CN103266130A - Application of soybean aquaporin gene GmPIP1;2 - Google Patents
Application of soybean aquaporin gene GmPIP1;2 Download PDFInfo
- Publication number
- CN103266130A CN103266130A CN2013100750997A CN201310075099A CN103266130A CN 103266130 A CN103266130 A CN 103266130A CN 2013100750997 A CN2013100750997 A CN 2013100750997A CN 201310075099 A CN201310075099 A CN 201310075099A CN 103266130 A CN103266130 A CN 103266130A
- Authority
- CN
- China
- Prior art keywords
- soybean
- gene
- pip1
- aquaporin
- transgenic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention belongs to the field of plant gene engineering. Specifically, the present invention relates to a PCR cloning soybean PIP (Plasma Intrinsic Protein) gene and an overexpression and interference material by transgenic technology; and also relates to application of the gene to regulate the tolerance of soybean to abiotic adversity stresses thus increasing soybean growth in adversity conditions and improving crop yields. The present invention discloses application of soybean aquaporin gene GmPIP1;2, which is used for constructing transgenic soybean with abiotic stress tolerance. The soybean aquaporin gene PIP1;2 has a nucleoside acid sequence shown as EQ ID NO: 1. The present invention specifically includes transforming soybean cotyledonary node by the nucleotide sequence shown as EQ ID NO: 1, and culturing the transformed soybean cells into transgenic plants.
Description
Technical field
The invention belongs to plant genetic engineering field.Specifically, the present invention relates to a kind ofly by PCR clone soybean PIP (Plasma Intrinsic Protein) gene, and obtain overexpression, interfere material by transgenic technology; Thereby also relate to and utilize this gene regulating soybean to be subjected to the abiotic stress stress tolerance to strengthen the soybean raising crop yield that under adverse environmental factor, grows.
Background technology
The moisture that root system absorbs in soilplant atmosphere continuum system can be carried to over-ground part continuously by flow of water difference.Water has three approach in roots of plants xylem quick travel: the apoplast approach, and synplasm approach and transcellular pathway, wherein synplasm is difficult to separate with transcellular pathway experimentally, therefore is collectively referred to as cell to cellular pathways.Plant is by the different main flowpathss of moisture in these two kinds of approach that change of relative liquid conductivity and osmotic pressure gradient.The apoplast approach can comprise that Casparian strip and corky change change by the structure of plant materials root.And cell can largely be that activity by aquaporin on the cytolemma (AQPs) determines that these changes are quick and reversible to the moisture conduction velocity of cellular pathways.Aquaporin accelerates the speed of iuntercellular water migration by the resistance that reduces the moisture transmembrane movement, and the embedding of aquaporin makes microbial film improve greatly the penetrating ability of water.Aquaporin is integrated protein (MIP) family member main on the cytolemma.They are height hydrophobins, comprise that six molecular weight are at the membrane spaning domain of 26-34kD.These albumen are divided into four main subfamilies: plasma membrane integrated protein (PIPs), tonoplast intrinsic protein (TIPs), the similar integrated protein of NOD26 (NIPs), little alkaline integrated protein (SIPs) and subfamilies such as the GIP, the HIP that newly report in the recent period and XIP.
The water globe shortage of resources worsens at present, and each continent tract is all experiencing ecosystem havoc, particularly soil quality decline and environmental quality etc.Improve effective farming in limited land resources and become important agenda.The soybean conduct is one of most important oil crops in the world, and the global demand amount constantly increases, and strengthen soybeans they grow, and it is very important improving soybean yields.Plant is being subjected under the adverse environmental factor of abiotic stress, can activate aquaporin expression and active.The aquaporin of expressing heterologous in Arabidopis thaliana or tobacco, can strengthen vigor or patience (the Aharon et al. 2003 to coercing of transgenic plant, Gao 2010, Hu et al. 2012, Katsuhara et al. 2003), the soaked channel protein PgTIP1 of overexpression ginseng liquid has promoted growing of transgenic arabidopsis in the Arabidopis thaliana, and increases its seed size (Lin et al. 2007).
Soybean is as the important cash crop in the whole world, and its aquaporin research is still blank at present.Because soybean genome sequencing in 2010 is finished and announced, has found the gene of 21 doubtful soybean aquaporins in the genome of whole announcement altogether, the function of relevant these genes and Its Mechanisms still are blank.
Above-mentioned reference is specific as follows:
1, Aharon R, Shahak Y, Wininger S, Bendov R, Kapulnik Y, and Galili G (2003) Overexpression of a plasma membrane aquaporin in transgenic tobacco improves plant vigor under favorable growth conditions but not under drought or salt stress. Plant Cell. 15: 439-447(Aharon R, Shahak Y, Wininger S, Bendov R, Kapulnik Y, and Galili G (2003) plasma membrane aquaporin of overexpression in transgene tobacco has increased the vigor of plant under the suitable growth condition, but does not increase its drought resisting or salt resistance.Plant?Cell.?15?:439-447）；
2, Gao Z, He X, Zhao B, Zhou C, Liang Y, Ge R, Shen Y, and Huang Z (2010). Overexpressing a putative aquaporin gene from wheat, TaNIP, enhances salt tolerance in transgenic Arabidopsis. Plant Cell Physiol 51,767-775(Gao Z, He X, Zhao B, Zhou C, Liang Y, Ge R, Shen Y, and Huang Z (2010). express the doubtful aquaporin gene of wheat TaNIP in the Arabidopis thaliana, increased the salt resistance of transgenic arabidopsis.Plant?Cell?Physiol?51,?767-775.）；
3, Hu W, Yuan Q, Wang Y, Cai R, Deng X, Wang J, Zhou S, Chen M, Chen L, Huang C, Ma Z, Yang G, and He G (2012). Overexpression of a Wheat Aquaporin Gene, TaAQP8, Enhances Salt Stress Tolerance in Transgenic Tobacco. Plant Cell Physiol 53,2127-2141(Hu W, Yuan Q, Wang Y, Cai R, Deng X, Wang J, Zhou S, Chen M, Chen L, Huang C, Ma Z, Yang G, express wheat aquaporin gene TaAQP8 in and He G (2012) tobacco, increased the salt resistance of transgene tobacco.Plant?Cell?Physiol?53,?2127-2141）；
4, Katsuhara M, Koshio K, Shibasaka M, Hayashi Y, Hayakawa T, and Kasamo K. (2003) Over-expression of a barley aquaporin increased the shoot root ratio and raised salt sensitivity in transgenic rice plants. Plant Cell Physiol 44:1378-1383(Katsuhara M, Koshio K, Shibasaka M, Hayashi Y, Hayakawa T, and Kasamo K. (2003) overexpression barley aquaporin gene has increased salt resistance and the stem root ratio of transgenic paddy rice.Plant?Cell?Physiol?44?:?1378-1383.）；
5, Lin WL, Peng YH, Li GW, Arora R, Tang ZC, Su WA, and Cai W. (2007) Isolation and functional characterization of PgTIP1, a hormone-autotrophic cells-specific tonoplast aquaporin in ginseng. J Exp Bot 58: 947-956(Lin WL, Peng YH, Li GW, Arora R, Tang ZC, Su WA, clone and the functional analysis of hormone autotrophic type cell-specific vacuole aquaporin PgTIP1 in and Cai W. (2007) genseng.J?Exp?Bot?58?:?947-956.）。
Summary of the invention
The technical problem to be solved in the present invention provides and a kind ofly can make soybean have protein and gene thereof that abiotic stress patience and biomass increase, and thus obtained transgenic plant and the method for utilizing described gene pairs soybean to transform.
In order to solve the problems of the technologies described above, the invention provides a kind of soybean water channel protein gene PIP1; 2 purposes: be used for making up genetically engineered soybean, genetically engineered soybean has abiotic stress patience;
Described soybean water channel protein gene PIP1; 2 have the nucleotide sequence shown in the EQ ID NO:1.
As soybean water channel protein gene PIP1 of the present invention; The improvement of 2 purposes: genetically engineered soybean has salt tolerance (salt resistance).
As soybean water channel protein gene PIP1 of the present invention; The improvement of 2 purposes: genetically engineered soybean has the characteristic that biomass is increased.
As soybean water channel protein gene PIP1 of the present invention; The improvement of 2 purposes: with the gene transformation soybean cotyledon node with the nucleotide sequence shown in the SEQ ID NO:1, the soya cells after will transforming is again cultivated into transfer-gen plant.
The new gene PIP1 that from soybean wild-type kind WILLIAMS-DARLING Ton 82, clones provided by the present invention; Plasma membrane integrated protein gene PIP1 in the 2---soybean aquaporin family; 2, have the DNA sequence (nucleotide sequence) shown in SEQ ID NO:1.This PIP1; The sequence number of 2 genes is Gm08g01860.
Gene PIP1; A kind of soybean aquaporin matter that is positioned cytoplasmic membrane of 2 codings, it has the aminoacid sequence shown in the SEQ ID NO:2, and it belongs to the MIP gene family.
Further specifically:
Another object of the present invention provides a kind of method of carrying out soybean conversion efficiently with the PIP gene, specifically, the invention provides gene with the sequence shown in Seq ID No.1 and Fig. 5 or the carrier of Gene Partial fragment, wherein, the PIP1 shown in Fig. 1; 2-oe, this carrier can express above-mentioned nucleotide sequence coded polypeptide.
The present invention also provides a kind of plant expression vector that utilizes to transform the method that plant influences soybean aquaporin PIP content ability.
Realize that concrete technological step of the present invention is as follows:
One, clone soybean PIPs gene
By round pcr, clone soybean PIP1; 2 genes, it is gene constructed to soybean conversion expression vectors with two kinds to cut connection equimolecular biology techniques by enzyme.See Fig. 1.
Two, soybean transgene
Obtain PIP1 by the fast preparation method of utilizing agriculture bacillus mediated soybean transgene acceptor; The transfer-gen plant of 2 gene overexpressions.
Three, regulate the expression of PIP gene in soybean:
By transgenic technology to PIP1; The expression of 2 genes in soybean obtained the genetically engineered soybean of overexpression and interference, and smears (Fig. 2), sxemiquantitative RT-PCR(Fig. 3 by careless fourth phosphine) etc. method detect transfer-gen plant.
Four, PIP gene function preliminary evaluation
Cultivate transgenosis overexpression material and wild-type soybean in the soybean nutritional liquid, grow to 10 the biggest seedlings and carry out salt stress processing 7 days with 100mM Nacl, observe phenotype, wild-type is compared the overexpression material and is subjected to obvious salt stress, aerial growth is suppressed, blade yellow (Fig. 4).
China exists cultivated area to reduce the crisis of moisture and non-renewable chemical fertilizer shortage of resources at present.Press for and cultivate that patience is strong, the high-yield and high-efficiency soybean varieties, aquaporin is the basis that determines soybean yields and water and nutrient assimilated efficiency, and the development of genetic engineering technique makes to use and regulates the PIP gene and adjust soybean and adapt to different adverse environmental factors and become possibility.The present invention obtains soybean water channel protein gene PIP by clone technology, and obtains overexpression and interfered material and preliminary evaluation the function of this gene by transgenosis.Thereby the present invention can make soybean have good stress tolerance, thereby promotes soybean growth, finally can improve soybean yields.
The present invention is clear and definite soybean aquaporin GmPIP1; 2 at anti-salt and improvement the function aspect the output.Achievement of the present invention can apply to regulate by biotechnology the expression of soybean water channel protein gene, thereby cultivates in the new soybean varieties that is significantly increased aspect output or the anti-environment-stress.The present invention has a good application prospect.
Description of drawings
Below in conjunction with accompanying drawing the specific embodiment of the present invention is described in further detail.
Fig. 1 is that soybean transforms expression vector PIP1; 2-oe carrier collection of illustrative plates;
Carrier uses the bar gene as transgenosis selection markers, PIP1; The 2-oe carrier meets total length GmPIP1 after with 35S promoter; 2 cDNA are used for can obtaining overexpression GmPIP1 after the transgenosis; 2 transfer-gen plant.
Fig. 2 is the careless fourth phosphine blade streak method detected result of genetically engineered soybean; Half sheet leaf of density bullet represents not to be coated with weedicide; The blade of master pulse the other side scribbles 135mg/L Basta weedicide.Left side figure is the non-transgenic soybean; Right figure is genetically engineered soybean.
Fig. 3 is that soybean transgene plant sxemiquantitative RT-PCR identifies PIP1; 2 gene expression results; Last figure is PIP1 among the figure; The PCR product of 2 genes, figure below are the soybean housekeeping gene--the PCR product (as confidential reference items) of Actin muscle encoding gene Actin.WT is the non-transgenic soybean, and 1-11 is PIP1; 11 independent transgenic lines of 2 gene overexpressions.
Fig. 4 is PIP1; The salt tolerant qualification result of 2 overexpression soybean; The soybean seedling after 10 days of germinateing changes in the nutrient solution of the NaCl that contains 100mM growth 7 days over to and handles as salt; Non-transgenic soybean (contrast) and the PIP1 of contrast for producing in the normal nutrient solution among the left figure; 2 gene overexpression genetically engineered soybean plant (PIP1; 2-Oe); Right figure is that salt is handled non-transgenic soybean (contrast) and PIP1 after 7 days; 2 gene overexpression genetically engineered soybean plant (PIP1; Plant height 2-Oe) and over-ground part biomass.
Fig. 5 is PIP1; The DNA sequence of 2 genes;
Fig. 6 is PIP1; The aminoacid sequence of 2 genes encodings.
Embodiment
(1) extraction of total RNA: get 50 ~ 100 milligrams in the blade of leaf period WILLIAMS-DARLING Ton 82 soybean seedlings, utilize Trizol method extracted total RNA.Concrete grammar is soybean leaves sample grind into powder in liquid nitrogen, add 1 milliliter of Trizol(Takala company then), sample after the grinding is placed under the room temperature and thaws, after treating sample complete " getting damp ", change in 1.5 milliliters of no RNA enzyme centrifuge tubes that contain 200 microlitre chloroformic solutions, acutely shake up, make it to be dissolved in fully in the lysate; Room temperature vibration is placed after 5 minutes at 4 ℃, under the 12000 g conditions centrifugal 10 minutes.Draw the colourless water in upper strata, add the equal-volume Virahol, slowly put upside down mixing, room temperature was placed after 10 minutes under the 12000 g conditions centrifugal 10 minutes.The RNA precipitation adds 1 milliliter of 75% ethanol, and it is centrifugal, dry to clean the back up hill and dale, adds 30 microlitre DEPC water dissolution precipitation.
(2) preparation of cDNA: adopt synthetic cDNA first chain of reverse transcription test kit.Get 1.5 milliliters of no RNA enzyme centrifuge tubes, add the RNA of 4 micrograms, the Oligo-dT(Promega company of 2 microlitres, 10 mcg/ml) and the DEPC water of certain volume, to final volume be 15 microlitres.The mixing reaction solution, 70 ℃ of water-bath sex change 5 minutes, cooled on ice 10 minutes immediately then; Add 8 microlitre First Strand buffer(Promega companies), 3 microlitres, 10 mM dNTP, 0.5 microlitre RNA enzyme inhibitors (every microlitre 40 units), and 1 microlitre M-MLV reversed transcriptive enzyme, the reaction final volume be 40 microlitres, 42 ℃ the reaction 1 hour after 75 ℃, 10 minutes termination reactions.
(3) reverse transcription PCR amplification GmPIP1; 2 full-length cDNA genes: amplification GmPIP1; The used PCR primer sequence of 2 cDNA is: upstream primer: GGACTTTGAACTACACTACA; Downstream primer: CTTTCTATTGAAGCCGCCTT.The PCR reaction system is: the cDNA2 microlitre, and dNTP 0.8 microlitre of 2.5mM, 10xPCR buffer 2 microlitres, each 0.2 microlitre of 10 μ M upstream primers and downstream primer, Taq enzyme 0.3 microlitre, water 14.5 microlitres, cumulative volume are 20 microlitres.The PCR response procedures is: 94 ℃, and 5min; 94 ℃, 30s; 56 ℃, 1min; 72 ℃, 30s; After 32 circulations 72 ℃, 10min.After PCR reaction finishes, make 1% sepharose, with PCR product point sample electrophoresis 20 minutes, reclaim test kit with gel and reclaim the DNA product, order-checking confirms that this cDNA sequence and EQ ID NO:1 are in full accord.
This carrier is used for GmPIP1; The overexpression of 2 genes in soybean.GmPIP1; 2 full-length cDNAs are connected to restriction endonuclease sites SmalI and can be used among the agriculture bacillus mediated genetically modified binary vector pBAR.The pBAR carrier has a selectable marker gene bar in the T-DNA zone, this genes encoding grass fourth phosphinothricin acetyl CoA transferring enzyme (PAT), but the free amino group acetylize of catalysis grass fourth phosphine, thus make weedicide grass fourth phosphine inactivation.GmPIP1; 2 are driven by 35S promoter.Final carrier PIP1; 2-Oe figure sees Fig. 1.
The original acceptor material of soybean transgene is WILLIAMS-DARLING Ton 82.Transgenic method is as follows:
(1). seed disinfection: the sterilization of chlorine dry method is adopted in the surface sterilization of soybean seeds, at first, selects mature and plump, no scab, no strong clean seed, and monolayer alignment is in the culture dish of 90*15mm; Culture dish uncapped put into moisture eliminator, place the glass beaker of a 500ml in the moisture eliminator, measure with the 100ml graduated cylinder in the commercial Javelle water adding beaker of 75ml, the 10ml graduated cylinder is measured 3ml 12N HCl, slowly adds along wall of cup; Cover the lid of moisture eliminator, guarantee the vessel sealing, standing over night, 10 ~ 16 hours; After sterilization is finished, culture dish added a cover transfer on the aseptic super clean bench, open the lid of culture dish, high wind blows removed residual chlorine in 25 ~ 40 minutes.At room temperature approximately can preserve for 2 weeks after the dry seed sealing of surface sterilization.
(2). Agrobacterium is prepared and infects: extract binary vector PIP1; The 2-Oe plasmid DNA, the method by electricity transforms changes binary vector among the agrobacterium strains EHA101 over to, and storage is formed in 50% glycerine.Preceding 2 days of transgenosis is drawn the Agrobacterium glycerol stock that contains carrier of 50 μ l, to the YEP liquid nutrient medium of 5 ml (5 g/L sodium-chlor, pH 7.0 for 10 g/L peptones, 5 g/L yeast extracts), and 28 ℃, 250rpm, shaking culture 24 ~ 36 hours; Draw the saturated bacterium liquid of 0.2～1ml enlarged culturing to the 250ml YEP liquid nutrient medium that has added microbiotic (1/2000), to OD650nm=0.8 ~ 1.0; Bacterium liquid branch is installed in the aseptic centrifuge tube of several 50ml, and centrifugal (4000rpm, 10min, 25 ℃) collect bacterium colony, are total to substratum (LCCM) with 25 ~ 50ml liquid and blow and beat gently, and resuspended post precipitation is standby.The LCCM nutrient solution contains that 1/10 B5 is a large amount of, trace and VITAMIN (Gamborg et al., 1968), 3% sucrose, organic buffer agent 2 (N-morpholine) ethanol sulfonic acid (MES) 3.9 g/L, pH 5.4,120 ℃ of sterilization 20min add Plant hormones regulators,gibberellins (GA3) 0.25 mg/L, 6-benzyladenine (BAP) 1.67 mg/L, halfcystine (Cys) 400 mg/L, dithiothreitol (DTT) (DTT) 154.2 mg/L, Syringylethanone (As) 200 μ mol/L under gnotobasis.
(3). infect: the sub-Ge of big beans kind of imbibition on aseptic thieving paper, is vertically cut seed along hilum with scalpel, with even two lobes separately of cotyledon and hypocotyl, remove behind kind of the skin standby.The resuspended liquid of Agrobacterium is poured in the clean sterile petri dish, put into about 50 explants, room temperature infected 20 ~ 30 minutes, during often stir bacterium liquid, make explant fully contact fresh bacterium liquid.
(4). cultivate altogether: after infecting end, explant is taken out, blots with aseptic thieving paper and be placed on the common substratum (CM) that is placed with aseptic filter paper, 7～10 explants of every ware, adaxial and its surface up, horizontal positioned.The CM culture medium prescription is identical with LCCM, and other adds the agar (Difco Agar, Noble company) of 5 g/L.Culture dish is stacked, seal the back in the Percival incubator with preservative film, 23 ℃, dark was cultivated 3～5 days altogether.
(5). inducing clumping bud: after cultivating 3～5 days altogether, the hypocotyl that cuts elongation is left and taken about 0.5cm, 30 ~ 45 ° of oblique angles are inserted in the bud that is added with selective agent and induce on (SI) substratum, the SI substratum contains that B5 is a large amount of, trace and VITAMIN, sucrose 30g/L, MES 0.59g/L and agar 8g/L(Sigma, USA), behind 120 ℃ of sterilization 20min, under aseptic condition, add BAP 1.67 mg/L, ticarcillin (Tic) 250 mg/L, cephamycin (Cef) 100 mg/L.Seal and transfer to culturing room (24 with the 3M breathable adhesive tape
oC, 18/6 intensity of illumination, 140 μ moles/m
2/ sec), cultivated for 4 weeks, per two weeks are changed once fresh SI substratum.
(6). the bud of growing thickly elongation: after inducing clumping bud screened for 4 weeks, excise remaining cotyledon, and transfer on bud elongation (SE) substratum, it is a large amount of that the SE substratum contains MS, trace and VITAMIN (Murashige and Skoog, 1962), sucrose 30 g/L, MES0.59 g/L, agar (Sigma, USA) 8 g/L, pH 5.8, behind 120 ℃ of sterilization 20min, under aseptic condition, add GA 30.5 mg/L, altheine (L-Asp) 50 mg/L, glutamine (Glu) 50 mg/L, indolylacetic acid (IAA) 0.1 mg/L, zeatin (ZR) 1 mg/L, Tic250 mg/L and Cef 100 mg/L, culture condition is with the inducing clumping bud process, cultivated for 2 ~ 8 weeks, per 2 weeks are changed once fresh SE substratum.Culture condition is 24
oC, 18/6 intensity of illumination, 140 μ moles/m
2/ sec).
(7). take root: the young shoot that will extend 3-4 centimetre downcuts, insert in the root media (RM) after in indolebutyric acid (IBA), dipping in 30s ~ 1min, the RM substratum contains that MS is a large amount of, trace and VITAMIN, sucrose 20 g/L, MES 0.59 g/L, agar (Sigma, USA) 8 g/L, IBA 0.1 mg/L, L-Asp 50 mg/L, Glu 50 mg/L, Tic 250 mg/L, Cef 100 mg/L, when treating after 1 ~ 2 week that root is about 2-3 centimetre, the seedling of will taking root takes out from substratum, clean the residual substratum of root, change over to and move to hot-house culture in the soil.Culture condition is 24
oC, 18/6 intensity of illumination, 140 μ moles/m
2/ sec.
(8). the Herbicid resistant of soybean transgene material is identified: because transgenosis coding careless fourth phosphinothricin acetyl CoA transferring enzyme (PAT) in the carrier, but the free amino group acetylize of catalysis grass fourth phosphine, thus make weedicide grass fourth phosphine inactivation.Identify and use weedicide Liberty that have another name called Basta, original liquid concentration is 135 g/L.In the experiment, with 1000 times of stoste dilutions, picking the Basta of a little 135 mg/L with cotton swab, be coated on the half sheet soybean leaves, is the boundary with the master pulse, doing the contrast that mark represents not to be coated with weedicide with marking pen on second half blade, observes blade after 3-5 days.There is significantly withered phenomenon to represent this sample negative (Fig. 2 right side) if scribble a half vane of weedicide than contrast; If blade normally then represent this sample positive (Fig. 2 left side).
Extract PIP1 with Trizol method (as described in embodiment 1); The total RNA of the genetically engineered soybean of 2-Oe and non-transgenic soybean (WILLIAMS-DARLING Ton 82) blade behind reverse transcription, carries out detection of expression with sxemiquantitative RT-PCR.Soybean housekeeping gene--Actin muscle encoding gene Actin is as confidential reference items.Show according to Fig. 3, can draw to draw a conclusion: at 11 PIP1; In the 2-Oe overexpression transgenic line, PIP1; 2 expression of gene significantly improve (Fig. 3) than the non-transgenic contrast.Therefore, genetically engineered soybean has obtained the transgenosis effect of expection.
The culture condition of embodiment 5, soybean material and resistance are identified
Seed after the genetically engineered soybean plant results that obtain (T1 generation), after the dry chlorine sterilization, be seeded in the sterilization muck soils, sprout under 30 ℃ of illumination conditions and cultivate, with 5 days careful from soil, the taking out of seedling of growth, clean soil on the root, be transplanted to be transferred to then in the soybean nutritional liquid on the sponge ball of PVC plate and cultivate.
The soybean culture condition is as follows: the controlled soybean of light temperature culturing room.Temperature control: 30 ℃ of daytimes, 20 ℃ of nights.12 hours photophases, intensity of illumination: 250-300 μ moles/m
2/ sec).Soybean umol.m-2.s-1, soy broth PH5pH5.8-6.0, regulate once every day, and soy broth was changed once in per 3 days.
The prescription of soy broth mother liquor (being storing solution) is as follows:
The remarks explanation: every kind of equal water of storing solution is prepared.
During use, add each 1ml of storing solution in every 1L nutrient solution No. 1-No. 4, No. 5 storing solution 5 ml, water carries out constant volume.
For the anti-salt property that the genetically engineered soybean that fully proves gained of the present invention has, experiment is identified the saline-alkaline tolerance of genetically engineered soybean.Experiment is carried out in the water planting condition, 10 the biggest wild-type soybean Williams82 and PIP1; The transgenosis seedling of 2 overexpressions uses the NaCl of 100mM to handle 7 days, does not add the processing of NaCl in contrast.As seen from Figure 4, genetically engineered soybean is compared with non-transgenic contrast soybean under the salt stress, and partial-length and fresh weight all obviously increase on the ground, and salt tolerance obviously improves.
Salt is measured sodium, potassium content in soybean plant strain blade, stem and the root respectively after handling, and Fig. 5 after the salt processing, compares the non-transgenic soybean, PIP1 as can be seen; The sodium ion difference is little in the 2 overexpression genetically engineered soybean roots, and potassium ion increases; But can see that sodium ions content significantly reduces in the genetically engineered soybean blade, the potassium ion indifference; The sodium potassium concentration differs all little in the stem.PIP1; The minimizing of 2 overexpression genetically engineered soybean blade sodium ions is PIP1; The mechanism of 2 gene salt tolerants.
At last, it is also to be noted that what more than enumerate only is several specific embodiments of the present invention.Obviously, the invention is not restricted to above embodiment, many distortion can also be arranged.All distortion that those of ordinary skill in the art can directly derive or associate from content disclosed by the invention all should be thought protection scope of the present invention.
Claims (4)
1. soybean water channel protein gene PIP1; 2 purposes is characterized in that: be used for making up genetically engineered soybean, described genetically engineered soybean has abiotic stress patience;
Described soybean water channel protein gene PIP1; 2 have the nucleotide sequence shown in the EQ ID NO:1.
2. soybean water channel protein gene PIP1 according to claim 1; 2 purposes is characterized in that: described genetically engineered soybean has salt tolerance.
3. soybean water channel protein gene PIP1 according to claim 1; 2 purposes is characterized in that: described genetically engineered soybean has the characteristic that biomass is increased.
4. according to claim 1,2 or 3 described soybean water channel protein gene PIP1; 2 purposes is characterized in that: with the gene transformation soybean cotyledon node with the nucleotide sequence shown in the SEQ ID NO:1, the soya cells after will transforming is again cultivated into transfer-gen plant.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310075099.7A CN103266130B (en) | 2013-03-10 | 2013-03-10 | Soybean water channel protein gene GmPIP1; The application of 2 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310075099.7A CN103266130B (en) | 2013-03-10 | 2013-03-10 | Soybean water channel protein gene GmPIP1; The application of 2 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103266130A true CN103266130A (en) | 2013-08-28 |
| CN103266130B CN103266130B (en) | 2015-12-23 |
Family
ID=49009792
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310075099.7A Expired - Fee Related CN103266130B (en) | 2013-03-10 | 2013-03-10 | Soybean water channel protein gene GmPIP1; The application of 2 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103266130B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103804479A (en) * | 2014-01-24 | 2014-05-21 | 中国热带农业科学院热带生物技术研究所 | Samphire aquaporins SpAQP1 and application of coding gene thereof in improving salt tolerance of plants |
| CN106191076A (en) * | 2016-07-26 | 2016-12-07 | 江苏省农业科学院 | Plant PIP1；10 genes and application thereof |
| CN112321690A (en) * | 2020-10-30 | 2021-02-05 | 浙江大学 | Wild soybean aquaporin GsPIP1-4 and coding gene and application thereof |
| CN114517202A (en) * | 2022-04-08 | 2022-05-20 | 山东农业大学 | Application of aquaporin gene SlPIP1 and 2 in improving resistance of tomatoes to facility continuous cropping soil |
-
2013
- 2013-03-10 CN CN201310075099.7A patent/CN103266130B/en not_active Expired - Fee Related
Non-Patent Citations (3)
| Title |
|---|
| DENG-DI LI ET AL.: "Expression of three cotton genes encoding the PIP proteins are regulated in root development and in response to stresses", 《BIOTIC AND ABIOTIC STRESS》, no. 28, 28 October 2008 (2008-10-28) * |
| FRANZISKA KRAJINSKI ET AL.: "Arbuscular mycorrhiza development regulates the mRNA abundance of Mtaqp1 encoding a mercury-insensitive aquaporin of medicago truncatula", 《PLANTA》, no. 211, 31 December 2000 (2000-12-31), pages 85 - 90 * |
| GENE BANK: "Accession ：XP003532817", 《GENE BANK》, 8 November 2011 (2011-11-08) * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103804479A (en) * | 2014-01-24 | 2014-05-21 | 中国热带农业科学院热带生物技术研究所 | Samphire aquaporins SpAQP1 and application of coding gene thereof in improving salt tolerance of plants |
| CN103804479B (en) * | 2014-01-24 | 2016-05-04 | 中国热带农业科学院热带生物技术研究所 | Sea purslane aquaporin SpAQP1 and encoding gene thereof are in the application improving in plant salt tolerance |
| CN106191076A (en) * | 2016-07-26 | 2016-12-07 | 江苏省农业科学院 | Plant PIP1；10 genes and application thereof |
| CN112321690A (en) * | 2020-10-30 | 2021-02-05 | 浙江大学 | Wild soybean aquaporin GsPIP1-4 and coding gene and application thereof |
| CN114517202A (en) * | 2022-04-08 | 2022-05-20 | 山东农业大学 | Application of aquaporin gene SlPIP1 and 2 in improving resistance of tomatoes to facility continuous cropping soil |
| CN114517202B (en) * | 2022-04-08 | 2024-04-19 | 山东农业大学 | Application of aquaporin gene SlPIP, 2 in improving resistance of tomatoes to facility continuous cropping soil |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103266130B (en) | 2015-12-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101736014B (en) | Gene engineering application of rice auxin transport protein gene OsPIN2 | |
| CN103966258A (en) | Agrobacterium tumefaciens mediated cabbage type oilseed rape genetic transformation method | |
| CN102599052A (en) | Plant in-situ regeneration method and application thereof in genetic transformation | |
| CN102154321B (en) | Method for breeding stress-resistance transgenic rice | |
| CN103266130A (en) | Application of soybean aquaporin gene GmPIP1;2 | |
| CN101186926A (en) | Modified method for transforming gramineous crop by agrobacterium mediation flower-dipping method | |
| CN101698854A (en) | Application of transcription thellungiella halophila CBF1 gene in improving drought resistance and salt tolerance of corn and wheat | |
| CN104087611B (en) | A kind of agriculture bacillus mediated Jatropha curcas genetic transforming method | |
| CN103014035A (en) | Tumorous stem mustard stress-resistant gene, plant expression vector, construction method and application thereof | |
| CN105907733B (en) | A kind of Sophora alopecuroide inositol transmethylase and its encoding gene and application | |
| CN104593380A (en) | Gene ZmHKT1;1a coding corn HKT transportprotein for improving plant salt-tolerance as well as application of gene | |
| CN104328127A (en) | Tumorous stem mustard stress resistance gene BjEFh1 as well as plant expression vector and application thereof | |
| CN102010864B (en) | Maize pollen tissue specific promoter and expression vector thereof | |
| CN106892973A (en) | Plant adversity resistance related protein GhMYB4 and encoding gene and application | |
| CN106749580A (en) | Plant salt tolerance GAP-associated protein GAP TaPUB15 D and its encoding gene and application | |
| CN103602644A (en) | Vacuole proton pyrophosphatase as well as encoding gene and application thereof | |
| Frame et al. | Maize (Zea mays L.) | |
| CN114703198B (en) | Cloning and application of tomato transporter SlZIF1 | |
| CN102337295A (en) | Agrobacterium-mediated melon seedling apex transformation method | |
| CN103602688A (en) | Helianthus tuberosus L. Na<+>/H<+> reverse transport protein genes HtNHX1 and HtNHX2 and use thereof | |
| CN104513825B (en) | Wheat salt-tolerant gene TaNAS1 and application thereof | |
| CN103243108A (en) | Calcium ion binding protein derived from stem nodule as well as encoding gene and application thereof | |
| CN106520723A (en) | Protein VvMas and encoding gene, and application thereof in improvement of salt tolerance of plants | |
| CN105906695A (en) | Sophora alopecuroides aquaporin and encoding gene and application thereof | |
| CN102220373A (en) | Wheat transgene method by slivering seedling leaf bases |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20151223 Termination date: 20200310 |