a patent holder |
Address after: 211225 Jiangsu Nanjing Lishui District Baima Town National Agricultural Science and Technology Park Nanjing Agricultural University base Patentee after: Nanjing Agricultural University Address before: 210095 Wei Gang 1, Xuanwu District, Nanjing, Jiangsu Patentee before: Nanjing Agricultural University |
|
| CP02 | Change in the address of a patent holder | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20121017 Termination date: 20200412 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |