CN105385701A - Tobacco phytochelatin synthetase gene and application thereof - Google Patents

Tobacco phytochelatin synthetase gene and application thereof Download PDF

Info

Publication number
CN105385701A
CN105385701A CN201510989403.8A CN201510989403A CN105385701A CN 105385701 A CN105385701 A CN 105385701A CN 201510989403 A CN201510989403 A CN 201510989403A CN 105385701 A CN105385701 A CN 105385701A
Authority
CN
China
Prior art keywords
gene
tobacco
tobacco plant
application
ntpcs1
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201510989403.8A
Other languages
Chinese (zh)
Inventor
翟妞
周会娜
陈千思
陈霞
刘萍萍
郑庆霞
徐国云
金立锋
张慧
高玉龙
王晨
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhengzhou Tobacco Research Institute of CNTC
Original Assignee
Zhengzhou Tobacco Research Institute of CNTC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhengzhou Tobacco Research Institute of CNTC filed Critical Zhengzhou Tobacco Research Institute of CNTC
Priority to CN201510989403.8A priority Critical patent/CN105385701A/en
Publication of CN105385701A publication Critical patent/CN105385701A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C12N9/104—Aminoacyltransferases (2.3.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y203/00—Acyltransferases (2.3)
    • C12Y203/02—Aminoacyltransferases (2.3.2)
    • C12Y203/02015—Glutathione gamma-glutamylcysteinyltransferase (2.3.2.15), i.e. phytochelatin synthase

Abstract

The invention belongs to the field of the biological technology and relates to a tobacco phytochelatin synthetase gene and application thereof, in particular to a tobacco cadmium absorption and distribution key gene and application of the gene in the fields of tobacco tar reduction and damage reduction. An interference carrier of an NtPCS1 gene is built through the gene silencing technology, a K326 silencing plant of NtPCS1 is successfully obtained, and the obtained silencing plant has a phenotype with the cadmium content obviously lower than that of a contract plant. Accordingly, by means of the gene silencing technology, expression of the NtPCS1 gene is reduced, a transgenic plant with the cadmium content being reduced can be obtained, low-cadmium tobacco breeding becomes possible, and an effective technical means is provided for reducing the cadmium content of tobacco.

Description

A kind of tobacco plant chelating peptide synthase gene and application thereof
Technical field
The invention belongs to biological technical field, be specifically related to the key gene of tobacco Cd uptake and distribution and the application in tobacco tar-reducing harm reduction field thereof.
Background technology
The content of heavy metals more and more receives the very big concern of domestic and international tobacco industry.Especially heavy metal cadmium, because its toxicity is large, it is general to pollute, the easy enrichment of tobacco, easily especially to be paid close attention to cigarette smoke migration, is one of 18 kinds of objectionable constituent preferentially disclosing of FCTC, has become one of target compound of domestic and international tobacco harm reduction.Therefore, the research that tobacco leaf cadmium controls for many years is main direction and the study hotspot of domestic and international tobacco heavy metal research and control always.China's cadmium pollution is ploughed and is accounted for about 40% of pollution arable land, the whole nation, and compared with the nineties in 20th century, China's tobacco-growing soil heavy metal element presents enrichment characteristics in various degree, and the enrichment of cadmium is especially obvious.Meanwhile, China's considerable part sound tobacco producing region is positioned at the Yunnan-Guizhou Plateau, high background area of Cadmium in Soil, causes part sound tobacco sample cadmium content higher.Therefore, China's tobacco leaf cadmium content is effectively reduced particularly outstanding with the problem improving tobacco product security.
Cd 2+absorption mainly by some to Cd 2+many base metal ion transporter or the channel protein with low affinity enter in vegetable cell.Heavy metal is then transported in vacuole by ligand complex that to carry out storing be one of approach that plant alleviates heavy metallic poison.In this course, the cell complexing of cadmium plays an important role.In vegetable cell, participate in heavy metal super-enriched relevant part mainly contain metallothionein(MT) (MTs) and phytochelatin (PCs).So by regulation and control tobacco plant chelating peptide synthetic enzyme ntPCS1expression in tobacco, reducing cadmium content in tobacco mature leaf is one of effective way of Tar.
RNA interference (RNAinterference, RNAi) is a conventional Protocols in Molecular Biology, is the selective degradation of external source or endogenous double-stranded RNA homeogenetic induction target gene mRNA in vivo, thus causes PTGS.The application of RNAi technology in plant research, has significant role in plant function genetic analysis, resistance, disease and insect resistance and genetic improvement etc.The present invention reduces the expression of NtPCS1 in tobacco by RNAi technology, thus reduces cadmium content in tobacco leaf, for tobacco bred improvement provides technical support.
Summary of the invention
The invention provides a kind of regulate and control tobacco Cd uptake and the key gene of distribution and the application in tobacco tar-reducing harm reduction field thereof, and disclose the construction process of the reticent plant of this gene.
For achieving the above object, the present invention is by the following technical solutions:
A kind of tobacco plant chelating peptide synthetase albumen gene, is characterized in that: described gene nucleotide series is as shown in SEQIDNO.1, and the aminoacid sequence of this genes encoding is as shown in SEQIDNO.2.
A kind of application of tobacco plant chelating peptide synthetase albumen gene, it is characterized in that: using the specific nucleotide acid fragment of described tobacco plant chelating peptide synthetase albumen gene as homing sequence, this nucleic acid specific fragment is inserted in plant expression vector with positive and negative both direction, build the RNAi interference carrier of tobacco plant chelating peptide synthase gene and transformation of tobacco plant, obtain the transgenic tobacco plant of low cadmium.
Described gene specific nucleotide fragments is as described in SEQIDNO3, and size is 403bp.
The special primer of described interference carrier is:
AttB1 is as shown in SEQIDNO.4;
AttB2 is as shown in SEQIDNO.5;
AttB1- ntPCS1as shown in SEQIDNO.6;
AttB2- ntPCS1as shown in SEQIDNO.7.
The medial expression vector of described interference carrier is pHellsgate2.
Described interference carrier proceeds to tobacco plant by agriculture bacillus mediated leaf disc transformation method.
The invention has the beneficial effects as follows: the interference carrier being constructed NtPCS1 gene by gene silent technology, have successfully been obtained the reticent plant of K326 of NtPCS1, the reticent plant obtained has the phenotype that cadmium content relative comparison plant obviously reduces.Visible, the expression utilizing gene silent technology to reduce NtPCS1 gene can obtain the transfer-gen plant that cadmium content reduces, and makes low cadmium tobacco breeding become possibility, provides a kind of effective technique means for reducing tobacco cadmium content.
Accompanying drawing explanation
Fig. 1 is positive colony PCR, wherein M:markerDL2000; 1-3:pHellsgate2-NtPCS1 clones;
Fig. 2 is the relative expression quantity of NtPCS1 in Gene interfere strain;
Fig. 3 is cadmium content in contrast and Gene interfere strain blade.
Embodiment
Below in conjunction with specific embodiment, set forth the present invention further, these embodiments are only not used in for illustration of the present invention and limit the scope of the invention.The test method of unreceipted actual conditions in the following example, usually conveniently condition.
The clone of embodiment 1. tobacco plant chelating peptide synthase gene total length
Tobacco plant chelating peptide synthase gene NtPCS1 of the present invention can be cDNA sequence, also can be genomic dna sequence, or has more than 90% homology with these sequences and the DNA sequence dna of identical function albumen of encoding.DNA sequence dna such as shown in SEQ ID NO:2.
By the method for homologous clone, according to the phytochelatin synthase sequence in higher plant, with the cDNA of the total serum IgE reverse transcription of K326 blade for template, design primer has been cloned ntPCS1oRF total length 1272 bpsequence (SEQIDNO:2), the protein sequence of its coding is as shown in the SEQIDNO:1 in sequence table, and sequence results analysis shows, it is very high that this albumen contains homology, high conservative.
Embodiment 2. interference carrier pHellsgate2- ntPCS1(PCS1i) structure
1, according to the requirement of bearer type and BP recombining reaction, designing two pairs of PCR primer, is for a pair based on recombination site attB1(GGGGACAAGTTTGTACAAAAAAGCA
GGCT) universal primer and attB2(GGGGACCACTTTGTACAAGAAAGCTGGGT); Other a pair adds after recombination site attB sequence ntPCS1the partial sequence of gene designs, and primer sequence is attB1- ntPCS1– AAAAAGCAGGCT cA
CTTTGTACAAGAAAGCTGGGT，attB2- NtPCS1-AGAAAGCTGG
GT CCGGTATGATCCGGTACGAAAA。
2, first with attB1- ntPCS1/ attB2- ntPCS1carry out first round pcr amplification, PCR reaction system is: 1 μ lcDNA is template, 5 μ l10 × PyrobestDNApolymerasebuffer, 5 μ ldNTPs(2mmol/L), 0.2 μ lattB1- ntPCS1primer (10 μm of ol/L), 0.2 μ lattB2- ntPCS1primer (10 μm of ol/L), 0.25 μ l high-fidelity PyrobestDNApolymerase (Takara, Japan), add ddH2O to 50 μ l final volume.PCR response procedures: 94 DEG C, 2min; 94 DEG C, 30s, 58 DEG C, 45s, 72 DEG C, 30s, 10 circulations; 72 DEG C, 5min, 4 DEG C of termination reactions.
3, getting PCR primer is template, carry out second with attB1/attB2 primer and take turns amplification, PCR reaction system is: 5 μ l the first step PCR primer are template, 5 μ l10 × PyrobestDNApolymerasebuffer, 4 μ ldNTPs(2mmol/L), 4 μ lattB1primer (10 μm of ol/L), 4 μ lattB2primer (10 μm of ol/L), 0.25 μ l high-fidelity PyrobestDNApolymerase (Takara, Japan), adds ddH 2o to 50 μ l final volume.PCR program: 94 DEG C of sex change 2min; 94 DEG C, 30s, 45 DEG C, 30s, 72 DEG C, 30s, 5 circulations; 94 DEG C, 30s, 58 DEG C, 30s, 72 DEG C, 30s, 5 circulations; 72 DEG C, 8min, 4 DEG C of termination reactions.
4, second take turns pcr amplification after, PCR primer is by 1% sepharose separation detection and reclaim target fragment, carries out exchange recombining reaction (BP reacts) with the plasmid of interference vector pHellsgate2.Recombining reaction system: 5 μ lBP damping fluids, 100ngPCR product, 100ngpHellsgate2 plasmid DNA, 4 μ lBPClonase, 25 DEG C of reaction 12h, then add Proteinase K, 37 DEG C of 10min termination reactions.Reagent used is that Gateway BRClonase IIenzymemix is purchased from Invitrogen company.
5, connect product and proceed to bacillus coli DH 5 alpha by thermal shock conversion method, utilize special primer (attB1- ntPCS1/ attB2- ntPCS1) PCR detection is carried out to positive colony.Extract positive recombinant plasmid, electric shocking method transformation Agrobacterium GV1301.Screening positive clone on the LB flat board containing Rif50mg/L, Spe100mg/L, and PCR checking (Fig. 1) is carried out to institute's menu bacterium colony.
The preparation of embodiment 3. transgene tobacco
1, aseptic seedling preparation
1) the K326 seed getting proper amt is placed in 1.5mL centrifuge tube, adds 1mL70% ethanol, and sterilization 30s or directly upset vibration are for several times.Treat sedimentation, suck ethanol.
2) the NaClO product 1mL added containing 2-2.5% available chlorine puts upside down vibration 6-7min, sucks NaClO solution.
3) by sterile water wash about at least 5 times, overturn the about 1min that vibrates at every turn, need be completely clean by Javelle water, avoid affecting seed germination rate.Suck sterilized water.
4) to sterilize scissors, sterile yellow rifle head front end is cut into wedge shape (or be cut into wedge shape after autoclaving), gets planting seed on MS solid medium with rifle head.
5) with sealed membrane sealing, 28 ° of C illumination cultivation can be germinateed for about 3 days.Diligent observation, if there is a small range of pollution, available scalpel cuts; If there is large stretch of fungal contamination, then should discard.
2, leaf disk method transforms
1) stand-by knife blade, tweezers were thoroughly burnt more than three times, for cut-off blade on spirit lamp;
2) remove blade edge part and master pulse part, general leaf can be cut into four explants;
3) often change a blade, all to burn tweezers and blade in order to avoid pollute;
4) explant cut is put into sterilizing plate, pour preprepared Agrobacterium bacterium liquid (having proceeded to target plasmid pHellsgate2-NtPCS1) (OD600=0.6-0.8) into, this process should operate near air outlet place, in order to avoid Agrobacterium is flown away inside super clean bench at super clean bench as far as possible.
5) with tweezers, each explant is infiltrated bacterium liquid, cover plate lid and infect 10min;
6) tweezers gripping explant to aseptic filter paper sops up the excessive Agrobacterium of blade surface, move into surface afterwards and be covered with on the Dual culture substratum of one deck filter paper;
7) seal up with sealed membrane and put into dark condition and carry out light culture 48h.
3, differentiation culture
1), after light culture, explant is moved in differentiation screening culture medium;
2) subculture was changed to ensure nutrient supply every about 7 days after.Shift in explant process between ware, before plate opened by super clean bench, should examine with or without Browning, if any pollution, first should shift the plate not having to pollute;
3) often change a Dual culture plate, all thoroughly will burn tweezers in order to avoid fungi pollution between ware.
Attention: as substratum has fungi pollution, when occurring fungi in substratum, should discard, and can not open plate in order to avoid fungal spore diffusion in group training room.When occurring Agrobacterium, super clean bench wind-force should be transferred to minimum, operate near super clean bench air port, and the time of opening germy plate to try one's best short, the opening of plate can not exceed the half of ware size, reduces bacterium and is diffused into probability in air.These operations should complete fast.
4, root culture
1) when the explant of differentiation culture differentiates 1cm high seedling, cut with the blade burnt the seedling (try not to switch to callus, but intercotyledonary for two panels leaf bud vegetative point can not be destroyed) differentiated to move in 1/3MS root media.
2) often cut one piece of explant, all will burn a blade and tweezers, and the seedling of planting in substratum should not insert in substratum too dark, seedling base portion inserts substratum and fixes, and tweezers do not stop the long time in order to avoid pollute on substratum simultaneously.
5, hardening and transplanting
1), when cultivation is taken root and reached 2cm for about one month, the mouth of tissue culture bottle is opened wide, adds appropriate water, place in greenhouse and within 1-2 days, carry out hardening (also directly can transplant and bury).
2) young plant is taken out from tissue culture bottle, careful and thoroughly remove the solid medium (with the thorough wash clean of water) of young plant root, then move in flowerpot, cover 2-3 days (moisturizing) with preservative film above, after young plant growth is normal, remove preservative film.
6, contrast strain K326 is set, when transgenic seedling grows to 6-8 sheet leaf, chooses the consistent plant of growing way and carry out gene NtPCS1 detection of expression.As shown in Figure 2: and contrast ratio, the expression amount of NtPCS1 declines about 90%, and silencing efficiency is good.
7, choose ntPCS1the obvious reticent strain of expression amount decline, and the experiment of water planting Cadmium treated is carried out in contrast.1 μm of ol/L concentration of cadmium ions process 24 hours, ICP-MS method detects blade cadmium content, as Fig. 3.With adjoining tree ratio, in reticent strain blade, cadmium content obviously reduces, decline 60%-70%.
Experimental result of the present invention shows: by the method for Gene interfere, reduces ntPCS1expression, the cadmium content in fresh tobacco leaves significantly reduces.

Claims (7)

1. a tobacco plant chelating peptide synthetase albumen gene, is characterized in that: described gene nucleotide series is as shown in SEQIDNO.1, and the aminoacid sequence of this genes encoding is as shown in SEQIDNO.2.
2. the application of a tobacco plant chelating peptide synthetase albumen gene, it is characterized in that: with the specific nucleotide acid fragment of described tobacco plant chelating peptide synthetase albumen gene, import in plant expression vector by recombining reaction, build the RNAi interference carrier of tobacco plant chelating peptide synthase gene and transformation of tobacco plant, obtain the transgenic tobacco plant of low cadmium.
3. the application of tobacco plant chelating peptide synthetase albumen gene as claimed in claim 2, is characterized in that: described gene specific nucleotide fragments is as shown in SEQIDNO3.
4. the application of tobacco plant chelating peptide synthetase albumen gene as claimed in claim 2, is characterized in that: the special primer of described interference carrier is:
AttB1 is as shown in SEQIDNO.4;
AttB2 is as shown in SEQIDNO.5;
AttB1- ntPCS1as shown in SEQIDNO.6;
AttB2- ntPCS1as shown in SEQIDNO.7.
5. the application of tobacco plant chelating peptide synthetase albumen gene as claimed in claim 2, is characterized in that: the specificity interference fragment of described interference carrier is as SEQIDNO.3, and size is 403bp.
6. the application of tobacco plant chelating peptide synthetase albumen gene as claimed in claim 2, is characterized in that: the medial expression vector of described interference carrier is pHellsgate2.
7. the application of tobacco plant chelating peptide synthetase albumen gene as claimed in claim 2, is characterized in that: described interference carrier proceeds to tobacco plant by agriculture bacillus mediated leaf disc transformation method.
CN201510989403.8A 2015-12-24 2015-12-24 Tobacco phytochelatin synthetase gene and application thereof Pending CN105385701A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510989403.8A CN105385701A (en) 2015-12-24 2015-12-24 Tobacco phytochelatin synthetase gene and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510989403.8A CN105385701A (en) 2015-12-24 2015-12-24 Tobacco phytochelatin synthetase gene and application thereof

Publications (1)

Publication Number Publication Date
CN105385701A true CN105385701A (en) 2016-03-09

Family

ID=55418480

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510989403.8A Pending CN105385701A (en) 2015-12-24 2015-12-24 Tobacco phytochelatin synthetase gene and application thereof

Country Status (1)

Country Link
CN (1) CN105385701A (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2216408A1 (en) * 2007-10-24 2010-08-11 Navarro Aviño, Juan Pedro Method for improving salinity tolerance
CN102191259A (en) * 2011-04-12 2011-09-21 南京农业大学 Lotus phytochelatin synthase NnPCS1 and plant expression vector and construction method thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2216408A1 (en) * 2007-10-24 2010-08-11 Navarro Aviño, Juan Pedro Method for improving salinity tolerance
CN102191259A (en) * 2011-04-12 2011-09-21 南京农业大学 Lotus phytochelatin synthase NnPCS1 and plant expression vector and construction method thereof

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BYOUNG DOO LEE ET AL.: "Tobacco phytochelatin synthase (NtPCS1) plays important roles in cadmium and arsenic tolerance and in early plant development in tobacco", 《PLANT BIOTECHNOL REP》 *
GENBANK: "XM_009764962.1", 《NCBI》 *
JIANG-CHUAN LI ET AL.: "RNA Interference-mediated Silencing of Phytochelatin Synthase Gene Reduce Cadmium Accumulation in Rice Seeds", 《JOURNAL OF INTEGRATIVE PLANT BIOLOGY》 *
付强等: "烟草植物螯合肽合成酶PCS1基因的电子克隆和序列分析", 《江苏农业科学》 *

Similar Documents

Publication Publication Date Title
Hu et al. Engineering non-transgenic gynoecious cucumber using an improved transformation protocol and optimized CRISPR/Cas9 system
WO2016119703A1 (en) Method for conducting site-specific modification on entire plant via gene transient expression
Odipio et al. Transgenic overexpression of endogenous FLOWERING LOCUS T-like gene MeFT1 produces early flowering in cassava
Navet et al. Efficient targeted mutagenesis in allotetraploid sweet basil by CRISPR/Cas9
CN110331145B (en) Application of miR156 and related biological materials thereof in regulation and control of plant disease resistance
CN107338230B (en) The application of OsMPK11 albumen and its encoding gene in regulation plant drought resistance
CN104480124A (en) Indicator gene used in TRV-mediated gene silencing system as well as construction method and application of carrier thereof
CN110904119B (en) XNDL2 gene, protein, overexpression vector, and method for obtaining rice with banded sclerotial blight resistance and application
Bao et al. CRISPR/Cas9-based gene editing in soybean
Zhang et al. Advances in genetic modification of cassava
Gatica-Arias et al. Genetic transformation of hop (Humulus lupulus L. cv. Tettnanger) by particle bombardment and plant regeneration using a temporary immersion system
Kang et al. A robust genome-editing method for wild plant species Nicotiana attenuata
CN102978235A (en) Betula luminifera transgene method adopting agrobacterium mediating
US20230132082A1 (en) Agrobacterium-mediated genetic transformation method for sea barleygrass
CN107794278B (en) Rapid transgenic method of populus trichocarpa based on hygromycin screening
CN105385701A (en) Tobacco phytochelatin synthetase gene and application thereof
CN104805093B (en) Applications of the paddy gene OsLOL3 in delaying plant leaf blade aging and improving drought resistance in plants
JP2007312635A (en) Tree reinforced with citric acid-secretory ability and method for creating the same
CN107338231A (en) The application of OsMPK21-1 albumen and its encoding gene in plant drought resistance is regulated and controled
Xu et al. High-efficiency agrobacterium-mediated transformation of chrysanthemum via vacuum infiltration of internode
CN105255898A (en) SgRNA for silencing rice catalase gene OSCAT3
CN105463014A (en) RNAi anti-ASPV (Apple Stem Pitting Virus) expression vector and application thereof in apple breeding for disease resistance
CN104988176B (en) Method for improving gum content of eucommia ulmoides
CN106811448B (en) Cotton tyrosine phosphatase GhPTP1 and its encoding gene and application
CN114805513B (en) Tobacco NtOEE1 gene and application thereof in regulation of stem and leaf included angle and plant height

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20160309