CN102766200B - Malus xiaojinensis MxVHA-c protein and coding gene thereof, and application thereof - Google Patents

Abstract

The invention discloses a Malus xiaojinensis MxVHA-c protein and a coding gene thereof, and application thereof. The Malus xiaojinensis MxVHA-c protein provided by the present invention is a protein (a) or (b) as follows: (a) a protein composed of an amino acid sequence shown in a sequence 1 in the sequence table; and (b) a protein derived from (a), related to iron deficiency tolerance of plant, and obtained by replacement and / or deletion and / or addition of one or more amino acid residues on an amino acid residue sequence of the sequence 1 in the sequence table. The MxVHA-c provided by the invention has important regulatory effect on plant with iron deficiency stress, and provides a good theoretical basis for further study on iron deficiency tolerance of Malus xiaojinensis.

Description

Malus xiaojinensis MxVHA-c albumen and encoding gene thereof and application

Technical field

The present invention relates to malus xiaojinensis MxVHA-c albumen and encoding gene thereof and application.

Background technology

Ferro element is one of essential nutritive element of plant-growth.Plant iron deficiency can cause degradation phenomenon under blade yellow, early ageing, photosynthesis, and severe patient causes Crops production and quality to decline.Agriculture production iron deficiency is a global problem, and there is the report of a large amount of relevant plant iron deficiencies countries in the world.Therefore, need to develop the way of effective resistance to iron deficiency.

Summary of the invention

An object of the present invention is to provide the albumen relevant to iron deficiency resistance of plants and encoding gene thereof.

The albumen relevant to iron deficiency resistance of plants provided by the present invention, name is called MxVHA-c, derives from Malus xiaojinensis (Malus xiaojinensis), is following (a) or protein (b):

(a) protein that the aminoacid sequence shown in sequence 1 forms in sequence table;

(b) by the amino acid residue sequence of sequence in sequence table 1 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and relevant to iron deficiency resistance of plants by (a) derivative protein.

Wherein, the sequence in sequence table 1 is comprised of 166 amino-acid residues.

In order to make 1) in MxVHA-c be convenient to purifying, the N-terminal of the protein that can form at the aminoacid sequence shown in sequence in sequence table 1 or C-terminal connect label as shown in table 1.

The sequence of table 1 label

Label	Residue	Sequence
			Poly-Arg	5-6(is generally 5)	RRRRR
Poly-His	2-10(is generally 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

Above-mentioned 2) MxVHA-c in can synthetic, also can first synthesize its encoding gene, then carries out biological expression and obtain.Above-mentioned 2) encoding gene of the MxVHA-c in can be by lacking the codon of one or several amino-acid residue by sequence in sequence table 2 in the DNA sequence dna shown in 5 ' end 1-498 bit base, and/or carry out the missense mutation of one or several base pair, and/or the encoding sequence that connects the label shown in table 1 at its 5 ' end and/or 3 ' end obtains.The replacement of described one or several amino-acid residue and/or disappearance and/or interpolation can be replacement and/or disappearance and/or the interpolation that is no more than 10 amino-acid residues.

Above-mentioned and encoding gene iron deficiency resistance of plants associated protein also belongs to protection scope of the present invention.

Described and encoding gene iron deficiency resistance of plants associated protein specifically can be following 1)-4) in arbitrary described gene:

1) sequence 2 DNA molecular shown in the 1st-498 Nucleotide from 5 ' end in sequence table;

2) DNA molecular shown in sequence 2 in sequence table;

3) under stringent condition with 1) or 2) shown in DNA molecule hybridize and the DNA molecular of encoding said proteins;

4) with 1) or 2) or 3) gene there is more than 90% homology and the DNA molecular of encoding said proteins.

Sequence 2 in above-mentioned sequence table is comprised of 498 Nucleotide, and its open reading frame (ORF) is from 5 ' end 1-498 position deoxynucleotide, and the aminoacid sequence of coding is as shown in the sequence 1 in sequence table.

Expression cassette, recombinant expression vector, transgenic cell line or the recombinant bacterium of the encoding gene that contains described and iron deficiency resistance of plants associated protein also belong to protection scope of the present invention.

Described recombinant expression vector is between the multiple clone site of pYES2.0 carrier, to insert the recombinant expression vector that encoding gene described and iron deficiency resistance of plants associated protein obtains.

Another object of the present invention is to provide a kind of method that obtains recombination microzyme.

The method of acquisition recombination microzyme provided by the present invention is following 1) or 2) shown in:

1) encoding gene with iron deficiency resistance of plants associated protein is imported and set out in yeast, obtain V-type H ⁺the recombination microzyme that-ATPase enzymic activity increases;

2) encoding gene with iron deficiency resistance of plants associated protein is imported and set out in yeast, obtain resistance to Cd ²⁺the recombination microzyme that murder by poisoning ability strengthens and/or resistance to iron deficiency ability strengthens.

Described and encoding gene iron deficiency resistance of plants associated protein is to be imported and set out in yeast by Yeast expression carrier.

The described yeast that sets out is wild-type yeast bacterial strain BJ2168(Saccharomyces cerevisiae).

The recombination microzyme obtaining according to described method also belongs to protection scope of the present invention.

The application in cultivating resistance to iron deficiency plant of above-mentioned arbitrary described albumen or its encoding gene also belongs to protection scope of the present invention.

Another object of the present invention is to provide a kind of method of cultivating the transgenic plant of resistance to iron deficiency ability enhancing.

The method of the transgenic plant that the resistance to iron deficiency ability of cultivation provided by the present invention strengthens, is that the encoding gene of above-mentioned albumen is imported and set out in plant, obtains the transgenic plant that tolerant to iron deficiency can strengthen.

The described plant that sets out is dicotyledons, is specially Arabidopis thaliana.

Malus xiaojinensis MxVHA-c albumen provided by the present invention and encoding gene MxVHA-c thereof have very important regulating effect for the plant of Fe Deficiency, the present invention's material malus xiaojinensis used is the plant that is a kind of resistance to iron deficiency, it is a kind of typical mechanism I plant, that is: plant must be by activating the H on plasma membrane ⁺-ATPase, makes soil acidification, increases the solubility of iron.Then under the effect of ferric iron reductase enzyme, ferric iron is reduced into ferrous iron, under the effect of the ferrous iron translocator on plasma membrane, transports in tenuigenin, increase the tolerant to iron deficiency of plant.

MxVHA-c gene provided by the present invention has very important regulating effect for the plant of Fe Deficiency, and the present invention provides good theoretical foundation for further studying the tolerant to iron deficiency of malus xiaojinensis.

Accompanying drawing explanation

Fig. 1 is the pcr amplification product result of MxVHA-c gene.

Fig. 2 is the fluorescent quantitative PCR result of MxVHA-c gene in malus xiaojinensis Different Organs under different iron processing horizontals.

Fig. 3 is that the enzyme of MxVHA-c gene transient expression carrier pEZS-MxVHA-c is cut qualification result.

Fig. 4 is the Subcellular Localization detected result of MxVHA-c gene.

Fig. 5 is that the enzyme of Yeast expression carrier pYES2.0-MxVHA-c-GFP is cut result.

Fig. 6 is the PCR qualification result of transgenic yeast.

Fig. 7 is V-type H in transgenic yeast ⁺the mensuration that-ATPase enzyme is lived.

Fig. 8 is the growing state of transgenic yeast under 40 μ M Ferrozine dispositions.

Fig. 9 is that transgenic yeast is at 10 μ M CdCl ₂growing state under disposition.

Figure 10 is that the PCR of transgenic line identifies

Figure 11 is the growing state of transgenic arabidopsis in iron deficiency situation.

Embodiment

The experimental technique using in following embodiment if no special instructions, is ordinary method.

In following embodiment, material used, reagent etc., if no special instructions, all can obtain from commercial channels.

Embodiment 1, with the acquisition of iron deficiency resistance of plants associated protein MxVHA-c and encoding gene thereof

One, the acquisition of MxVHA-c full length gene

With malus xiaojinensis (Malus xiaojinensis), (public Ke Cong China Agricultural University obtains, the non-patent literature of recording this malus xiaojinensis is: Cheng Minghao, Li Xiaolin, Zhang Yun is expensive, the good rootstock resource-malus xiaojinensis of apple, Agricultural University Of Southwest's journal, in October, 2000,22(5): being 383-386) experiment material, extracting the total RNA of its blade, is cDNA by its reverse transcription.Take this cDNA as template, take sequence 3 in primers F 1(sequence table) and primer R1(sequence table in sequence 4) be primer pair:

Primers F 1:AAA gAATTCaTGTCTTCTTCAACCTTC, underscore partly represents restriction enzyme site EcoRI,

Primer R1:AAA gTCGACcCCTCAGCTCTTGACTGACC, underscore partly represents restriction enzyme site SalI,

Carry out pcr amplification, in reaction system, use the HiF mix of high-fidelity, to guarantee the specificity of amplification.Pcr amplification reaction system is as follows:

PCR reaction conditions: first 94 ℃ of denaturation 3min; Then 94 ℃ of sex change 40S, 58 ℃ of annealing 40S, 72 ℃ are extended 1min, totally 30 circulations; Last 72 ℃ are extended 10min.

Get PCR product and carry out 1% agarose gel electrophoresis, result as shown in A in Fig. 1, wherein, the DNA molecular amount standard that swimming lane M is 2000bp, swimming lane 1 and swimming lane 2 are pcr amplification product.Result shows to obtain the object fragment of 498bp.Cut object band, after purifying reclaims, according to pEASY-T1 sample-Vector Kit support agent box (purchased from Quan Shijin biotech firm) specification sheets, PCR product is connected to carrier pEASY-T1 sample(purchased from Quan Shijin biotech firm) upper, after cutting checking, SalI and EcoRI enzyme check order.Enzyme is cut the result as shown in figure B: the DNA molecular amount standard that swimming lane M is 15000bp, swimming lane 1 is cut the product of checking for enzyme.Sequencing result shows, pcr amplification product sequence total length is 498bp, its nucleotide sequence as sequence in sequence table 2 from as shown in the Nucleotide of 5 ' end 1-498 position, coding has the protein of the amino acid residue sequence shown in sequence 1 in sequence table, and in sequence table, sequence 1 is comprised of 166 amino-acid residues.By this unnamed gene, be MxVHA-c, by the albumen called after MxVHA-c of this genes encoding.

Two, the expression analysis of MxVHA-c gene in malus xiaojinensis Different Organs

Malus xiaojinensis tissue cultured seedling is cultivated in growth medium (MS+0.5mg/L IBA+0.2mg/L 6-BA), after it grows into stem lignifying, be transferred to root media (1/2MS+1.0mg/L IBA), tissue cultured seedling bears after white root, moving to 1/2 pancebrin (forms in Table 2, initial pH value is adjusted to 6.0 with NaOH) in overlay film moisturizing cultivate 2 weeks, proceeding to afterwards pancebrin (forms in Table 1, initial pH value is adjusted to 6.0 with NaOH) cultivate one month, change weekly pancebrin one time, culture condition is: illumination cultivation 16 hours (photon gamma flux density 250 μ EM-2S-1), temperature is 25 ± 2 ℃, dark culturing 8 hours, temperature is 17 ± 2 ℃.Carry out afterwards iron deficiency induction, method is: plant is gone to from pancebrin containing 4 μ M Fe nutritive mediums (form in Table 3, initial pH value is adjusted to 6.0 with NaOH), deionized water rinsing before shifting.

The formula of table 1 pancebrin

The formula of table 21/2 pancebrin

Table 3 is containing the formula of 4 μ M Fe nutritive mediums

Extract respectively normal iron (Hoagland nutritive medium+40 μ M Fe-EDTA) and the low iron of supplying and process (Hoagland nutritive medium+4 μ M Fe-EDTA) 0,12h, 1d, 3d, 6d and the malus xiaojinensis young root of 9d, total RNA of climax leaves, ultraviolet spectrophotometer is measured respectively the content of the RNA of Different Organs, different treatment, the above-mentioned RNA that the quality such as gets, reverse transcription becomes strand cDNA.This strand cDNA of take is template, first usings 18s gene as internal reference, uses 18s primer:

18SR-F：5′-ACACGGGGAGGTAGTGACAA-3′，

18SR-R：5′-CCTCCAATGGATCCTCGTTA-3′，

Carry out pcr amplification, according to agarose gel electrophoresis result, adjust the consumption of different treatment template, the pcr amplification product brightness that makes each process 18s is consistent.After different treatment template Determination of quantity, carry out the amplification of MxVHA-c3 gene.The primer of MxVHA-c gene amplification is: RT-F1 and RT-R1,

RT-F1：GGTAGTTATGGCGGGAGTGTTGGGT，

RT-R1：GGTAATAGGACTTAGCCTTGGGGTT，

First with common Taq enzyme, carry out the checking of RT-PCR, according to primer synthetic step back temperature, increase.Reaction system is as follows:

Reaction conditions is: 95 ℃ of sex change 5s, and 55 ℃ of annealing 30s, 72 ℃ are extended 30s, totally 40 circulations; Primer is measured the expression of gene in different iron deficiency situations with quantitative real time PCR Instrument after determining, in test, with 18s, does internal reference.The step of quantitative fluorescent PCR two-step approach is: 95 ℃ of denaturation 30s, and 95 ℃ of sex change 5s then, 55 ℃ of annealing 30s, 72 ℃ are extended 30s, totally 40 circulations; Last 95 ℃ of 15s, 60 ℃ of 1min, 95 ℃ of 15s.

As shown in Figure 2, result shows RT-PCR amplification: MxVHA-c gene has expression in root, climax leaves, and the expression amount in root is slightly higher than the expression amount in leaf.In iron deficiency 12h, in root, the expression amount of gene significantly strengthens, and expression amount declines and occurs a series of fluctuation afterwards.In leaf, along with the increase in treatment time, the expression amount of gene strengthens, and during by the 3rd day, reaches the highest, and expression amount declines afterwards.Experimental result can also show MxVHA-c gene meeting up-regulated expression in short period of time and long-time iron deficiency processing root, and iron deficiency is processed the MxVHA-c gene in leaf within 1-3d can up-regulated expression.Illustrate if be subject to for a long time Fe Deficiency, plant is by regulating the MxVHA-c gene of root to increase the adaptive of resistance to iron deficiency.

Three, the Subcellular Localization of MxVHA-c gene

The structure of the transient expression carrier that 1, MxVHA-c gene and GFP merge

The cDNA that the above-mentioned iron deficiency of take is processed the malus xiaojinensis root of 12h is template, use sequence 3 in primers F 1(sequence table) and R1(sequence table in sequence 4) carry out pcr amplification acquisition MxVHA-c full length gene sequence (having removed the MxVHA-c open reading frame of terminator codon), and cloned in pEASY-T1 sample carrier, after SalI and EcoRI enzyme are cut, clone again in pEZS-NL carrier (purchased from Quan Shijin Bioisystech Co., Ltd) and build transient expression carrier pEZS-MxVHA-c.PEZS-MxVHA-c transforms bacillus coli DH 5 ɑ bacterial strain, the positive spot of picking carries out bacterium colony PCR, enzyme is cut and identified and sequence verification, enzyme is cut qualification result as shown in Figure 3, wherein, swimming lane M is the DNA molecular amount standard of 15000bp, and swimming lane 1 is cut identification result figure for the enzyme of transient expression carrier pEZS-MxVHA-c.The bacterial plaque that qualification result is positive is shaken to bacterium, extract plasmid and carry out sequence verification.Sequencing result shows, inserted sequence 2 in sequence table and, from the nucleotide sequence shown in 5 ' end 1-498 position, illustrate that transient expression carrier pEZS-MxVHA-c builds correct between the SalI of pEZS-NL carrier and EcoRI restriction enzyme site.

2, adopt particle bombardment to carry out expression vector to the conversion of onion epidermis cell

(1) preparation of onion epidermis to be transformed

Under aseptic condition, the entocuticle of the onion of tearing, is laid in the culture dish that contains MS substratum, then culture dish is wrapped standby with masking foil.

(2) preparation of bronze suspension

Take 60mg bronze, put into the centrifuge tube of 1.5ml sterilizing, add 1ml dehydrated alcohol, concussion 1min, the centrifugal 10s of 10000rpm, abandons supernatant, then adds 1ml dehydrated alcohol, concussion 1min, the centrifugal 10s of 10000rpm; Abandon supernatant, bronze is suspended from 1ml sterilized water, obtain bronze suspension ,-20 ℃ save backup.

(3) preparation of bronze-plasmid dna complex zoarium

Draw bronze suspension, 3.5 μ l 0.1M nitrosamine, the 8.5 μ l 2.5M CaCl of 8.5 μ l above-mentioned steps 2 preparations ₂2H ₂the transient expression carrier pEZS-MxVHA-c that O and 5 μ l above-mentioned steps (1) obtain, by the 3min that vibrates on mixture earthquake device; The centrifugal 20s of 10000rpm; Abandon supernatant, with dehydrated alcohol rinsing 3 times; Add 30 μ l dehydrated alcohols to suspend, obtain bronze-plasmid dna complex zoarium standby.

(4) bombardment receptor material

Select the pressure membrane of certain pressure, in the dehydrated alcohol 70% together with bombardment film, soak 1-2 hour, taking-up is dried; Sterilizing on spirit lamp after 70% soaked in absolute ethyl alcohol for metal plate washer; Get bronze-plasmid dna complex zoarium that 10 μ l above-mentioned steps 3 prepare, evenly coat on the mid-way of bombardment film, be not applied on whole film, the area of coating is consistent with the pore diameter range on carrier solid circle; After film is dried, be installed on launching device; Pressure membrane is installed to the lower end of gas accelerator; Onion epidermis cell is placed in the middle part of culture dish, puts into vacuum chamber, takes off culture dish lid; Vacuumize pointer to 26; Exit in gas accelerator, until pressure reaches in the time of can splitting the pressure that film can bear in pipe, can split film and break, gas is flushed on bombardment film, and carrier moves downward, and by metal plate washer, is blocked, and metallic particles below sees through the mesh of metal plate washer, directive target cell.

(5) Fluirescence observation

Culture dish is sealed with Parafilm, cultivated 24h for 28 ℃, in the expression of fluorescence microscopy Microscopic observation green fluorescence, adopting uses the same method processes control plasmid pEZS-NL.Concrete outcome as shown in Figure 4.Wherein, A1 is the control plasmid pEZS-NL bright field photo through modifying, and A2 is the control plasmid pEZS-NL dark field photo through modifying, and B1 is plasmid pEZS-MxVHA-c bright field photo, and B2 is plasmid pEZS-MxVHA-c dark field photo.Result shows, MxVHA-c is mainly positioned on vacuole skin.

The acquisition of experimental example 2, transgenic yeast and the analysis of resistance to heavy metal toxicity thereof

One, the MxVHA-c gene transformation yeast that clone obtains

Use respectively the plasmid (Beijing DingGuo ChangSheng Biology Technology Co., Ltd) of EcoRI and XbaI enzyme cutting pEZS-MxVHA-c, pEZS-NL and Yeast expression carrier pYES2.0, glue reclaims respectively, obtain respectively the MxVHA-c-GFP of 1218bp and the GFP of 720bp, be connected on the pYES2.0 after enzyme is cut, obtain recombinant expression vector pYES2.0-MxVHA-c-GFP and pYES2.0-GFP, the latter can be used as positive control.

Recombinant expression vector pYES2.0-MxVHA-c-GFP and pYES2.0-GFP are transformed to competent escherichia coli cell, extract plasmid, with EcoRI and XbaI enzyme cutting, agarose gel electrophoresis detects, and obtains the MxVHA-c gene fragment of 498bp left and right.Result as shown in Figure 5, the DNA molecular amount standard that wherein swimming lane M is DL15000bp, swimming lane 1 is cut result for the enzyme of pYES2.0-MxVHA-c-GFP, and result shows that pYES2.0-MxVHA-c-GFP and pYES2.0-GFP are the expression vector that contains MxVHA-c-GFP and GFP gene.

First (this substratum of SD-Ura-comprises Difco yeast nitrogen base 6.7g/l to join yeast growth type substratum (YPD) and defective type substratum, L-Isoleucine 300mg/l, L-Valine 1500mg/l, L-Adenine hemisufate salt200mg/l, L-Arginine HCl 200mg/l, L-Histidine HCl monohydrate 200mg/l, L-Leucine1000mg/l, L-Lysine HCl 300mg/l, L-Methionine 200mg/l, L-Phenylalanine 500mg/l, L-Threonine 2000mg/l, L-Tryptophan 200mg/l, L-Tyro sine 300mg/l and mass percent concentration are 40% glucose), then utilize yeast conversion test kit (general Jino, Beijing Science and Technology Ltd.) will contain MxVHA-c-GFP and GFP recombinant expression vector pYES2.0-MxVHA-c-GFP and pYES2.0-GFP and import the acquisition of wild-type yeast bacterial strain BJ2168(public Ke Cong China Agricultural University, the non-patent literature of recording this material is: Hong Ding, Lihong Duan, Huilan Wu, et al.Regulation of AhFRO1, an Fe (III)-chelate reductase of peanut, during iron deficiency stress and intercropping with maize.Physiologia Plantarum136:274 – 283.2009) in, obtain recombinant bacterium BJ2168/pYES2.0-MxVHA-c-GFP and BJ2168/pYES2.0-GFP, coat defective type substratum (SD-Ura ^-) upper, picking positive colony, carries out bacterium colony PCR evaluation with primers F 1 and R1.Result is as shown in Figure 6: wherein, M is the DNA molecular amount standard of DL15000bp Plus, the negative contrast recombinant bacterium BJ2168/pYES2.0-GFP of swimming lane 1,2, and swimming lane 3 is recombinant bacterium BJ2168/pYES2.0-MxVHA-c-GFP.Result shows, Yeast expression carrier pYES2.0-MxVHA-c-GFP and pYES2.0-GFP successfully proceed in yeast strain BJ2168.

Two, V-type H in yeast ⁺the mensuration of-ATPase enzymic activity

First utilize fungi/yeast cell film vesica (RSOV and IOV) to prepare the vacuole skin that test kit (Shanghai Jie Mei gene Pharmaceutical Technology Co., Ltd) extracts yeast cell, the membranin of extraction utilizes hydrogen ion membrane channel (V-type ATP enzyme) green fluorescence detection kit (Shanghai Jie Mei gene Pharmaceutical Technology Co., Ltd) to detect the V-type H of yeast ⁺-ATPase enzymic activity, as shown in Figure 7, the RFU ratio of genetically modified yeast (pYES2.0-MxVHA-c-GFP) turns the low of empty carrier contrast (pYES2.0-GFP), illustrated more H+ by pump in tenuigenin in vacuole skin, thereby proved the V-type H of genetically modified yeast ⁺-ATPase enzymic activity is than the height that turns unloaded yeast cell.

Three, the existence situation of transgenic yeast in iron deficiency environment

Genetically modified yeast (pYES2.0-MxVHA-c-GFP) with turn empty carrier and contrast (pYES2.0-GFP) and containing 40 μ m Ferrozine(-Fe) YPD substratum in incubated overnight, when the OD of every pipe value reaches 1, start timing, mensuration-Fe processes the OD value of 0h, 12h, 24h, 48h respectively.Thereby to crossing the tolerant to iron deficiency analysis of the yeast of expressing gene.Result as shown in Figure 8, as seen from the figure, genetically modified yeast (pYES2.0-MxVHA-c-GFP) is than yeast growth fast that turns empty carrier contrast (pYES2.0-GFP), can in the substratum of iron deficiency, grow, in iron deficiency is processed 1d, can see that the OD value of the yeast of appearing expressing gene is apparently higher than what contrast, illustrate that yeast can stand coercing of iron deficiency.

Four, the more resistance to Cd of transgenic yeast ²⁺poison

Get 10ul and add 3mlSD-Ura through the bacterium liquid of identifying ^-liquid nutrient medium, 28 ℃, 200rpm overnight incubation.Second day is put into 4mlSD-Ura from wherein getting 20ul ^-liquid nutrient medium adds Cdcl simultaneously ₂making its final concentration is 10 μ M, measures the OD of each pipe simultaneously in uv-spectrophotometric instrument ₆₀₀, each manages consistent 28 ℃ afterwards of concentration, and 200rpm cultivates, and measures the concentration (different time points is surveyed three times) of respectively managing bacterium liquid respectively at 0h, 24h, 48h, 72h and 96h.As shown in Figure 9, the increment that turns unloaded yeast (pYES2.0-GFP) presents downward trend always, and 10uM Cdcl is described ₂had a strong impact on the growth of yeast cell.And the yeast (pYES2.0-MxVHA-c-GFP) that turns MxVHA-c gene can be alleviated Cdcl ₂toxic action.

The acquisition of embodiment 3, transgenic plant and evaluation

One, the structure of recombinant expression vector

1,, with restriction enzyme EcoRI and XbaI enzyme cutting transient expression carrier pEZS-MxVHA-c, reclaim enzyme and cut product (about 1218bp).

2, according to the sequences Design two ends of 35S promoter respectively with primers F 3 and the R3 of EcoRI and KpnI.It is template that the enzyme of take is cut transient expression carrier pEZS-MxVHA-c, with the primer pair that F3 and R3 form, carries out pcr amplification, reclaims about 1000bp pcr amplification product.

F3：5’-CCGGAATTCCAATCCCACCAAAACCTGA-3’；

R3：5’-TTCGAGCTCCGTGTCCTCTCCAAATGAAA-3’。

3, with the pcr amplification product of restriction enzyme EcoRI and KpnI double digestion step 2, reclaim enzyme and cut product.

4, with restriction enzyme EcoRI and KpnI double digestion pCAMBIA2300 plasmid (Beijing DingGuo ChangSheng Biology Technology Co., Ltd), reclaim carrier framework (about 8742bp).

5, the carrier framework of the enzyme of step 3 being cut to product and step 4 is connected, and obtains recombinant plasmid.

6, with the recombinant plasmid of restriction enzyme EcoRI and XbaI enzyme cutting step 5, reclaim carrier framework (about 10063bp).

7, the carrier framework of the enzyme of step 1 being cut to product and step 6 is connected, and obtains recombinant expression vector pCAMBIA2300-35sMxVHA-c.

Two, the structure of control plasmid

1, pEASY-T1 sample is cut with restriction enzyme EcoRI and SalI enzyme, and reclaim small segment (about 109bp).

2, with restriction enzyme EcoRI and SalI enzyme, cut pEZS-NL carrier, reclaim carrier framework (about 5680bp).

3, the carrier framework of the small segment of step 1 and step 2 is connected, obtains recombinant plasmid.

4, with the recombinant plasmid of restriction enzyme EcoRI and XbaI enzyme cutting step 3, reclaim small segment (about 829bp).

5, with 2 of step 1.

6, with 3 of step 1.

7, with 4 of step 1.

8, with 5 of step 1.

9, with 6 of step 1.

10, the carrier framework of the small segment of step 4 and step 9 is connected, obtains recombinant expression vector pCAMBIA2300-eGFP.

Three, the acquisition of transgenic plant

1, utilize freeze-thaw method that recombinant expression vector pCAMBIA2300-35sMxVHA-c is imported to agrobacterium tumefaciens GV3101, obtain the Agrobacterium of recombinating.

2, transform the processing of front plant

When wild-type Arabidopis thaliana (col-0) plant grows to the high 3cm of stem, remove its terminal inflorescence (to stimulate the growth of the raw inflorescence of leaf), after 5-7d, (now the raw inflorescence of leaf grows, and the flower of its underpart is polliniferous appearance) transforms.Transform to water the day before yesterday permeable, the flower of cutting angle fruit and having opened.

3, restructuring Agrobacterium is inoculated in 5ml YEB liquid nutrient medium (containing 50 μ g/ml kantlex and 10 μ g/ml Rifampins), cultivate 24-36h for 28 ℃, with the volume ratio of 1: 50, be transferred in 200mlYEB substratum, be cultured to OD600 value for 1.2-1.6, the centrifugal 10min of 4500rpm collects thalline, with permeating in right amount substratum (sucrose+0.02% SilwetL-77 of 1/2MS+5%) suspension thalline to OD ₆₀₀value, for 0.6-0.8, is bacteria suspension.

4, the acquisition of transgenic arabidopsis and screening

The bacteria suspension of step 3 is poured in small beaker, the flower of the Arabidopis thaliana of step 2 is immersed to 3-5min in suspension, guarantee that the above part of lotus throne leaf is dipped in (immersion 5min in suspension, on visible plant, there is thin film), soaked Arabidopis thaliana plant is taken out, and lucifuge traverse 16-24h, is just then being put, pinion loose bud and cultivate, obtaining T0 for Arabidopis thaliana plant.T0 is extremely solid for Arabidopis thaliana plant cultivating, and results mature seed is T1 for Arabidopis thaliana seed.By T1 for Arabidopis thaliana planting seed in 1/2MS substratum (receiving mycin containing 50 μ g/ml cards), 4 ℃ of vernalization 2-3 days, 22 ℃ of cultivations, obtain 25 strain T1 for Arabidopis thaliana plant.

Extract T1 for Arabidopis thaliana plant, extract genomic dna, take genomic dna as template, with the primer pair that F1 and R1 form, carry out pcr amplification, the electrophorogram of part pcr amplification product is shown in Figure 10.Wherein, M is the DNA molecular amount standard of 2000bp Plus, S1-S7 is that T1 is for turning MxVHA-c PCR result, WT is the PCR result of wild-type Arabidopis thaliana, bright band is cut to glue to be reclaimed, be connected on pEASY-T1 carrier and check order, result shows that S1-S7 turns MxVHA-c Arabidopis thaliana positive plant at T1 generation, and MxVHA-c gene successfully proceeds in Arabidopis thaliana.Adopting uses the same method identifies the positive T1 of common acquisition 20 strains for turning MxVHA-c Arabidopis thaliana.

T1, for transgenic arabidopsis individual plant sowing, is obtained to T2 Arabidopis thaliana seed, by T2, for Arabidopis thaliana cultivating seeds, be plant and carry out identical PCR and order-checking is identified, through chi square test, meet the separation ratio of 3: 1.

According to T1, for the sequencing result of plant and the sequencing result of 2nd generation plant, obtain 10 transgenic arabidopsis strains of isozygotying (called after 1s is to 10s successively).

The T2 of the transgenic arabidopsis strain of isozygotying, for plant individual plant sowing, is obtained to T3 for transgenic arabidopsis seed.

5, recombinant expression vector pCAMBIA2300-eGFP is replaced recombinant expression vector pCAMBIA2300-35sMxVHA-c carry out the operation of step 1 to 4, obtain T0 generation and turn empty carrier Arabidopis thaliana, T1 generation and turn that empty carrier Arabidopis thaliana, T2 generation turns empty carrier Arabidopis thaliana and T3 generation turns empty carrier Arabidopis thaliana.

Four, T3 observes at the upper growing state of low iron substratum (4uM Fe-EDTA) for transgenic arabidopsis

Choose at random 2 Transgenic wheat lines (homozygous lines S1 and homozygous lines S2), the T3 of 2 Transgenic wheat lines (each strain 10 strain) identified for the seed of seed and wild-type Arabidopis thaliana as follows for seed, the T3 that turns empty carrier Arabidopis thaliana (10 strain):

Seed is grown on 1/2MS substratum one week (seed is sprouted).Then plant is handled as follows: transgenic arabidopsis, turn unloaded Arabidopis thaliana and wild-type Arabidopis thaliana and be transplanted to respectively low iron substratum (the 1/2MS substratum that contains 4 μ M Fe-EDTA) and cultivate.

Process after 7 days, observe the growing state of seedling, see Figure 11.Under iron deficiency environment, the growing state of transgenic arabidopsis is better than turning empty carrier Arabidopis thaliana and wild-type Arabidopis thaliana, and the phenotype that turns unloaded Arabidopis thaliana and wild-type Arabidopis thaliana is basically identical.Transgenic arabidopsis plant can grow normally, and blade is light green, and etiolation has obviously appearred in the blade that turns empty carrier Arabidopis thaliana and wild-type Arabidopis thaliana.Result shows, MxVHA-c gene can better improve the resistance to Fe Deficiency ability of plant.

Claims (9)

1. an albumen, is the protein that the aminoacid sequence shown in sequence 1 forms in sequence table.

2. the encoding gene of albumen described in claim 1.

3. encoding gene according to claim 2, is characterized in that: the encoding gene of described albumen is following 1) or 2) described gene:

1) sequence 2 DNA molecular shown in the 1st-498 Nucleotide from 5 ' end in sequence table;

2) DNA molecular shown in sequence 2 in sequence table.

4. the expression cassette, recombinant expression vector, transgenic cell line or the recombinant bacterium that contain encoding gene described in claim 2 or 3.

5. recombinant expression vector according to claim 4, is characterized in that: described recombinant expression vector is between the multiple clone site of pYES2.0 carrier, to insert the recombinant expression vector that the encoding gene described in claim 2 or 3 obtains.

6. obtaining a method for recombination microzyme, is following 1) or 2) shown in:

1) encoding gene described in claim 2 or 3 is imported and set out in yeast, obtain V-type H ⁺the recombination microzyme that-ATPase enzymic activity increases;

2) encoding gene described in claim 2 or 3 is imported and set out in yeast, obtain resistance to Cd ²⁺the recombination microzyme that murder by poisoning ability strengthens and/or resistance to iron deficiency ability strengthens.

7. method according to claim 6, is characterized in that: the encoding gene described in claim 2 or 3 is to be imported and set out in yeast by Yeast expression carrier; Described Yeast expression carrier is the recombinant expression vector described in claim 4 or 5; The described yeast that sets out is yeast strain BJ2168(Saccharomyces cerevisiae).

8. the application of encoding gene in cultivating resistance to iron deficiency plant described in albumen or claim 2 or 3 described in claim 1; Described plant is Arabidopis thaliana.

9. cultivate a method for resistance to iron deficiency plant, comprise the steps: the encoding gene of albumen described in claim 1 to import and set out in plant, obtain the transgenic plant that tolerant to iron deficiency can strengthen; The described plant that sets out is Arabidopis thaliana.

Images