CN102559630B - Malus xiaojinensis MxHA7 protein and coding gene and application thereof - Google Patents

Abstract

The invention discloses a malus xiaojinensis MxHA7 protein and a coding gene and application thereof. The protein is obtained from malus xiaojinensis, and is following (a) or (b): (a) a protein is composed of amino acid sequence which is showed by sequence 1 in a sequence table; and (b) a protein is derived from (a) and is related to P type H+-ATPase enzymatic activity in a plant through replacement and/or loss and/or addition of one or several amino acid residues of amino acid residue sequence of the sequence 1 in the sequence table. The invention further provides a method for obtaining genetically modified organisms, which includes following 1 and 2, 1 the coding gene of the protein is led in an original organism to obtain a genetically modified organism with increased P type H+-ATPase enzymatic activity; and 2 the coding gene of the protein is led in the original organism to obtain a genetically modified organism with enhanced iron deficiency resistant capability. The malus xiaojinensis MxHA7 protein and the coding gene and the application of the malus xiaojinensis MxHA7 protein have important value for cultivation of reverse-resistant plants.

Description

Malus xiaojinensis MxHA7 albumen and encoding gene thereof and application

Technical field

The present invention relates to a kind of malus xiaojinensis MxHA7 albumen and encoding gene and application.

Background technology

Iron is a kind of important nutritive element, participates in many biochemical reactions.1/3 soil all is alkaline in the world, Fe in this soil ³⁺Content very abundant, but Fe ³⁺Solubility very low.The plant iron deficiency can cause degradation phenomenon under blade yellow, early ageing, the photosynthesis, and severe patient causes Crops production and quality to descend.The agriculture production iron deficiency is a global problem, and there is the report of a large amount of relevant plant iron deficiencies countries in the world.

Plant is difficult to absorb and utilize ferro element from this soil.Plant must be Fe ³⁺Change into Fe ²⁺Could satisfy plant to the needs of ferro element, in order to promote to a greater extent this conversion, plant has formed typical two kinds and has inhaled rail mechanism, and dicotyledons belongs to mechanism I.Fruit tree is important dicotyledons, its nutrition mainly obtains from stock, malus xiaojinensis is the efficient good stock of a kind of iron that screens from 40 kinds of apple kinds and the ecotype, with iron poor efficiency type apple rootstock Malus baccata ratio, obvious acidifying appears in the root of malus xiaojinensis in the iron deficiency situation, and very high cation exchange capacity is arranged, and these phenomenons can adapt to Fe Deficiency, so malus xiaojinensis belongs to mechanism I plant.

In mechanism I, some biochemical reactions can occur and adapt to coercing of iron deficiency in plant, as the tip of a root expand, the root hair increases the variation of root cells structure etc.And in cucumber, studies show that H ⁺Outflow and root hair relative when producing position and the tip of a root and expanding the district.H is found in research in the tomato ⁺Release and the H on the plasma membrane ⁺-ATPase is relevant.Acidifying and H around the root ⁺The increase of-ATPase protein content is relevant.Explanation is in the situation that iron deficiency, H ⁺-ATPase plays very important effect, mainly the iron ion of root absorption is transported to overground part by xylem, but its again the mechanism of action in the iron deficiency situation also do not study clear.Outside the Pass having coerced with iron, H ⁺-ATPase also participates in other physiological and biochemical procedure, such as sugared signal conduction, stomatal movement, salt stress etc.

H ⁺-ATPase is a gene family that contains many subunits, the H that first is cloned into ⁺-ATPase gene is AHA1 and the AHA3 in the Arabidopis thaliana, along with the arabidopsis gene group checks order successfully, has been cloned into altogether 12 H from Arabidopis thaliana ⁺-ATPase gene, but AHA12 may be a pseudogene.Also be cloned into this gene at many species afterwards, such as cucumber, tomato, tobacco, yeast etc.H ⁺-ATPase gene has tissue specificity, and the expression of this gene is arranged in root, leaf, flower and fruit.Studies show that in Arabidopis thaliana, AHA2 and AHA7 gene are maximally related with iron deficiency, and the AHA2 gene is relevant with the root acidifying, and AHA7 is relevant with the generation of root hair.Two genes of in cucumber, cloning, the transcriptional level of CsHA1 gene can increase in the iron deficiency situation, and the CsHA2 gene is not regulated and control by iron deficiency.Transfer-gen plant can significantly improve resistance.

Summary of the invention

The purpose of this invention is to provide a kind of malus xiaojinensis MxHA7 albumen and encoding gene and application.

Protein provided by the invention available from malus xiaojinensis, is following (a) or (b):

(a) protein that is formed by the aminoacid sequence shown in the sequence in the sequence table 1;

(b) with the amino acid residue sequence of sequence in the sequence table 1 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and with plant in P type H ⁺-ATPase enzymic activity relevant by (a) derivative protein.

In order to make the protein in (a) be convenient to purifying, N-terminal or C-terminal that can the protein that the aminoacid sequence shown in the sequence 1 forms in by sequence table connect label as shown in table 1.

The sequence of table 1 label

Label	Residue	Sequence
			Poly-Arg	5-6 (being generally 5)	RRRRR
Poly-His	2-10 (being generally 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

Above-mentioned (b) but in the protein synthetic, also can synthesize first its encoding gene, carry out again biological expression and obtain.The encoding gene of the protein in above-mentioned (b) can be by the codon with one or several amino-acid residue of disappearance in the dna sequence dna shown in the sequence in the sequence table 2, and/or carry out the missense mutation of one or several base pair, and/or obtain at the encoding sequence that its 5 ' end and/or 3 ' end connects the label shown in the table 1.

The gene of encoding said proteins also belongs to protection scope of the present invention.

Described gene can be following 1)-4) in arbitrary described dna molecular:

1) in the sequence table sequence 2 from the dna molecular shown in 5 ' terminal the 1st to 2898 Nucleotide;

2) dna molecular shown in the sequence 2 in the sequence table;

3) under stringent condition with 1) or 2) shown in dna molecule hybridize and the dna molecular of encoding said proteins;

4) with 1) or 2) or 3) gene have homology more than 90% and the dna molecular of encoding said proteins.

Above-mentioned stringent condition can be 0.1 * SSPE (or 0.1 * SSC), in the solution of 0.1%SDS, hybridization and wash film under 65 ℃ of conditions.

The recombinant expression vector, expression cassette, transgenic cell line or the recombinant bacterium that contain described gene all belong to protection scope of the present invention.

Available existing expression vector establishment contains the recombinant expression vector of described gene.Described expression vector comprises the double base agrobacterium vector and can be used for the carrier etc. of micropellet bombardment.Described expression vector also can comprise 3 ' end untranslated zone of foreign gene, namely comprises the dna fragmentation of polyadenylic acid signal and any other participation mRNA processing or genetic expression.The bootable polyadenylic acid of described polyadenylic acid signal joins 3 ' end of mRNA precursor.When using described gene constructed recombinant expression vector, can add any enhancement type promotor or constitutive promoter before its transcription initiation Nucleotide, they can use separately or be combined with other promotor; In addition, when using gene constructed recombinant expression vector of the present invention, also can use enhanser, comprise translational enhancer or transcriptional enhancer, these enhanser zones can be ATG initiator codon or neighboring region initiator codon etc., but must be identical with the reading frame of encoding sequence, to guarantee the correct translation of whole sequence.The source of described translation control signal and initiator codon is widely, can be natural, also can synthesize.Translation initiation region can be from transcription initiation zone or structure gene.For the ease of identifying and screening, can process expression carrier used thereof, can produce enzyme or the gene of luminophor, the antibiotic marker thing with resistance or the anti-chemical reagent marker gene etc. of colour-change as adding coding.Also can not add any selected marker, directly according to phenotypic screen.

Described recombinant expression vector can be following (I) or (II) or (III):

(I) between the multiple clone site of pEZS-NL carrier, insert the recombinant expression vector that described gene obtains;

(II) between the multiple clone site of pYES2.0 plasmid, insert the recombinant expression vector that described gene obtains;

(III) between the multiple clone site of pCAMBIA2300 plasmid, insert the recombinant expression vector that described gene obtains.

Described recombinant expression vector specifically can be described gene is connected the recombinant plasmid A that obtains with carrier pEASY-T1 sample.Described recombinant expression vector specifically can be the recombinant plasmid B that obtains between the KpnI of the insertion of the small segment between KpnI and ApaI restriction enzyme site pEZS-NL carrier among the described recombinant plasmid A and the ApaI restriction enzyme site.Described recombinant expression vector specifically can be the recombinant plasmid C that obtains between the KpnI of the insertion of the small segment between KpnI and XbaI enzyme cutting site pYES2.0 plasmid among the described recombinant plasmid B and the XbaI enzyme cutting site.Described recombinant expression vector specifically can be the recombinant plasmid D that obtains between the KpnI of the insertion of the small segment between KpnI and XbaI enzyme cutting site pCAMBIA2300 plasmid among the described recombinant plasmid B and the XbaI enzyme cutting site.Described recombinant expression vector specifically can be at the EcoRI of described recombinant plasmid D and KpnI restriction enzyme site and inserts the recombinant plasmid E that 35S promoter obtains.

Described recombinant bacterium specifically can be (II) described recombinant expression vector or recombinant plasmid C is imported the recombinant bacterium that obtains in the yeast.Described yeast specifically can be yeast saccharomyces cerevisiae, such as yeast strain BJ2168.

The present invention also protects a kind of method that obtains genetically modified organism, for 1. following or 2.:

1. described gene is imported in the biology that sets out, obtain P type H ⁺The genetically modified organism that-ATPase enzymic activity increases;

2. described gene is imported in the biology that sets out, obtain the genetically modified organism that anti-iron deficiency ability strengthens.

Described biology is yeast, and described gene imports the described biology that sets out by (II) described recombinant expression vector or recombinant plasmid C.Described yeast specifically can be yeast saccharomyces cerevisiae, such as yeast strain BJ2168.

Described iron specifically can be Fe ²⁺

Described biology is plant, and described gene is by (III) described recombinant expression vector or recombinant plasmid D or the described biology that sets out of recombinant plasmid E importing.Described plant is monocotyledons or dicotyledons, and described plant specifically can be Arabidopis thaliana, such as AHA7 mutant Arabidopis thaliana (being called for short SALK-042485).

Malus xiaojinensis MxHA7 albumen provided by the present invention and encoding gene MxHA7 thereof have very important regulating effect for the plant of Fe Deficiency, the used material malus xiaojinensis of the present invention is the plant that is a kind of anti-iron deficiency, it is a kind of typical mechanism I plant, that is: plant must be by activating the H on the plasma membrane ⁺ATPase makes soil acidification, increases the solubility of iron.Then under the effect of ferric iron reductase enzyme ferric iron is reduced into ferrous iron, transhipment is advanced in the tenuigenin under the effect of the ferrous iron translocator on plasma membrane, increases the tolerant to iron deficiency of plant.MxHA7 gene provided by the present invention has very important regulating effect for the plant of Fe Deficiency, and the present invention provides good theoretical foundation for the tolerant to iron deficiency of further studying malus xiaojinensis.The present invention has great value for cultivating plant with adverse resistance.

Description of drawings

Fig. 1 is the MxHA7 gene of pcr amplification and the agarose gel electrophoresis figure that enzyme is cut product thereof.

Fig. 2 is that iron deficiency is induced the fluorescent quantitative PCR result of rear MxHA7 gene in the malus xiaojinensis Different Organs.

Fig. 3 is the Subcellular Localization detected result of MxHA7 gene.

Fig. 4 is the PCR qualification result of transgenic yeast.

Fig. 5 is P type H in the transgenic yeast ⁺The mensuration that-ATPase enzyme is lived.

Fig. 6 is the growing state of transgenic yeast under 40 μ M Ferrozine dispositions.

Fig. 7 is the pcr analysis of transgenic arabidopsis.

Fig. 8 is the fluorescence situation of transgenic arabidopsis under iron deficiency is processed.

Fig. 9 is the growing state of transgenic arabidopsis under iron deficiency is processed.

Embodiment

Following embodiment is convenient to understand better the present invention, but does not limit the present invention.Experimental technique among the following embodiment if no special instructions, is ordinary method.Used test materials among the following embodiment if no special instructions, is and purchases available from routine biochemistry reagent shop.Quantitative test in following examples all arranges repeated experiments three times, results averaged.Ferrozine: give birth to worker's biotechnology company limited available from Shanghai, article No. is: PB1542.

Agrobacterium tumefaciens GV3101: the public can obtain from China Agricultural University; Reference: Zhao Junsheng, Zhi Daying, Xue Zheyong, the summer is photosensitive. Agrobacterium tumefaciens mediated Festuca Arundinacea Study on Genetic Transformation. Acta Genetica Sinica .2005.6Vol 32, No.6:579-585.

Malus xiaojinensis (Malus xiaojinensis Cheng et Jiang): the public can obtain from China Agricultural University; Put down in writing the non-patent literature of this malus xiaojinensis: Cheng Minghao, Li Xiaolin, Zhang Yun is expensive, the good rootstock resource-malus xiaojinensis of apple, Agricultural University Of Southwest's journal, in October, 2000,22 (5): 383-386.

Yeast strain BJ2168 (belonging to yeast saccharomyces cerevisiae): the public can obtain from China Agricultural University, the non-patent literature of putting down in writing this material is: Hong Ding, Lihong Duan, Huilan Wu, et al.Regulation of AhFR01, an Fe (III)-chelate reductase of peanut, during iron deficiency stress andintercropping with maize.Physiologia Plantarum.2009,136:274-283..

Defective type substratum: Ura Minus Media (general Jino, Beijing Science and Technology Ltd.) 8g/L, glucose 20g/L, all the other are distilled water.

Inducing culture: Ura Minus Media (general Jino, Beijing Science and Technology Ltd.) 8g/L, semi-lactosi 20g/L, all the other are distilled water.

The acquisition of embodiment 1, MxHA7 albumen and encoding gene thereof

One, the acquisition of MxHA7 full length gene

Total RNA and the reverse transcription of extracting the malus xiaojinensis blade are cDNA.Take cDNA as template, with the primer pair that F1 and R1 form, use the HiFi mix of high-fidelity to carry out pcr amplification, obtain pcr amplification product.

F1：5’-ATGGTGGTGGCCGAGTCGGTTGCC-3’；

R1：5’-GAGGGTGTAGTTTTGATTGATGG-3’。

Pcr amplification system (20 μ l): ddH ₂O 7.0 μ l, 2 * HiF Mix (0.5U/ μ l) 10 μ l, F1 (10mM) 1.0 μ l, R1 (10mM) 1.0 μ l and template 1.0 μ l.

Pcr amplification program: 94 ℃ of denaturation 3min of elder generation; Then 94 ℃ of sex change 40s, 58 ℃ of annealing 40s, 72 ℃ of extensions 1min, totally 30 circulations; Last 72 ℃ are extended 10min.

Pcr amplification product is carried out 1% agarose gel electrophoresis, see Figure 1A (swimming lane M is the dna molecular amount standard of 15000bp, and swimming lane 1 and swimming lane 2 are pcr amplification product).The result shows, has obtained the approximately dna fragmentation of 2898bp.

Purifying reclaims behind this dna fragmentation according to pEASY-T1 sample-Vector Kit support agent box (available from full Shi Jin biotech firm) specification sheets the PCR product is connected on the carrier pEASY-T1 sample (available from full Shi Jin biotech firm), carries out successively enzyme and cuts evaluation (KpnI and ApaI) and order-checking.Enzyme is cut qualification result and is seen Figure 1B (swimming lane M is the dna molecular amount standard of 15000bp, and swimming lane 1 is cut product for enzyme).Sequencing result shows, pcr amplification product sequence total length is about 2898bp, its nucleotide sequence such as the sequence 2 of sequence table from shown in the Nucleotide of 5 ' terminal 1-2898 position, the protein (being formed by 966 amino-acid residues) shown in the sequence 1 in the code sequence tabulation.

With the protein called after MxHA7 albumen shown in the sequence 1 of sequence table, be the MxHA7 gene with the unnamed gene of coding MxHA7 albumen.

Two, the expression analysis of MxHA7 gene in the malus xiaojinensis Different Organs

The malus xiaojinensis tissue cultured seedling is cultivated in growth medium (MS+0.5mg/L IBA+0.2mg/L 6-BA), after it grows into the stem lignifying, be transferred to root media (1/2MS+1.0mg/L IBA); After tissue cultured seedling bears white root, move to the middle overlay film moisturizing of 1/2 pancebrin (composition sees Table 3, and initial pH value transfers to 6.0 with NaOH) and cultivated for 2 weeks; Change afterwards pancebrin (composition sees Table 2, and initial pH value transfers to 6.0 with NaOH) over to and cultivated one month, change weekly pancebrin one time; Culture condition in the whole process is: 16 hours (photon gamma flux density 250 μ EM of illumination cultivation ^-2S ^-1), temperature is 25 ± 2 ℃; Dark culturing 8 hours, temperature are 17 ± 2 ℃.Carry out afterwards iron deficiency and induce, method is: plant is gone to from pancebrin contain 4 μ M Fe nutritive mediums (composition sees Table 4, and initial pH value transfers to 6.0 with NaOH), deionized water rinsing before shifting.

The prescription of table 2 pancebrin

The prescription of table 3 1/2 pancebrin

Table 4 contains the prescription of 4 μ M Fe nutritive mediums

Get respectively that iron deficiency induces 0, the young root of the malus xiaojinensis of 12h, 24h, 3d and 6d or total RNA of mature leaf, ultraviolet spectrophotometer is measured the content of RNA, the above-mentioned RNA of quality such as gets, reverse transcription becomes strand cDNA.

Take this strand cDNA as template, adjust first the consumption (make pcr amplification product brightness consistent) of template by pcr amplification 18s gene, then analyze the expression of MxHA7 gene and 18s gene (reference gene) by quantitative fluorescent PCR.

The primer of amplification 18s gene is as follows:

18SR-F：5′-ACACGGGGAGGTAGTGACAA-3′；

18SR-R：5′-CCTCCAATGGATCCTCGTTA-3′。

The primer of amplification MxHA7 gene is as follows:

RT-F1：5′-GCTATGCCAACTGTTCTTTCTGTC-3′；

RT-R1：5′-ATCACTGCATAGAACATCCATCC-3′。

What the consumption of adjustment template adopted is regular-PCR.Reaction system (20 μ l): ddH ₂O 7.0 μ l, Taq Mix (0.5U/ μ l) 10 μ l, 18SR-F (10mM) 1.0 μ l, 18SR-R (10mM) 1.0 μ l, template 1.0 μ l.Reaction conditions: 95 ℃ of sex change 5s, 55 ℃ of annealing 30s, 72 ℃ of extensions 30s, totally 40 circulations.

Quantitative fluorescent PCR is adopted in the genetic expression component analysis.The step of quantitative fluorescent PCR three-step approach is: 95 ℃ of denaturation 30s; Then 95 ℃ of sex change 5s, 55 ℃ of annealing 30s, 72 ℃ of extensions 30s, totally 40 circulations; Last 95 ℃ of 15s, 60 ℃ of 1min, 95 ℃ of 15s.

The relative expression quantity of target gene passes through 2- ^{△ △ CT}Method determines that (concrete operations: the ratio of the expression amount of the expression amount of MxHA7 gene and 18s gene is as the relative expression quantity of MxHA7 gene in the same template, in mapping, the expression amount of 0 moment gene is considered as 1, thereby observe out the expression amount of different time gene more intuitively), the results are shown in Figure 2.The MxHA7 gene has expression in root and blade, and the expression amount in root is slightly higher than the expression amount in blade.Iron deficiency is induced in the 12h, and the expression amount of MxHA7 gene significantly strengthens in the root, and expression amount descends and a series of fluctuation occurs afterwards.In blade, induce the increase in treatment time along with iron deficiency, the expression amount of MxHA7 gene strengthens, and reaches the highest during by the 3rd day, and expression amount descends afterwards.Experimental result shows, plant is to increase the adaptive of resistance to iron deficiency by the MxHA7 gene of regulating in root and the blade.

Three, the Subcellular Localization of MxHA7 gene

1, the transient expression Vector construction of MxHA7 gene and eGFP fusion

Iron deficiency induces the cDNA of the malus xiaojinensis root behind the 12h as template in the step 2, the primer pair that uses F1 and R1 to form carries out pcr amplification, obtain pcr amplification product (for sequence 2 in the sequence table from 5 ' terminal 1-2898 position Nucleotide, but also in direct labor's composition sequence table sequence 2 from the dna fragmentation shown in the 5 ' terminal 1-2898 position); Described pcr amplification product and pEASY-T1 sample (available from full Shi Jin biotech firm) are connected, obtain cutting and reclaim enzyme with restriction enzyme KpnI and ApaI enzyme behind the recombinant plasmid and cut product; Cut pEZS-NL carrier (available from full Shi Jin Bioisystech Co., Ltd) with restriction enzyme KpnI and ApaI enzyme, reclaim carrier framework (approximately 5680bp); Described enzyme is cut product and is connected the carrier framework connection, obtain transient expression carrier pEZS-MxHA7.

Transient expression carrier pEZS-MxHA7 is transformed e.colistraindh5α, and the positive spot of picking carries out bacterium colony PCR successively, enzyme is cut and identified and sequence verification.Sequencing result shows, inserted in the sequence table sequence 2 from the dna fragmentation shown in the 5 ' terminal 1-2898 position, the eGFP gene fusion on this dna fragmentation and the pEZS-NL carrier between the KpnI of pEZS-NL carrier and ApaI restriction enzyme site.

2, adopt particle bombardment to carry out the transient expression carrier to the conversion of onion epidermis cell

(1) preparation of onion epidermis to be transformed

Under aseptic condition, the entocuticle of the onion of tearing is tiled in the culture dish that contains the MS substratum, then wraps culture dish for subsequent use with masking foil.

(2) preparation of bronze suspension

Take by weighing the 60mg bronze, put into the centrifuge tube of 1.5ml sterilization, add the 1ml dehydrated alcohol, concussion 1min, the centrifugal 10s of 10000rpm abandons supernatant, adds the 1ml dehydrated alcohol again, concussion 1min, the centrifugal 10s of 10000rpm; Abandon supernatant, bronze is suspended from the 1ml sterilized water, obtain bronze suspension ,-20 ℃ save backup.

(3) preparation of bronze-plasmid dna complex zoarium

Draw 8.5 μ l bronze suspension, 3.5 μ l 0.1M nitrosamine, 8.5 μ l 2.5M CaCl ₂2H ₂O and 5 μ l transient expression carrier pEZS-MxHA7 are with the 3min that vibrates on the mixture earthquake device; The centrifugal 20s of 10000rpm; Abandon supernatant, with dehydrated alcohol rinsing 3 times; Add 30 μ l dehydrated alcohols and suspend, obtain bronze-plasmid dna complex fit.

(4) bombardment receptor material

Select the pressure membrane of certain pressure, soaked 1-2 hour in 70% dehydrated alcohol with the bombardment film, taking-up is dried; The metal plate washer is sterilized at spirit lamp after with 70% soaked in absolute ethyl alcohol; Get 10 μ l bronzes-plasmid dna complex fit, evenly coat on the mid-way of bombardment film, the area of coating is consistent with the pore diameter range on the carrier solid circle; After film dried, be installed on the launching device; Pressure membrane is installed to the lower end of gas accelerator; Onion epidermis cell places the middle part of culture dish, puts into vacuum chamber, takes off the culture dish lid; Vacuumize pointer to 26; Exit on gas accelerator, until pressure reaches in the time of can splitting the pressure that film can bear in the pipe, can split film and break, gas is flushed on the bombardment film, and carrier moves downward, and is blocked by the metal plate washer, and following metallic particles sees through the mesh of metal plate washer, directive target cell.

(5) Fluirescence observation

Culture dish is sealed with Parafilm, cultivated 24h for 28 ℃, in the expression of fluorescence microscopy Microscopic observation green fluorescence, adopting uses the same method processes pEZS-NL carrier (control plasmid).The result is (A is the bright field photo of pEZS-NL carrier, and B is the dark field photo of pEZS-NL carrier, and C is the bright field photo of transient expression carrier pEZS-MxHA7, and D is the dark field photo of transient expression carrier pEZS-MxHA7) as shown in Figure 3.The result shows, the MxHA7 protein localization is on plasma membrane.

The acquisition of experimental example 2, transgenic yeast and the analysis of anti-heavy metal toxicity thereof

One, the acquisition of transgenic yeast

1, with the transient expression carrier pEZS-MxHA7 of preparation among restriction enzyme KpnI and the XbaI enzyme cutting embodiment 1, reclaims enzyme and cut product (approximately 3618bp).

2, with restriction enzyme KpnI and XbaI enzyme cutting pYES2.0 plasmid (Yeast expression carrier, Beijing DingGuo ChangSheng Biology Technology Co., Ltd), reclaim carrier framework (approximately 5900bp).

3, the enzyme of step 1 is cut the carrier framework connection that product is connected with step, obtained recombinant expression vector pYES2.0-MxHA7.

4, utilize yeast conversion test kit (general Jino, Beijing Science and Technology Ltd.) that recombinant expression vector pYES2.0-MxHA7 is imported yeast strain BJ2168, obtain transgenic yeast BJ2168/pYES2.0-MxHA7.

5, the structure of control plasmid

(1) pEASY-T1 sample is cut and reclaims small segment (approximately 109bp) with restriction enzyme KpnI and ApaI enzyme.

(2) cut the pEZS-NL carrier with restriction enzyme KpnI and ApaI enzyme, reclaim carrier framework (approximately 5680bp).

(3) small segment of step (1) is connected 2 with step) carrier framework connect, obtain recombinant plasmid.

(4) with the recombinant plasmid of restriction enzyme KpnI and XbaI enzyme cutting step (3), reclaim small segment (approximately 829bp).

(5) with restriction enzyme KpnI and XbaI enzyme cutting pYES2.0 plasmid, reclaim carrier framework (approximately 5900bp).

(6) small segment with step (4) is connected with the carrier framework of step (5), obtains recombinant expression vector pYES2.0-eGFP.

7, utilize yeast conversion test kit (general Jino, Beijing Science and Technology Ltd.) that recombinant expression vector pYES2.0-eGFP is imported yeast strain BJ2168, obtain transgenic yeast BJ2168/pYES2.0-eGFP.

8, transgenic yeast BJ2168/pYES2.0-MxHA7 is carried out bacterium colony PCR and identify (primer pair that adopts F1 and R1 to form).The result is (M is the dna molecular amount standard of DL15000bp, and swimming lane 3 is transgenic yeast BJ2168/pYES2.0-MxHA7, and swimming lane 1 is transgenic yeast BJ2168/pYES2.0-eGFP, and swimming lane 2 is yeast strain BJ2168) as shown in Figure 4.

Two, P type H in the yeast ⁺The mensuration of-ATPase enzymic activity

H ⁺-ATPase enzyme activity determination method is with reference to the people's such as E.Nso yeast cell plasma membrane H ⁺-ATPase activity determination method (E.Nso, A.Goffeau and J.-P.Dufour.Fluctuations during growth of theplasma membrane H+-ATPase activity ofSaccharomyces cerevisiaeandSchizosaccharomyces pombe.Folia Microbiol.2002,47:401-406.).

Yeast strain BJ2168 can't grow on the defective type substratum.

Respectively transgenic yeast BJ2168/pYES2.0-MxHA57 and transgenic yeast BJ2168/pYES2.0-eGFP are carried out following experiment:

1, adopts the defective type substratum, culturing yeast spend the night (usually cultivating 18h) under 30 ℃, 200rpm condition.

2, with the centrifugal 5min of bacterium liquid 2000rpm of 3mL step 1, collect thalline and wash thalline (do not contain glucose in the used substratum, other component is with the defective type substratum).

3, the thalline with step 2 is seeded to the 50mL inducing culture, cultivates under 30 ℃, 200rpm condition, until bacterium liquid OD ₆₀₀Be 1.

4, utilize fungi/yeast cell film vesica (RSOV and IOV) preparation test kit (the outstanding U.S. gene in Shanghai Pharmaceutical Technology Co., Ltd) to extract the plasmalemma protein of yeast.

5, with bovine serum albumin be the concentration of the plasmalemma protein of standard substance determination step 4 extractions.

6, detect P type H ⁺The precursor of-ATPase enzymic activity is 1ml, comprises following material: 6mmol/L ATP, 9mmol/L MgCI ₂6H ₂O, 50mmol/L MES; PH6.0 (regulating with NaOH).In front system, add 2 μ g plasmalemma proteins, hatch 30min under 30 ℃, the SDS aqueous solution termination reaction that adds afterwards 3mL 1g/100mL, with the absorbance value (A) under the spectrophotometer detection 820nm, (y=0.8434x-0.0269 is x wherein: the burst size of inorganic phosphorus according to the inorganic phosphorus typical curve, y: light absorption value) calculate the burst size of the inorganic phosphorus under the different light absorption values, the inorganic phosphorus that the higher explanation of absorbance value discharges is more, thereby determines P type H ⁺-ATPase enzymic activity.

Revision test is set three times, results averaged.The absorbance value of transgenic yeast BJ2168/pYES2.0-MxHA7 is 0.381.The absorbance value of transgenic yeast BJ2168/pYES2.0-eGFP is 0.190.

The result as shown in Figure 5, the light absorption value of transgenic yeast BJ2168/pYES2.0-MxHA7 is higher than transgenic yeast BJ2168/pYES2.0-eGFP, has illustrated that more inorganic phosphorus discharges.The result shows, after importing and expressing the MxHA7 gene, and the P type H of yeast ⁺-ATPase enzymic activity strengthens greatly.

Three, the existence situation of transgenic yeast in the iron deficiency environment

Yeast strain BJ2168 can't grow on the defective type substratum.

Respectively transgenic yeast BJ2168/pYES2.0-MxHA57 and transgenic yeast BJ2168/pYES2.0-eGFP are carried out following experiment:

1, adopt defective type substratum culturing yeast under 30 ℃, 200rpm condition to spend the night (usually cultivating 18h) the suppressed expression of goal gene this moment.

2, with the centrifugal 5min of bacterium liquid 2000rpm of 3mL step 1, collect thalline and wash thalline (do not contain glucose in the used substratum, other component is with the defective type substratum).

3, the thalline with step 2 is seeded to the inducing culture that 50mL contains 40 μ M Ferrozine, cultivates under 30 ℃, 200rpm condition, until bacterium liquid OD ₆₀₀Be to begin timing at 1 o'clock, measure respectively the OD600 value of 0h, 12h, 24h, 48h, 60h, 72h.

Revision test is set three times, results averaged.Transgenic yeast BJ2168/pYES2.0-MxHA7 is than fast many of the growth of transgenic yeast BJ2168/pYES2.0-eGFP.The results are shown in Figure 6.The result shows, after importing and expressing the MxHA7 gene, yeast strengthens greatly to the tolerance of iron deficiency.

The acquisition of embodiment 3, transgenic plant and evaluation

One, the structure of recombinant expression vector

1, with restriction enzyme KpnI and XbaI enzyme cutting transient expression carrier pEZS-MxHA7, reclaims enzyme and cut product (approximately 3618bp).

2, according to the sequences Design two ends of 35S promoter respectively with primers F 3 and the R3 of EcoRI and KpnI.Cut transient expression carrier pEZS-MxHA7 as template take enzyme, the primer pair that forms with F3 and R3 carries out pcr amplification, reclaims approximately 1000bp pcr amplification product.

F3：5’-CCGGAATTCCAATCCCACCAAAACCTGA-3’；

R3：5’-TTCGAGCTCCGTGTCCTCTCCAAATGAAA-3’。

3, with the pcr amplification product of restriction enzyme EcoRI and KpnI double digestion step 2, reclaim enzyme and cut product.

4, with restriction enzyme EcoRI and KpnI double digestion pCAMBIA2300 plasmid (Beijing DingGuo ChangSheng Biology Technology Co., Ltd), reclaim carrier framework (approximately 8742bp).

5, the enzyme of step 3 is cut the carrier framework connection that product is connected with step, obtained recombinant plasmid.

6, with the recombinant plasmid of restriction enzyme KpnI and XbaI enzyme cutting step 5, reclaim carrier framework (approximately 10063bp).

7, the enzyme of step 1 is cut the carrier framework connection that product is connected with step, obtained recombinant expression vector pCAMBIA2300-35sMxHA7.

Two, the structure of control plasmid

1, pEASY-T1 sample is cut and reclaims small segment (approximately 109bp) with restriction enzyme KpnI and ApaI enzyme.

2, cut the pEZS-NL carrier with restriction enzyme KpnI and ApaI enzyme, reclaim carrier framework (approximately 5680bp).

The carrier framework of 3, the small segment of step 1 being connected with step connects, and obtains recombinant plasmid.

4, with the recombinant plasmid of restriction enzyme KpnI and XbaI enzyme cutting step 3, reclaim small segment (approximately 829bp).

5, with 2 of step 1.

6, with 3 of step 1.

7, with 4 of step 1.

8, with 5 of step 1.

9, with 6 of step 1.

The carrier framework of 10, the small segment of step 4 being connected with step connects, and obtains recombinant expression vector pCAMBIA2300-eGFP.

Three, the acquisition of transgenic plant

1, utilizes freeze-thaw method that recombinant expression vector pCAMBIA2300-35sMxHA7 is imported agrobacterium tumefaciens GV3101, obtain the Agrobacterium of recombinating.

2, transform the processing of front plant

AHA7 mutant Arabidopis thaliana (is called for short SALK-042485; Available from Ohio State Univ-Columbus USA Arabidopis thaliana Biological resources center, network address: when http://www.arabidopsis.org/index.jsp) plant grows to the high 3cm of stem, remove its terminal inflorescence (giving birth to the growth of inflorescence to stimulate leaf), (the living inflorescence of leaf this moment grows, and the flower of its underpart is polliniferous appearance) transforms behind the 5-7d.Transform to water the day before yesterday permeable, the flower of cutting the angle fruit and having opened.

3, the Agrobacterium of will recombinating is inoculated in the 5ml YEB liquid nutrient medium (containing 50 μ g/ml kantlex and 10 μ g/ml Rifampins), cultivate 24-36h for 28 ℃, be transferred in the 200mlYEB substratum with 1: 50 volume ratio, be cultured to the OD600 value and be 1.2-1.6, the centrifugal 10min of 4500rpm collects thalline, with permeating in right amount substratum (sucrose of 1/2MS+5%+0.02% SilwetL-77) suspension thalline to OD ₆₀₀Value is bacteria suspension for 0.6-0.8.

4, the acquisition of transgenic arabidopsis and screening

The bacteria suspension of step 3 is poured in the small beaker, the spending of Arabidopis thaliana of step 2 immersed 3-5min in the suspension, guarantee that the above part of lotus throne leaf is dipped in (immersion 5min in the suspension, as seen on the plant thin film is arranged), soaked Arabidopis thaliana plant is taken out, and then lucifuge traverse 16-24h is put it just, pinion loose bud and cultivation, get T0 for the Arabidopis thaliana plant.T0 is extremely solid for the Arabidopis thaliana plant cultivating, and the results mature seed is T1 for the Arabidopis thaliana seed.With T1 for the Arabidopis thaliana planting seed in 1/2MS substratum (contain 50 μ g/ml cards receive mycin), 4 ℃ vernalization 2-3 days, 22 ℃ of cultivations obtain 25 strain T1 for the Arabidopis thaliana plant.

Extract T1 for the Arabidopis thaliana plant, extract genomic dna, take genomic dna as template, with the primer pair (F2:GTCCTCCTCATTATCAATTCTACCA of F2 and R2 composition; R2:AAAGTTTCCAATTGACGTTAATACC) carry out pcr amplification, the electrophorogram of part pcr amplification product is seen Fig. 7.Among Fig. 7, swimming lane M is the dna molecular amount standard of DL2000bp Plus, swimming lane 1 to swimming lane 7 be fractional t1 for the Arabidopis thaliana plant ,+CK is recombinant expression vector pCAMBIA2300-35sMxHA7 ,-CK is SALK-042485.Cut glue and reclaim purpose band and order-checking, filter out altogether 18 strain T1 for transgenic arabidopsis.

T1 for transgenic arabidopsis individual plant sowing, is obtained T2 Arabidopis thaliana seed, be plant with T2 for the Arabidopis thaliana cultivating seeds and carry out identical PCR and order-checking is identified, meet 3: 1 separation ratio through chi square test.

For the sequencing result of plant and the sequencing result of 2nd generation plant, obtain 10 transgenic arabidopsis strains of isozygotying (successively called after 1# to 10#) according to T1.

The T2 of the transgenic arabidopsis strain of will isozygotying obtains T3 for the transgenic arabidopsis seed for plant individual plant sowing.

5, recombinant expression vector pCAMBIA2300-eGFP is replaced recombinant expression vector pCAMBIA2300-35sMxHA7 carry out the operation of step 1 to 4, obtain T0 generation and turn empty carrier Arabidopis thaliana, T1 generation and turn that empty carrier Arabidopis thaliana, T2 generation turns the empty carrier Arabidopis thaliana and T3 generation turns the empty carrier Arabidopis thaliana.

Four, T3 observes at low iron substratum (4uM Fe-EDTA) and the normal upper Fluirescence observation of iron substratum (100uMFe-EDTA) and the growing state of supplying for transgenic arabidopsis

Choose at random 2 Transgenic wheat lines (homozygous lines 1# and homozygous lines 8#), the T3 of 2 Transgenic wheat lines (each strain 10 strain) carried out following evaluation for seed, the T3 that turns empty carrier Arabidopis thaliana (10 strain) for seed and SALK-042485 (10 strain) seed:

Seed is grown a week (seed is sprouted) at the 1/2MS substratum.Then plant is divided into two groups, every group of 5 strains, be handled as follows respectively: first group moves into low iron substratum (the 1/2MS substratum that contains 4 μ M Fe-EDTA) cultivation, and second group of immigration normally cultivated for iron substratum (the 1/2MS substratum that contains 100 μ M Fe-EDTA).

Process after 3 days, carry out Fluirescence observation with the fluor visor.First group partial results is seen Fig. 8 (A is homozygous lines 1#, and B is SALK-042485).The result of homozygous lines 8# is consistent with homozygous lines 1#.Turn the empty carrier Arabidopis thaliana consistent with the result of SALK-042485.Under the iron deficiency environment, the eGFP fluorescence intensity of transgenic arabidopsis is obviously than turning being eager to excel of empty carrier Arabidopis thaliana and wild-type Arabidopis thaliana, and at Ye Zhongye faint fluorescence appearance arranged.

Process after 3 days, observe the growing state of seedling, first group Part of photos taken is seen Fig. 9 (A is SALK-042485, and B is homozygous lines 1#).The result of homozygous lines 8# is consistent with homozygous lines 1#.Turn the empty carrier Arabidopis thaliana consistent with the result of SALK-042485.Under the iron deficiency environment, the growing state of transgenic arabidopsis is better than turning empty carrier Arabidopis thaliana and wild-type Arabidopis thaliana, and the transgenic arabidopsis plant strain growth is good, blade is light green, and etiolation has obviously appearred in the blade that turns empty carrier Arabidopis thaliana and wild-type Arabidopis thaliana.The result shows, turns the anti-Fe Deficiency that the MxHA7 gene can better improve plant.

Claims (13)

1. protein, the protein that is formed by the aminoacid sequence shown in the sequence in the sequence table 1.

2. the gene of coding claim 1 described albumen.

3. gene according to claim 2, it is characterized in that: described gene is following 1)-4) in the described dna molecular of any one:

1) in the sequence table sequence 2 from the dna molecular shown in 5 ' terminal the 1st to 2898 Nucleotide;

2) dna molecular shown in the sequence 2 in the sequence table;

3) under stringent condition with 1) or 2) shown in dna molecule hybridize and the dna molecular of encoding said proteins;

4) with 1) or 2) or 3) gene have similarity more than 90% and the dna molecular of encoding said proteins;

Above-mentioned stringent condition is in the solution of 0.1 * SSPE or 0.1 * SSC, 0.1%SDS, hybridization and wash film under 65 ℃ of conditions.

4. the expression cassette that contains claim 2 or 3 described genes.

5. the transgenic cell line that contains claim 2 or 3 described genes.

6. the recombinant expression vector that contains claim 2 or 3 described genes.

7. recombinant expression vector according to claim 6, it is characterized in that: described recombinant expression vector is following (I) or (II) or (III):

(I) inserts the recombinant expression vector that claim 2 or 3 described genes obtain between the multiple clone site of pEZS-NL carrier;

(II) inserts the recombinant expression vector that claim 2 or 3 described genes obtain between the multiple clone site of pYES2.0 plasmid;

(III) inserts the recombinant expression vector that claim 2 or 3 described genes obtain between the multiple clone site of pCAMBIA2300 plasmid.

8. the recombinant bacterium that contains claim 2 or 3 described genes.

9. recombinant bacterium according to claim 8 is characterized in that: the recombinant bacterium of described recombinant bacterium for obtaining in (II) of claim 7 described recombinant expression vector importing yeast.

10. method that obtains genetically modified organism, for 1. following or 2.:

1. claim 2 or 3 described genes are imported in the biology that sets out, obtain the genetically modified organism that P type H+-ATPase enzymic activity increases;

2. claim 2 or 3 described genes are imported in the biology that sets out, obtain the genetically modified organism that anti-iron deficiency ability strengthens;

Described set out biological be yeast or dicotyledons.

11. method according to claim 10 is characterized in that: step 1. in, claim 2 or 3 described genes import the described biology that sets out by (II) of claim 7 described recombinant expression vector.

12. method according to claim 10 is characterized in that: step 2. in, claim 2 or 3 described genes import the described biology that sets out by (III) of claim 7 described recombinant expression vector.

13. arbitrary described method according to claim 10-12 is characterized in that: described dicotyledons is Arabidopis thaliana.

Images